Wikipedia To Host Human Gene Repository

schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."

Comments

I saw it on Wikipedia

[omnichad]

It says that gene #45A79 controls glowing in the dark! It must be true!

Re:I saw it on Wikipedia

[voltel]

Like we're fooled Anonymous Coward! Your just trying to make yourself look good after that epic fail!

GATTA

[BadAnalogyGuy]

TAGGATTACACCT

Yo Yo I gots my GAT
rat a tat tat anotha nigga on his BAAACK

Steve W sucks cock! lol!!!1

16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)

Re:Original research?

[Chyeld]

Citation needed? ^_^

Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

Re:Original research?

[omnichad]

Well...anyone can post a gene. That means more information, right? I've already made up 50.

What could possibly go wrong?

[SirGarlon]

I've seen enough errors, sloppiness, and outright sabotage on Wikipedia to be highly skeptical when, as TFA says,

The stub articles are expected to seed the posting of more detailed information by Wikipedia users.

What safeguards will be in place to make sure the information in this Wiki is trustworthy and reliable? Think for a moment about the potential consequences.

Re:What could possibly go wrong?

[jesdynf]

Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

Re:Original research?

[philspear]

I could be wrong, but doesn't wiki allow you to submit your research as long as it's been published somewhere you can reference? If you discover a gene, you're going to publish it somewhere you can put on your CV.

Anyway, this will be pretty redundant. NCBI already has a gene database that is well crosslinked.

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene

As this database is powered by published research and updated by a government sponsored organization, it also cannot easily be vandalized, unlike wiki.

Lastly, a lot of researchers put information about their favorite gene up on wiki currently.
Example: reelin. I couldn't help noticing the last time I looked that one of the major contributors was referencing her own (peer-reviewed published) research on reelin.

Editing the Human Genome

[D Ninja]

Heh. The type of graffiti that will be put on these sites should be good. I can see it now...

Title: Bill Gates Genome
ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG

Title: Linus Torvalds Genome
ATTATATACGYAYOPENSOURCETAGCCGCGATCG

Title: Cowboy Neal Genome
ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT

Oh, no you don't!

[Illbay]

I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."

I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."

The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!

Re:Original research?

[Insightfill]

Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

Should we perhaps call it a gene pool?