Wikipedia To Host Human Gene Repository
schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."
It says that gene #45A79 controls glowing in the dark! It must be true!
the article states that the researchers hope to speed up research by doing this, and goes on to say that they're using a computer program to copy the information into Wikipedia... If the only thing they are doing is copying data to Wikipedia, how will this speed up research? It's against Wikipedia's rules to post original research, so I'm assuming this is all they CAN do. While it is neat, I'm not sure I understand how this will speed up new research...
TAGGATTACACCT
Yo Yo I gots my GAT
rat a tat tat anotha nigga on his BAAACK
Steve W sucks cock! lol!!!1
16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)
I've seen enough errors, sloppiness, and outright sabotage on Wikipedia to be highly skeptical when, as TFA says,
What safeguards will be in place to make sure the information in this Wiki is trustworthy and reliable? Think for a moment about the potential consequences.
[Sir Garlon] is the marvellest knight that is now living, for he destroyeth many good knights, for he goeth invisible.
Nice try guys, but I think this is doomed to fail due to the time pressures that most experts who would be able to contribute to this wiki operate under.
Heh. The type of graffiti that will be put on these sites should be good. I can see it now...
Title: Bill Gates Genome
ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG
Title: Linus Torvalds Genome
ATTATATACGYAYOPENSOURCETAGCCGCGATCG
Title: Cowboy Neal Genome
ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT
Whenever they talk about these human genome projects (including the guys who can sequence it in a matter of weeks) I always wonder whose genome they're talking about. How long before this become a privacy issue?
SNPedia has been around since August 2006. It's just for SNPs, not entire genes, and focuses on SNPs used in commercial testing, but the layout of SNPedia and the proposed wiki in the paper are fairly similar.
A totally artificial human from the pieces I steal from Gene Wiki. It will be able to tap dance and sing too.
I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."
I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."
The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!
Any technology distinguishable from magic is insufficiently advanced.
I, for one, have faith that in the true spirit of wiki, it will be worked, reworked, improved pon, and cross-referenced until it is as good as any reference work.
I think this project will end up giving more credibility to the wiki way.
If video games influenced behavior the Pac Man generation would be eating pills and running away from their problems.
That when the genome's posted on Wikipedia it'll be pretty easy to find out exactly which gene contains the gene for Wolverine's super healing mutation.
Am I the only one who thinks this "map" should be on Google maps instead of Wikipedia?
I for one would love to see a "You Are Here" Google pin in the gene pool...
Link
In case anybody wanted to look at it on Wikipedia.
Hello Markov bot. Would you like to add some coherence please?
This won't last long. On wikipedia, a very notable personality or topic can be removed with little justification other than "not notable" while every single minor pokemon character gets a full ten page writeup.
Mark the human genome for deletion due to lack of notability!
And I shall call this flexible, organic archive of human genetic information a "cell."
This is a good idea on many fronts. One if this is open and collaborative it cannot be instantly monetized. It can perhaps in the way linux can, but still it has the spirit of the open-source community behind it. Two, information sharing is a good thing. If there are twenty separate universities working on this project independently, think of how much productivity loss happens. Instead, when they collaborate and share information in a formal manner, everyone wins. Third, if there is open information sharing, it is a lot more simple to establish guidelines for using and monetizing this information. This is interesting and I think should be followed closely.
The science article where the approach is described in detail is this one: "A Gene Wiki for Community Annotation of Gene Function", http://dx.doi.org/10.1371/journal.pbio.0060175 It has just come out in PLoS Biology, - an open access journal. The researchers/wikipedians have constructed a script called "Protein box bot" that runs on (the real) Wikipedia. It creates images and writes text, for example links to NCBI. The bot can do this both for existing articles, such as this one: http://en.wikipedia.org/wiki/HTR2A, or it can create new articles with a the box, a small summary and references. The "gene wiki" is making an impact on the science part of Wikipedia. I counted the number of outbound scientific citations from Wikipedia, and the new ones that the bot has created are now the majority. The details of this count are here: http://www2.imm.dtu.dk/pubdb/views/publication_details.php?id=5666
Wikipedia already hosts a comprehensive gene repository:
Please ignore this portion of the comment, I am trying to get around the "too few characters per line" filter. Your comment has too few characters per line. Your comment has too few characters per line. Your comment has too few characters per line. Your comment has too few characters per line. Your comment has too few characters per line.
I like my coffee the way I like my women - roasted and ground up into little tiny pieces.
If these articles are being automatically posted, they may run in contravention with bot editing rules; see "Wikipedia:Bots".