Wikipedia To Host Human Gene Repository
schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."
It says that gene #45A79 controls glowing in the dark! It must be true!
Citation needed? ^_^
Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?
I could be wrong, but doesn't wiki allow you to submit your research as long as it's been published somewhere you can reference? If you discover a gene, you're going to publish it somewhere you can put on your CV.
Anyway, this will be pretty redundant. NCBI already has a gene database that is well crosslinked.
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene
As this database is powered by published research and updated by a government sponsored organization, it also cannot easily be vandalized, unlike wiki.
Lastly, a lot of researchers put information about their favorite gene up on wiki currently.
Example: reelin. I couldn't help noticing the last time I looked that one of the major contributors was referencing her own (peer-reviewed published) research on reelin.
Heh. The type of graffiti that will be put on these sites should be good. I can see it now...
Title: Bill Gates Genome
ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG
Title: Linus Torvalds Genome
ATTATATACGYAYOPENSOURCETAGCCGCGATCG
Title: Cowboy Neal Genome
ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT