Slashdot Mirror


DNA Strands Modified Into Tiny Fiber-Optic Cables

holy_calamity writes "New Scientist reports on the latest idea from researchers trying to make microcomputers use photons in place of electrons — to make optical interconnects from strands of DNA. Mixing DNA strands with the right dye molecule upgrades them into wires for light, like microscopic optical fibers, able to absorb photons at one end and transmit them to the other. One of the neat things about using DNA is it is the right scale to play nicely with existing and future chip lithography. Quoting: 'The result is similar to natural photonic wires found inside organisms like algae, where they are used to transport photons to parts of a cell where their energy can be tapped. In these wires, chromophores are lined up in chains to channel photons.'"

113 comments

  1. Robots by pipatron · · Score: 4, Funny

    Ok great, yeah, give the robots DNA too. Like we'll have any chance now.

    --
    c++; /* this makes c bigger but returns the old value */
    1. Re:Robots by grimmfarmer · · Score: 2, Funny

      Worse, yet: will hard-up DNA farmers now begin selling their crops at a premium to industry, diverting crucial DNA from where it's needed most: the third world?

    2. Re:Robots by Smivs · · Score: 2, Funny

      I for one will welcome the arrival of our photon-brained cyborg overlords.

    3. Re:Robots by Anonymous Coward · · Score: 0

      Second that notion...now it's not so hard for me to imagine how machines will morph into self-aware creatures!

    4. Re:Robots by Cyanara · · Score: 1

      It's cool, it's cool. We'll just make them all female and irradiate the reproductive organs so they can't breed. Just as long as we don't use frog DNA...

    5. Re:Robots by Anonymous Coward · · Score: 0

      were gana get owned

  2. Right scale... by morgan_greywolf · · Score: 2, Interesting

    Hmmm...I'm no biologist, but I'll bet it's the right scale for human-implanted computing. Wow. Be afraid...very afraid...

    1. Re:Right scale... by elp · · Score: 3, Insightful

      You be afraid. I can't wait. Oh the trans-humanity!

    2. Re:Right scale... by philspear · · Score: 1

      I'm no biologist, but I'll bet it's the right scale for human-implanted computing.

      I'm no... er... bio-computerist... person... but if you had naked DNA strands running through your body linking computers or something like that, they wouldn't last very long. For one thing, they'd get broken just by moving around. Also, this YO they need to add onto DNA strands actually interacts with the DNA. I don't know if it would be able to penetrate your cell nuclei to interact with your own DNA, but if it did that would increase your risk of cancer.

      So... yes, be afraid, because not only would it not work, you'd get cancer!

  3. Cylons by dragin33 · · Score: 1

    This will be the beginning of the Cylons..

    1. Re:Cylons by Anonymous Coward · · Score: 0

      If we can build them to look like Tricia Helfer or Grace Park and then mass produce them, there will be a lot of female-ignored nerds that will be happy.

      At least for a little while, anyway....

  4. Damn! by Anonymous Coward · · Score: 5, Funny

    We had this ability already built into our biology and we instead use chemical signals for our nervous system? It is a pity we didn't have an intelligent designer (one with degrees in electrical engineering and physics).

    1. Re:Damn! by Xerxes333 · · Score: 4, Funny

      Perhaps the intelligent designer chose the "home" edition rather than the "professional" edition and we are in breach of some universal EULA.

      --
      "Never underestimate the power of stupid people in large numbers"
    2. Re:Damn! by Anonymous Coward · · Score: 0

      I thought we were all distributed under an open source license. Aren't we allowed to view and modify the code for our own purposes?

    3. Re:Damn! by Eternauta3k · · Score: 1

      Code? All we have is the hex (quaternary, rather) code, and a crude disassembly (the aminoacids that correspond to each triplet). That's like saying a hexdump of an executable counts as code. God is a closed-source monopolist!

      --
      Yeah. Would you choose a neurosurgeon who pokes around people's brains in his spare time? I wouldn't.
    4. Re:Damn! by SinGunner · · Score: 1

      Maybe we are the platform upon which he is designing. Program intelligently using new Human++ on Rails!

    5. Re:Damn! by Skysurfer27 · · Score: 1

      I thought we were all distributed under an open source license. Aren't we allowed to view and modify the code for our own purposes?

      I haven't found any documentation yet, but it seems there are many people working very hard to reverse engineer the code. So I think that means we are running proprietary software. We better watch out though, if we are caught breaking the EULA they might terminate all running code....

  5. The organisation of life by Kupfernigk · · Score: 5, Interesting
    This is yet more evidence, if it was needed, that there is something about carbon chemistry that facilitates the emergence of life. Once you have a DNA or RNA molecule, organisation and replication of small molecules seems to emerge almost from nowhere. This evidence that even a concept as significant as photon collecting and channelling could emerge out of a largely self-organising process is quite extraordinary, because it starts to answer the objections of Creationists to, for instance, the evolution of light sensitivity. Given the sheer vastness of geological time, the range of environments on even a minor planet going around a mid-rank star, the opportunities for something to get started are enormous. It's a kind of corollary to Murphy's law: in a sufficiently large system, given long enough, practically anything possible is going to happen at some point.

    This of course is not evidence for or against any kind of theology in general, because theology is a much more diverse (and interesting) subject than the Creationists and IDers would have you believe. But it does look as though the question "how did life get started", which is vague and ill defined, is gradually resolving down to the question "under what circumstances can ribose nucleic acids form spontaneously, and how many other small molecules can we find which can spontaneously arrange themselves in the presence of ribose nucleic acids?" which is testable.

    --
    From scarped cliff or quarried stone she cries "A thousand types are gone, I care for nothing, no not one."
    1. Re:The organisation of life by Mindcontrolled · · Score: 1

      Carbon chemistry being extraordinarily well-suited for the emergence of complex systems, in particular life, is not exactly a new idea, though. Carbon chemistry simply offers the broadest range of thermodynamically stable, complex compounds. I'd go as far as to rule out any other chemical basis for life. Closest candidate would be possibly Silicon, but it still has a way too limited chemical flexibility to allow for the emergence of complexity, in my opinion.

      --
      Ubi solitudinem faciunt, pacem appellant.
    2. Re:The organisation of life by gilleain · · Score: 1

      I'd go as far as to rule out any other chemical basis for life.

      Agreed. I would go even further and suggest that DNA/RNA/protein are the only possibilities for living systems.

      Of course, chemical space is very large, but there is a relatively small subspace that is (bio)synthetically accessible. Further, there is an even smaller region that is self-synthetically accessible. Even more, there is a tiny part that can form spontaneously on a planet, self-synthesise, and evolve.

    3. Re:The organisation of life by Anonymous Coward · · Score: 0

      I love you.

    4. Re:The organisation of life by Emb3rz · · Score: -1, Flamebait

      the question "how did life get started", which is vague and ill defined

      Any proper "IDer" should be able to contest that claim..

      And Jehovah God proceeded to form the man out of dust from the ground and to blow into his nostrils the breath of life, and the man came to be a living soul. Genesis 2:7

      Just as one would be foolish to argue the manufacturing process of something they know little about (me speaking on the topic of CPUs, for instance, would be disastrous), it is foolish for humans to argue the origins of life which we have incomplete understanding of. The explanation that has been given in the Bible is the only one whose source is decidedly not human. If we choose to disregard that, then we're submitting ourselves to futility in answering an answered question.

    5. Re:The organisation of life by OolimPhon · · Score: 2, Interesting

      The explanation that has been given in the Bible is the only one whose source is decidedly not human.

      Proof that the source is not human, please?

    6. Re:The organisation of life by Emb3rz · · Score: 1
    7. Re:The organisation of life by Doc+Ruby · · Score: 1

      Every day someone wins the lottery. They must be prophets.

      --

      --
      make install -not war

    8. Re:The organisation of life by Doc+Ruby · · Score: 1

      Creationists insist that their ability to understand all of "creation" is sharply limited. And they even celebrate those limits, elevating the limiter to omnipotent status.

      Scientists insist that they can understand practically anything they try, and demonstrate that they're right over and over in ways that everyone accepts by using, and even depending on, them.

      It is foolish for Creationists to argue the chemical and biological origins of life with scientists, who have a pretty accurate, though increasingly precise, understanding of how it happened.

      "The" bible you're claiming is sourced from someone "decidedly" (by you and other circular referencers) is contradicted by other bibles, some of which even predate your bible, some of which are more popular than your bible. Those contradictions don't get in the way of faith, which is unimpeded and unassisted by proof or evidence either for or against articles of faith. But in the material world of phenomena, outside the human mind's virtual image of it, those contradictions discredit it. Which is why everyone relies on scientists, not Creationists, to explain the world.

      If you've got Sunday off with nothing better to do, Creationism is pretty harmless. But the rest of the week, it's useless except as a personal diversion.

      --

      --
      make install -not war

    9. Re:The organisation of life by Emb3rz · · Score: 1

      Since you've clearly read the links I provided...

      The Bible had predictions (complete with details) penned hundreds, if not thousands of years in advance of their (accurate) fulfillments. The year 1914, for instance, is indicated as a significant year, the end of the seven gentile times. Anything significant happen in 1914 that you can think of...?

      Moreover, over the thousands of years that humans have had the Bible available to them, its content has not been altered beyond minor scribal changes. It has been left intact despite efforts to destroy it entirely.

      It provides the only consistently (and provably) healthful teachings for family life, work ethic, view of money, treatment of fellow man, etc..

      In short? Don't mock what you don't know.

    10. Re:The organisation of life by Emb3rz · · Score: 1

      To clarify: I am not a Creationist. As someone who has examined the physical evidence and found that the explanation of creation provided in the Hebrew and Christian Scriptures (which collection I shall consistently refer to as the Bible) is sufficient and then some, I have cause to believe in an Intelligent Designer and almighty God.

      Credulity != Faith. I have faith.

    11. Re:The organisation of life by gilleain · · Score: 1
      (Slightly edited).

      The explanation that has been given in the Bible is the only one whose source is decidedly not human. [It is] an answered question.

      To clarify: yes, you are a creationist.

      If you believe that an Intelligent Designer created life AND that the science is looking at an "answered" question, then you are a creationist.

      If you are uncomfortable with the company you keep, of Biblical literalists, then that is your problem...

    12. Re:The organisation of life by Doc+Ruby · · Score: 4, Insightful

      I read the links. For someone divinely inspired, you're not a very good guesser.

      I didn't see anything in there about "1914". Nor do I see the number "1914" anywhere in "the" bible.

      The other "bibles" I'm talking about are those held sacred (and literal) by other faiths, such as the Mahabarata and other Vedic scriptures, any number of Buddhist sutras, the oral traditions of North American tribes, the Greek, Roman or Egyptian texts and traditions, and on and on around the world. Of course you don't think of those as "the bible", but rather just some superstition, but of course their believers think the same of yours, and of each other.

      There are other things that have changed. Even the Hebrew torah changed in important ways about 2000 years ago, and there's plenty of analysis showing it changed from an original form to its form around the time of the Roman conquest in specific sections. And of course the original christian canon of over 400 different texts was reduced to the 4 in the "new testament" by a christian order about 1600 years ago. The persistence of biblical transcription and consistency through the millennia is still remarkable, but owes to the priority for exact transcription, and the fear of punishment for failure in both the living world, and the expected "afterlife". Zoroastrian gospel has been at least as consistent since about 3000 years ago, while spending its first millennium transmitted only orally, with at least as many "efforts to destroy it entirely".

      There is no evidence that "the" bible you prefer is effective for family life, work ethic, view of money, treatment of fellow man, etc. Practically no one follows the entire literal prescriptions of the bible, to the exclusion of any other source of life guidance. And there are plenty of perfectly functional and happy people who follow their own bibles, with little influence sourced from "the" bible you prefer.

      I know "the" bible, and its blindered, faithy adherents (of many denominations, many bibles), quite well, thank you. I also know science and reason, which make it easy to debunk any of the bible worshippers' contrived arguments like you've offered here. The only way that bible worship ever meets science and reason with any chance of survival is by willful blindness, or acceptance of science and reason debunking the bible except as a self-programming exercise in pure metaphysics.

      The bible's got some good lessons, co-evolving with a successful style of civilization the dominance of which self-selects for successful life strategies within its constructed values. But it's a work of humans, even if quite an excellent one. Except maybe when it doesn't matter what's true, and what you're looking for is a good story to share with other people you like, when believing it's something supernatural is harmless fun. Taking it further than that is unwarranted, and usually leads to terrible consequences fairly quickly.

      --

      --
      make install -not war

    13. Re:The organisation of life by Inner_Child · · Score: 1

      Are you seriously suggesting that we should trust the word of those who are essentially the equivalent of Amway representatives for Christianity? And let's not even get into the fact that they're trying to show that the Bible is a valid factual source using quotes from the Bible. I respect people's faith, but you really should try a little bit harder if you want to be taken seriously.

      "Act now and you too can get into Heaven! Only 144,000 spots, so be sure to act fast! This is a limited time offer, the rapture is coming!"

      --
      Today is red jello day - all workers must eat all of their red jello. Failure to comply will result in five demerits.
    14. Re:The organisation of life by bgackle · · Score: 1

      Based on the ubiquitous copyright statements in that book, I'd say the source IS quite decidedly human.

      --
      What we really need is a ten day waiting period and a background check before you can buy a congressman.
    15. Re:The organisation of life by Inner_Child · · Score: 1

      As someone who has examined the physical evidence and found that the explanation of creation provided in the Hebrew and Christian Scriptures (which collection I shall consistently refer to as the Bible) is sufficient and then some, I have cause to believe in an Intelligent Designer and almighty God.

      "Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities."

      As one who believes in creationism you are, in fact, a Creationist.

      --
      Today is red jello day - all workers must eat all of their red jello. Failure to comply will result in five demerits.
    16. Re:The organisation of life by Doc+Ruby · · Score: 2, Insightful

      There is no physical evidence of "divine creation". The whole point is that "god created the heavens and the Earth" by some miraculous act.

      You're a Creationist. You "know" that god created existence, and Adam and Eve. The way you know it is by reading a book written before you were born. You have faith in that knowledge, which means you know something that cannot be either proven or disproven.

      Others have their own faiths, like tribal Americans who believe a Creator created some garden plants, then made the first people out of them. Neither of you can prove the other is wrong, because faith is independent of proof. You're both guessing. It's sufficient for you, because you don't require proof to believe things.

      I require proof. Until I get proof, I know that knowledge is merely provisional. And I don't take any serious actions based on provisional knowledge.

      But regardless of the place for your way of knowing things, you are a Creationist. That you deny it just undermines any reason to respect the rest of what you claim to know.

      --

      --
      make install -not war

    17. Re:The organisation of life by bgackle · · Score: 2, Insightful

      Recipe for accurate prophecy:

      1) Get a list of 128 email addresses.
      2) Pick a volatile stock.
      3) Send half the list a "tip" that the stock will climb.
      4) Send the other half a "tip" that it will fall.
      5) Discard whatever half you gave bad advice to.
      6) Repeat steps 2-5, five times
      7) Send the remaining guy an email pointing out that you just picked six stock movements in a row, offer to give another tip in exchange for immortal soul and 10% of earthly income.
      8) PROPHET!!

      It's called survivor bias. When you decide which books are the holy ones and which are the heretical ones 1000 years after they get written, it's pretty easy to pick out the ones that were right.

      --
      What we really need is a ten day waiting period and a background check before you can buy a congressman.
    18. Re:The organisation of life by albyrne5 · · Score: 1

      No mod points. This is one of the best postings I've ever read on Slashdot.

    19. Re:The organisation of life by Anonymous Coward · · Score: 0

      It provides the only consistently (and provably) healthful teachings for family life, work ethic, view of money, treatment of fellow man, etc..

      In short? Don't mock what you don't know.

      The "prophecies" within the Christian Bible are gleaned AFTER THE FACT. I see you're a believer of Bible Codes, a nonsense "science" that pretends that matching up letters according to ever-changing numerical patterns somehow "awakens proof" of some "prophecies".

      Don't mock what I don't know? I know all about it, kid.

    20. Re:The organisation of life by Asklepius+M.D. · · Score: 1
      "Act now and you too can get into Heaven! Only 144,000 spots, so be sure to act fast! This is a limited time offer, the rapture is coming!"

      According to http://en.wikipedia.org/wiki/Jehovah's_WitnessesWikipedia there are "an average of 6.8 million members actively involved in preaching". Contrast that with the 144,000 belief and no matter how you crunch the numbers it means there are several million seriously deluded people subscribing to this belief system. I'm all for people believing whatever they want to believe so long as they don't try to push it on me.....so the next time someone hands you a copy of the "WatchTower" do what I do and ask if they're willing to donate their slot to improve your odds!

      --
      He who would be a man, must be a nonconformist. -- Emerson
    21. Re:The organisation of life by Emb3rz · · Score: 2, Funny

      I see you're a believer of Bible Codes

      I can only imagine you're referring to my statement regarding the year 1914. This is a number reached through chronology based on prophecy, not mystic numerical patterns.

    22. Re:The organisation of life by peragrin · · Score: 1

      except that the Christian calendar was created hundreds of years later. In fact because of miss translations(Hebrew-Greek- Latin-English) the bible as you have read it contains numerous small errors. The story of gensis isn't seven days but seven periods of time. Ranging from days to eons.

      Believing the bible without reading it in Hebrew or ancient Greek. Is for those who can't think.

      --
      i thought once I was found, but it was only a dream.
    23. Re:The organisation of life by witherstaff · · Score: 1

      If the bible is accurately predicting the future then there is no such thing as free will. The pre-determined future requires man to have no tabla rosa, our fate is given to us at birth. (Actually given to us at the time of the predictions being first given)

      Therefore why bother with healthful teachings - it's not nurture, it's nature all the way. You are who you are programmed to be, unable to change destiny one iota or the carefully scripted outcome would fall apart.

      Sounds depressing to me, I think I'll find some hedonistic pleasures to cheer up. But that's alright, that must be all part of the plan.

    24. Re:The organisation of life by Anonymous Coward · · Score: 1

      There is no prophecy in the Bible save for Revelations. Get over it.

    25. Re:The organisation of life by Anonymous Coward · · Score: 0

      I am anonymous, and I bring you modups. I also noticed an article at wikipedia that says that 666 is not the mark of the beast as it is written. In fact, almost everybody is mistaken as revelations was translated wrong from 616. I wonder how many people would still say that 666 had great significance, when it is a clerical err?

    26. Re:The organisation of life by azcoyote · · Score: 1

      You mention theology, so I figure as a theologian I should give you a reply. To start, I do not have a stance on "creationism" or "intelligent design" as such because these considerations are ultimately secondary to the fundamental question of the ultimate origin and ground of being. I assume this is why you say that "theology is a much more diverse (and interesting) subject than the Creationists and IDers would have you believe."

      While you are correct that the natural propensity for DNA or RNA to promote organization, replication, and thus complexification should be somewhat measureable, the problem is that this can ultimately have little bearing on the fundamental question of the origin of all being. By definition the ultimate origin is the answer to a question that answers it own question. It is the only answer that does not give way to an unanswered question. It is the fundamental horizon of questioning that, as a horizon, always recedes as we move toward it. What I mean by this is, granted that DNA or RNA may have a natural propensity for evolution, this propensity begs the question of why there is a propensity at all. Why is there DNA or DNA at all, why is there nitrogen at all, why do atoms and molecules have their respective natural properties? Why is there a universe at all, when it is much simpler (think Ockham) for there not to be a universe? Granted that things exist, and there is no identifiable reason that they should exist, we are pressed with the reality of a contingent existence: a reality that we have no claim on existence that strong-arms it into letting us exist. We are, and yet we could just as well not be. And if things could just as well not be, then the only answer to the question of everything is something that absolutely cannot not be.

      As long as people are content to answer questions only so far--only far enough to say that the molecules have a propensity for life, or that atoms have a propensity to be molecules--without answering why such propensities exist at all, then the fundamental question is ignored and will find no answer. Many theologians have shown well how an evolutionary mindset is not impossible or absolutely contradictory to the scriptural witness rightly understood (not according to a fundamentalist hermaneutic), but what ultimately will be affirmed by a Christian because of the creation account is that it is a creation ex nihilo (out of nothing). All of the world, then, has a beginning and an origin, and a contingency in that it might as well not exist. But God is not something of the world, not among the world, not bound by its contingencies. Theology, then, ultimately affirms that God, as the fullness of being, the one being that actualizes himself in existence, the only being that must exist and cannot not exist, confirms in existence everything else that is contingent, because everything contingent is contingent upon being itself. Thus, the necessities of natural law are only necessities given that nature exists. And this given is not an absolute given, but contingent upon creation by the absolute being.

      --
      Incipiamus, fratres, servire Domino Deo, quia hucusque vix vel parum in nullo profecimus.
    27. Re:The organisation of life by Anonymous Coward · · Score: 0

      That was an extremely long winded post for something that can be concisely stated as "my belief is better than yours." The amount of zealotry the minority has against religion can be quite humorous. You seem to have done a lot of research to support your theory that your idea is better than everyone else.

      However I will state for the record that most of the science and technology we have today came directly from people who held a firm belief in God (or the human soul and a supreme being which presides over all existence). I'm sure I'll be modded down by some agnostic for "trolling" but I figured I'd try to get this post out again.

      The list of scientific contributors who believe(d) in God far outweighs the list of those who didn't (and don't).

    28. Re:The organisation of life by pjt33 · · Score: 1

      Even the Hebrew torah changed in important ways about 2000 years ago, and there's plenty of analysis showing it changed from an original form to its form around the time of the Roman conquest in specific sections.

      Can you cite any references for this off the top of your head? I'd be interested to read more.

      And of course the original christian canon of over 400 different texts was reduced to the 4 in the "new testament" by a christian order about 1600 years ago.

      Here you lose me completely. The NT has more than 4 texts. Are you claiming that there were originally 400 accounts of the life of Jesus? That sounds rather high.

    29. Re:The organisation of life by Anonymous Coward · · Score: 0

      Well, who cares? You are appealing to authority. It doesn't matter what scientists thought, I'm sure your statement is true about the number of people who thought the earth was flat in the history of time versus now. It's a non-starter. And some beliefs *are* better than others, surely you can agree to that. How do you know your god is better than mine?

      Here's a little thought experiment. What if we replaced the word Jesus Christ, in the Bible, with Blahzie Blabber. Then we gave this new Bible, everything else the same, to a child, and reared him as any other Christian child is reared. This child lead a godly life, praising Blabber whenever he could, repenting for all his sins, believing that Blabber was the only son of god sent to die for his sins, helping his fellow man, etc.

      Does this person go to heaven in your worldview? ;)

    30. Re:The organisation of life by Doc+Ruby · · Score: 1

      Anonymous faithy Coward, my post was a response to several separate claims in the post to which I responded. Each rebuttal was clear and to the point. If you could read, you'd know, but I suppose not even reading skills are required of bible worshippers: just faith, and some of you to spout baseless insults in public to keep the ball rolling.

      All of the people who held a firm belief in god who produced most of our science and technology also believed many other wrong things that science and technology have easily disproven. Practically all of those people also owned slaves: so what? Their slave ownership and their belief in god had nothing to do with their scientific and technological discoveries and creations. But I suppose that to a bible worshipper, the only thing that matters is that someone believe in "god" - even if they didn't believe that "god" was much like the one that you believe in. Which is also irrelevant, though I'm sure you'd claim otherwise.

      The list of scientific contributors who believed the Sun orbited the Earth was pretty large and significant, but that doesn't count against what they got right.

      You faithy people don't know how to keep some sense to your faith. It's OK for you to guess about unproveable knowledge. Just don't pretend your guesses are at all as reliable as our scientific knowledge. And don't pretend you can know that your faith is right and someone else's is wrong, any more than they can know about theirs over yours. And don't pretend you can tell anyone what to do or think because of your faith that they don't have. Grow up enough to treat your own faith responsibly, instead of its nearly unbroken history of going way overboard, and you can talk about it in public without reasonable people finding you too childish to deal with.

      --

      --
      make install -not war

    31. Re:The organisation of life by Dun+Malg · · Score: 1

      The year 1914, for instance, is indicated as a significant year, the end of the seven gentile times.

      Yeah, if you're an idiot maybe. According to Daniel armageddon comes 7 "times" after the destruction of Jerusalem (607BC), and a "time" is 360 days, so we're talking about 2,520 days, or a little less than 7 years. Oh, but if you're a moron, or if you're a Jehovah's Witness (but I repeat myself), you go to Numbers 14:34 and cherry-pick a line that says âoea day for a yearâ, and make it 2,520 years, and "ominously" arrive at 1914! What a fucking crock of shit. Take your "my magic man in the sky wrote this book" bullshit elsewhere.

      --
      If a job's not worth doing, it's not worth doing right.
    32. Re:The organisation of life by Doc+Ruby · · Score: 1

      The modern canonical torah was finalized sometime between 1700 and 1900 years ago, as can be seen in differences from the Dead Sea Scrolls.

      Just one of several textual analyses of the torah showing revisions is Friedman's breakdown into several component parts, written at different times.

      There's even more details about history of "bible" authorship that explains how most of the source texts that christians used around 1700 years ago were left out of the canonization of the New Testament, mostly gnostic rivals to the people who decided on the canon.

      --

      --
      make install -not war

    33. Re:The organisation of life by Anonymous Coward · · Score: 0

      you a J-Dub? or a 7th day adventist?

    34. Re:The organisation of life by Nikker · · Score: 1

      It's funny how you mention with such certainty that the (Christian?) Bible was never modified even though I am personally skeptical that this could be proven you forget that there were very few people around that time that could even read including many of the clergy so as the Bible was being copied (by hand mind you) who was to say it was the same as another by any scale?

      The Bible was put together at a time where people were forced to burn materials that did not conform to the 'faith' put forward by the Church . So if you think about it if all of the creative works seemed to contrary to the Bible then is it really all encompassing? What is it about human ideas and thoughts that was so scary that to become a Christian you had to burn all the books you owned(refer to link above) and what is it about the Bible that gives so much shelter from our selves?

      The truth?

      --
      A loop, by its nature, continues. If that didn't make sense, start reading this sentence again.
  6. RNA by ServerIrv · · Score: 1

    This gives new meaning to a man in the middle attack.

    1. Re:RNA by Anonymous Coward · · Score: 0

      This gives new meaning to a man in the middle attack.

      I am more than "strands of DNA", you insensitive clod!

      And why do you keep calling me Eve?

  7. Okay, but... by MaxwellEdison · · Score: 1

    Who's DNA did they use? Does this mean we'll have a true Father or Mother of modern optical computing. And, if we continue down this line, how long before we are creating computers that blur the line between machine/organism. Or to sum it up...ZOMG!!!11!!!

    --
    -=Bang Bang=-
    1. Re:Okay, but... by qmaqdk · · Score: 1

      My guess would be a rats or a pigs DNA.

      I for one welcome our new animal modern optical computing overlords.

      --
      My UID is prime. Hah!
    2. Re:Okay, but... by philspear · · Score: 1

      The article is -light- on details (ugh). If the DNA strand has to be of a specific base composition, then they probably made it themselves with polymerase chain reaction (PCR) in a test tube. Also, proteins stuck on the DNA strand may have interfered with whatever YO is and whatever it was doing, PCR-generated DNA would also eliminate that problem.

      If associated proteins don't stop the signal and sequence doesn't matter, I suppose they could have gotten it from anywhere they wanted. Its easy to harvest a lot of DNA from bacteria.

      Humans or animals I think are unlikely, because it's at least a little more difficult (AKA expensive) to get a sample and purify the DNA.

  8. Signal loss? by GogglesPisano · · Score: 2, Interesting

    As I understand it, fiber optic works because there is minimal signal (light) loss due to total internal reflection, which is a consequence of differences in the refractive indices of the glass and the cladding used in the fiber. Does the structure of DNA somehow support reflecting light in the same way? Pretty cool stuff.

    1. Re:Signal loss? by Doc+Ruby · · Score: 3, Informative

      These DNA "optical fibers" are made by inserting chromophores into DNA strands. The DNA is the path between two points, a substrate on which to lay out a sequence of chromophores. The chromophore path can transfer photons from one chromophore to another. The light isn't "reflecting", its transmission is something like the inverse of internally refractive transmission through an optically transparent medium. Chromophores do form the path through which light travels, but this new publication doesn't specify the physical mechanism by which light is transmitted from one chromophore to another along the DNA. However, the chromophores are not a contiguous optically transparent medium, so they're not transferring the photons the way that familiar fiberoptics do, which depends on them acting as a contiguous optical medium.

      --

      --
      make install -not war

    2. Re:Signal loss? by dontmakemethink · · Score: 1

      If I follow this reply, the DNA strands are in essence infused with molecules that resonate light. So they're not conduits of minimal resistance like fiber, they are more like a series of acoustic relays at a molecular level. String them together tightly enough and they form optical conduits.

      --

      War as we knew it was obsolete
      Nothing could beat complete denial
      - Emily Haines
    3. Re:Signal loss? by Doc+Ruby · · Score: 1

      Not exactly. AFAICT, the "molecules that resonate light", are really chromophores, parts of a molecule, that are integrated into the DNA sequence as part of a single DNA molecule. The mechanism of transmitting light from chromophore to chromophore along the length of DNA isn't explained.

      But in glass optical fibers, "conduits of minimal resistance" isn't really a good description of the transmission. That optical medium is made of molecules that accept incoming photons, then emit outgoing photons, along the momentum axis of the photon, but refracting from the juncture of the optical medium with another medium with sufficiently different refraction index. The chromophores appear to do the same thing, but it's not really clear. They do form "optical conduits", or they wouldn't transmit photons, though indeed the article doesn't really make clear that the quanta aren't passed as electrons until being emitted by a final chromophore, which would invalidate the entire comparison to "optical fibers".

      --

      --
      make install -not war

  9. star trek? by servo335 · · Score: -1, Offtopic

    Didn't Voyager use some kind of bio pack to help power the ship?

  10. lasers, sigh.... by Missing_dc · · Score: 1

    Does this mean I can (eventually) get modified to shoot lasers from my eyes?

    or fingertips?

    --
    How amazed would you be to suddenly find that you just forgot what I wrote and you needed to reread my post.... again.
    1. Re:lasers, sigh.... by MaxwellEdison · · Score: 1

      Lasers in your fingertips? But then every time someone was seen picking their nose it could be seen as an attempted suicide. My God! Think of what that would do to life insurance premiums you insensitive clod!

      --
      -=Bang Bang=-
    2. Re:lasers, sigh.... by Missing_dc · · Score: 1

      I am sure it would come with a power switch of some sort....

      Are laser pointers always on?

      I may be an insensitive clod, but you, sir are an unintelligent dork.

      Tomorrow, I can take sensitivity training, you.... well....

      --
      How amazed would you be to suddenly find that you just forgot what I wrote and you needed to reread my post.... again.
    3. Re:lasers, sigh.... by Anonymous Coward · · Score: 0

      I have one simple request. And that is to have sharks with frickin' laser beams attached to their heads! And you give me organic fiber optics instead? What do I pay you people for, honestly? Throw me a bone here!

    4. Re:lasers, sigh.... by thePowerOfGrayskull · · Score: 1

      And switches never fail, right? ;)

  11. Light beings by Anonymous Coward · · Score: 1, Interesting

    So, eventually this DNA fiber optics will evolve into beings that have nervous systems that operate at the speed of light and therefore can think at the speed of light? Which leads to them being vastly superior to us and them pushing us to extinction?

    1. Re:Light beings by MikeDirnt69 · · Score: 2, Insightful

      Thinking fast doesn't mean thinking wisely. We don't have an AI level high enough to put on robots to make the smarter than us.

      --
      Am I eval()? - http://www.monst3r.com.br
  12. Photonic "wires" by Mindcontrolled · · Score: 2, Interesting
    Admittedly I can't be arsed to RTFA, but, hey, let's blabber on.

    I don't think the comparison with optic fibres is valid. This is no reflection phenomenon. The so-called natural optic wires are not reflection based, but rather a series of chromophores chained together. Photon transport is a series of absorption-emission-events channeling the energy down the chain.

    The same is most likely the case with this stuff. The light transport is no intrinsic property of the DNA, but rather of chromophores coupled to it. DNA just serves as a scaffold to arrange the absorption-emission centres.

    Ofc, build this into a computer and I will show you the true meaning of "virus".... Biochemical hacking, oh yes, I am looking forward to that...

    --
    Ubi solitudinem faciunt, pacem appellant.
    1. Re:Photonic "wires" by gilleain · · Score: 2, Informative

      There are examples of biological optics:

      A small node on one example

    2. Re:Photonic "wires" by Anonymous Coward · · Score: 0

      Oh booo, you ruined the article already.

    3. Re:Photonic "wires" by Mindcontrolled · · Score: 1

      True, but the eyes you are using to read /. are an example for biological optics, too. That is out of the question. I am not aware of any biological "optic fibre"-type structures. Feel free to correct me if I am wrong, though - in my lab days I just pushed single proteins around, now I am just pushing paper around, so I am somewhat out of the loop.

      --
      Ubi solitudinem faciunt, pacem appellant.
    4. Re:Photonic "wires" by gilleain · · Score: 1

      Yes, that's why my link is about a biological "optical-fibre" example :) In short, it's about the 'Sea Mouse' which has chitin spines that are photonic band-gap crystals (I read - I'm a biologist, too, not a physicist).

    5. Re:Photonic "wires" by Lord+Bitman · · Score: 1

      Isn't all "bouncing" of light, and therefor fiber optics too, just a series of absorption-emission-events?
      Correct me if you know better, this is just a "didn't I read somewhere once that the same photon doesn't come back when it "reflects" off a mirror?" thing

      --
      -- 'The' Lord and Master Bitman On High, Master Of All
    6. Re:Photonic "wires" by Doc+Ruby · · Score: 1

      You guessed right that the DNA is just the "scaffolding" determining paths of chromophores "doped" into the DNA along their paths. That the light is transmitted through the sequence of chromophores (though the article doesn't specify just what mechanism transmits the light along the chromophore trail).

      But that doesn't at all discount these structures from being counted as "optical fibers". They just introduce a new class of optical fibers that aren't a contiguous optically transparent medium the way glass fibers (and their plastic analogues) are.

      It's worthwhile to consider them as optical fibers, because they are, and because they could be much more engineerable at the microscale and nanoscale than are internally reflective photonics. We've got a pretty good scientific understanding of engineering DNA topologies. We can literally program shapes of interconnected DNA, even to arbitrary topologies of high complexity. We have biochemistry to interconnect engineered DNA with inorganic devices like microchips and organic but nonbiological materials like nanotubes. We are practically on the verge of tech that clones our arbitrary DNA structures once the "prototype" is constructed, making mass manufacturing at nanoscale completely feasible and economical.

      This demonstration shows that we can get the communications effects of more familiar optical fibers by using chromophore-doped DNA instead. They're fibers, they're optical, and they do what we thought we wanted glass fibers to do to interconnect logic devices. Why not call them optical fibers, and just accept that some optical fibers work by means other than total internal reflectance? We'd be opening our opportunities the same way as if we stopped insisting that all geometry be "triangular".

      --

      --
      make install -not war

  13. I made this on Fomalhaut by nickrjsmith · · Score: 1

    I created DNA for this express purpose. I'm from a planet near a place you call Fomalhaut, and I am the intelligent designer some of the more clever amongst you call the creator. Unfortunatly you are simply a bi-product of our search for the perfect computing system. Yes - you're an accident, sorry.

    1. Re:I made this on Fomalhaut by Anonymous Coward · · Score: 0

      you had me right up to the point where you wrote "unfortunatly" and "bi-product"

  14. Yeah, because our brains are light based by SmallFurryCreature · · Score: 1, Insightful

    How exactly does implanting optic wires into your brain do anything except give you a possible headache.

    We have had electrodes for ages, so anyone wanting to create a brain-computer interface already had the tech. Oooh, and they already done it.

    Mind you, you are the perfect sample for my next paper. "Tinfoil-hats linked to permanent brain damage."

    --

    MMO Quests are like orgasms:

    You may solo them, I prefer them in a group.

    1. Re:Yeah, because our brains are light based by Anonymous Coward · · Score: 0

      Cite your sources:
      Raskolnikov, R. R. and F. M. Dostoyevski (1867) "Blunt hatchet linked to permanent brain damage" No Shit Sherlock 66(13):1337-11

    2. Re:Yeah, because our brains are light based by morgan_greywolf · · Score: 0, Offtopic

      I guess my humour was lost on everyone.

      *sigh*

    3. Re:Yeah, because our brains are light based by interploy · · Score: 1

      Are you kidding? Yeah, it's been done using current technology, but to date there isn't one that isn't some clunky, oversized, borg-looking construction that requires an impractical amount of power. We need a "transitor" of the man-machine interface, something compact, efficient and reliable, and this looks like a step in the right direction. Or are you going to tell me since we've had vacuum tubes and wires for ages, we never should have moved on from ENIAC?

    4. Re:Yeah, because our brains are light based by Dun+Malg · · Score: 2, Informative

      Are you kidding? Yeah, it's been done using current technology, but to date there isn't one that isn't some clunky, oversized, borg-looking construction that requires an impractical amount of power. We need a "transitor" of the man-machine interface, something compact, efficient and reliable, and this looks like a step in the right direction.

      The brain communicates chemically/electrically. A way to turn DNA strands into optical fiber isn't a step anywhere NEAR the direction of interfacing with the human brain.

      --
      If a job's not worth doing, it's not worth doing right.
    5. Re:Yeah, because our brains are light based by Anonymous Coward · · Score: 0

      Well, aluminium has been connected with Alzheimer's.

    6. Re:Yeah, because our brains are light based by spazdor · · Score: 1

      It's a step in the direction of distributing signals across disparate parts of the brain without disturbing the brain itself. Sure, at the end of the fiber we'd have to have a device which turns some light into electricity but if they can get the light there using a single molecular chain, that means they can fit more of 'em into your skull without displacing your invaluable brainmeats.

      --
      DRM: Terminator crops for your mind!
    7. Re:Yeah, because our brains are light based by spazdor · · Score: 1

      I think it's yer axons and dendrites growin' tin whiskers.

      --
      DRM: Terminator crops for your mind!
  15. yes, certainly the perfect interface... by DragonTHC · · Score: 1

    for a CYBORG! cybernetic interfaces here we come.

    --
    They're using their grammar skills there.
  16. Think Photosynthesis, not Fiber Optics by cynicsreport · · Score: 4, Interesting

    These modified DNA strands seem to act more like the photosynthetic electron-transport system than they do optical fibers. In fact, one of the applications listed is "light harvesting in artificial photosynthetic systems." It is curious that TFA describes this as a fiber optics corollary.
    Fiber optics works based on the principles that photons will reflect off of a surface given a sufficient difference in refractive index and approach angle, allowing high-bandwidth communication. This new DNA photon transport system seems to have very little resemblance. I would guess that using DNA for communication would be very slow and very low bandwidth, to the point of being practically infeasible.

    --
    - Demosthenes
    cynicsreport.com
  17. new plan, people by jollyreaper · · Score: 2, Insightful

    1. Use DNA-based fiber-optics in the major backbones of the internet
    2. Spread rumor that the DNA comes from fetal stem cells from forcibly aborted babies, white christian babies!
    3. Watch right-wingers shut down their sites and flee the internet so they won't be taking part in the satanic evil of telecommunications.
    4. Remind them that their phone calls go over that same satanic fiber so they can't use phones, either.
    5. Gin up a new rumor that the power lines are being replaced by baby DNA fiber-optics, too, mail that to them in a chain letter.
    6. Watch them become the new Amish, shunning baby DNA-based demon technology, spinning their hate into hand-crafted quilts sold by the roadside.
    7. ??? Maybe if we're still feeling malicious, convince them buttons use baby DNA, too.
    8. Profit!

    --
    Kwisatz Haderach
    Sell the spice to CHOAM
    This Mahdi took Shaddam's Throne
    1. Re:new plan, people by Anonymous Coward · · Score: 0

      Unfortunately the rabid right-wingers hold too much power in America. If we told them that the internet was using aborted white christian babies as a transfer medium they would lobby the President to have it banned in your country and they would succeed, even if it meant replacing the President.

    2. Re:new plan, people by Anonymous Coward · · Score: 0

      I think it would be awesome if your second step were actually true.

      1. According to Christianity, unbaptized babies (I guess salt water some pedo's been hoarding is more sacred than amniotic fluid...) don't go to heaven.
      2. You've built a planet-spanning machine built from the bone and blood of the damned.
      3. ???
      4. pennyarcadesingthesongthatendstheearth.jpg

  18. Decay by wonkavader · · Score: 1

    OK, but don't DNA strands decay when hit by any number of high-energy rays? Aren't they organic molecules that various organisms eat? Would we trading the benefits of using this molecule for a whole new set of failure types and the cost and weight of shielding?

    1. Re:Decay by Adriax · · Score: 1

      Gives an old meaning to the term virus, huh?
      Hackers will now use genetically engineered viruses to attack network links directly.

      --
      I don't suffer from insanity, I enjoy every minute of it!
  19. Flamebait??? by qmaqdk · · Score: 0, Offtopic

    How can this be tagged flamebait?

    --
    My UID is prime. Hah!
  20. And free copy too... by DrYak · · Score: 1

    Aren't we allowed to view and modify the code {...} ?

    Yeah, but you can count on fundamentalists and puritans to try to restrict us from copying and sharing around the code freely. (Or at least before a proper exclusive contract called "wedding" has been signed).

    --
    "Sufficiently advanced satire is indistinguishable from reality." - [Tips: 1DrYakQDKCQ6y52z6QbnkxHXAocMZJE61o ]
  21. And the answers is... by DrYak · · Score: 0, Offtopic

    Unfortunatly you are simply a b[y]-product of our search for the perfect computing system

    42 ! Fourty-two !

    The answers to the computations is "42" !
    See ? We're still good at computing.
    Now please remove your finger from the button labelled "destroy failed computing project in order to build a hyper-space by-pass on the free place"

    --
    "Sufficiently advanced satire is indistinguishable from reality." - [Tips: 1DrYakQDKCQ6y52z6QbnkxHXAocMZJE61o ]
  22. Which Bible is that? Not the original. by Kupfernigk · · Score: 2, Interesting
    Funnily enough, I actually learned at little Hebrew at University. Enough to be able to read parts of Bereshit, anyway. (Why call an English translation Genesis, which is not an English word? Either call it by its translated name "In the Beginning", or its actual name which is Bereshit.) Enough to know that there is no such word as "Jehovah" in the Bible (it's an interesting story how the error arose, but rest assured it is an error.) Bereshit actually begins, in a fairly accurate translation, "In the beginning the Gods created the Heavens and the Earth" - the word "Elohim" is in the form of a Hebrew plural. YHWH turns up later in the book. If you actually read it in anything like a literal translation, you will find that there are at least 3 different gods wandering around the first book of the Bible, along with some angels who intermarry with human beings.

    So either we have to believe that the Jehovah's Witnesses and other "fundamentalists" have been supplied with a heavily corrected version of the Hebrew Bible by a God who keeps supplying different versions in different versions of English (King James, Revised etc.) or that they have been misled by a series of incompetent scholars who never bothered to learn Hebrew.

    It's strange, is it not, that Roman Catholic and Episcopalian priests (most of whom do know Hebrew) are quite comfortable with the age of the Universe and the Theory of Evolution, and it is the unlettered fundamentalists, who don't know their k'thibh from their qu're, who aren't?

    --
    From scarped cliff or quarried stone she cries "A thousand types are gone, I care for nothing, no not one."
    1. Re:Which Bible is that? Not the original. by Emb3rz · · Score: 1

      Perhaps some more study would be beneficial to you.

      Hebrew grammar

      Elohim has plural morphological form in Hebrew, but it is used with singular verbs and adjectives in the Hebrew text when the particular meaning of the God of Israel (a singular deity) is traditionally understood. Thus the very first words of the Bible are breshit bara elohim, where bara is a verb inflected as third person singular masculine perfect. If Elohim were an ordinary plural word, then the plural verb form bar'u would have been used in this sentence instead. Such plural grammatical forms are in fact found in cases where Elohim has semantically plural reference (not referring to the God of Israel). There are a few other words in Hebrew that have a plural ending, but refer to a single entity and take singular verbs and adjectives, for example (be'alim, owner) in Exodus 21:29 and elsewhere.

      Source

      That "Jehovah" is not the original name of the God of the Israelites is well documented. Despite this, it is a name that is familiar (as Jesus whose name may have been closer to Yehoshua is another example of) and has the same semantic significance. The illustration has been given that, if you had a foreign friend whose name was difficult to impossible for you to pronounce, would he appreciate it if you simply assigned him a title (Mister, Sir) and called him by that, or if you tried to use his name (or, also fitting may be to assign them a nickname that to both you and he could be considered as his name)?

    2. Re:Which Bible is that? Not the original. by zindorsky · · Score: 1

      (Why call an English translation Genesis, which is not an English word? Either call it by its translated name "In the Beginning", or its actual name which is Bereshit.)

      "Genesis" is from Greek, meaning origin or beginning. I believe it is the first word in the Greek version of the Hebrew Bible, a.k.a. the Septuagint. The reason we use the Greek word instead of the Hebrew one probably lies in the fact that once Christianity expanded to non-Jewish groups, more Christians used Greek than Hebrew.

      "In the beginning the Gods created the Heavens and the Earth" - the word "Elohim" is in the form of a Hebrew plural.

      Elohim does have the plural ending, but this is usually taken as an honorific. Especially since the verb conjugations used with Elohim are singular, not plural. I'll grant you though that this may point to earlier versions of the Genesis story where multiple gods were involved.

      --
      If the geiger counter does not click, the coffee, she is not thick.
    3. Re:Which Bible is that? Not the original. by Anonymous Coward · · Score: 0

      I got some Bereshit on my shoe once, pissed me off to no end. I couldn't take my shoe off, because it was all over the place and didn't want to get it on my hands.

      Dirty faith get's everywhere, I think I can smell some right now.

  23. Opto Switch by KiwiCanuck · · Score: 1

    I have yet to see an opto-actuated opto-switch. I haven't been paying attention to the opto domain for a while, but this was the case the last time I was searching. Anyone here know a potential (pure opto) switch technology?

  24. gdo7l by Anonymous Coward · · Score: -1, Flamebait
  25. They strain at a gnat by Kupfernigk · · Score: 2, Interesting
    And swallow a camel. You are not, of course, answering my main point (that the first Book of the Bible is a collection of heterogeneous legends with more than one theology) while trying to absorb the oddity that Elohim _is_ a plural, and the claim that it isn't in this context is based on bar'a and bar'u. To give a simple analogy from German, if I wrote "Der Goetter" rather than "Die Goetter", it's more likely that I didn't know the correct form of the article than that I really mean "Der Gott". In the Biblical case, if I was a scribe coming along later who wanted to clean things up a bit as regards monotheism, faced with the difference between changing a single letter and replacing a whole word, I might well decide to slide in one of the few vowels that actually appears in unpointed text. Especially as vowels are less sacred than consonants. (Wikipedia writer, btw, hedges bets by writing "is traditionally understood").

    The second issue is quite basic. Fundamentalists, to preserve their interpretation against the evidence, have to pretend that the Bible is literally correct. If you preserve an actual mistake - because the word Jehovah is a mistake, not a mispronunciation - you are admitting to your Bible something that is not literally correct. And if you have done that, how many other scribes and copyists may have done the same?

    It's OK. Mit der Dummheit kaempfen Goetter selbst vergebens, and I know the battle is unwinnable. I wouldn't have bothered, had not your original post been so ridiculous.

    --
    From scarped cliff or quarried stone she cries "A thousand types are gone, I care for nothing, no not one."
  26. Re:Light beings What do you mean we don't have by davidsyes · · Score: 1

    the AI level to make robots smarter than us?

    If we store a sufficient amount of morality code, replete with case-by-case deviations to spare the condemnable and condemn the innocent, and if we train these robots or computers to sit SIMULTANEOUSLY on hundreds of US and thousands of foreign nations' civil and criminal court proceedings, and teach the robots all we know about science, law, logic, crimes, and more, it's inevitable that within about 15 years these machines could corral our asses and threaten human's "right of self-determination".

    I kind of look forward to that day to be imposed upon humans. So long as the programming has various overlapping overrides to morally satisfy that the machine that deviates (to kill or destroy truly innocent, mostly-law-abiding human citizens/residents of Earth) is doing so on purpose, then most of us could rest assured that such machines might eradicate not only assholes but asshole DNA from humanity as much as possible. That, i look forward too as well.

    Next, with enough gyros, motors, and flexibility and lightweight yet durable structure (ability to telescope/adjust height, pop-up, drop-down, bend, leap) and provided with balance better than a standing, weight-loaded combat-equipped soldier, these machines could be viable as law enforcers, and built in sufficient numbers, could hold whole neighborhoods accountable for failing to report on any sufficiently criminal humans.

    There is not a shortage of AI, there is a plethora of human greed and fear standing in the way. The machines don't need to be artists, exquisite love-makers, and nuanced in poetry, but enforcers of basic right and wrong, to correct malignant human pettiness, maldistribution of protein and other nutritional needs, proper assignment/allocation of jobs to humans qualified rather than given them by cronyism....

    --
    Previously: "Linux... Toward the Sunrise..." Now: "Linux... Toward the-- No, now, part of Every Sunrise"
  27. Speed of thought? by Smivs · · Score: 1

    This got me wondering so I looked it up. Apparently research has shown that it took a volunteer between 550 and 750 milliseconds to begin to understand a pictured object in tests. That's pretty quick, if not light-speed.

  28. Re:The organisation of life A..... by davidsyes · · Score: 1

    MEN! Amen. Without a DOUBT, one of THE best postings of substance on slashdot. There should be a once-a-month super-mod button so that there is a global ranking/display of the best minds (based on account name or person behind it) on slashdot, for those of us who need a true beacon here.

    --
    Previously: "Linux... Toward the Sunrise..." Now: "Linux... Toward the-- No, now, part of Every Sunrise"
  29. One more piece of the puzzle by Anonymous Coward · · Score: 0

    This guy could make something more fun out of it. His work uses DNA (really, just RNA) plus staples that automatically hit the right points due to DNA's matching. It can easily be folded into sheets, and now those sheets can have embedded wiring. The only thing missing is hanging functional parts off of the staples, and computer science tells us that it takes very few different basic components to become computationally complete.

  30. Brings new meaning to computer virus by _avs_007 · · Score: 1

    I can't wait until an employee sick with the cold or flu shows up to work, and their PC gets sick, infecting the whole network.

    Remember that Star Trek Voyager episode the Voyager's bioneural gel packs got sick, and the whole ship went haywire?

  31. Re:Light beings What do you mean we don't have by MikeDirnt69 · · Score: 1

    I don't know what you had in your breakfast today, but you seem to be too bitter. I was talking about intelligence, not morality. We still can't make them smart/fast/strong enough to practice all this immorality you're talking about.

    --
    Am I eval()? - http://www.monst3r.com.br
  32. AT vs. CG by primenerd · · Score: 1

    I was just thinking, if they actually wanted to implement this they would have to worry about G4 complexes. That would rule out long stretches of guanine-cytosine, which is a shame as they have a triple hydrogen bonding and would be much stronger for such applications. They could use adenine and thymine or possibly uracil as the bulk of the wire with infrequent GC pairs as reinforcement... something like 5'-(AAA GCG UUU AAA CGC UUU)n -3'

    It is doubtful that anyone will be putting these into living organisms... intercalating dyes tend to be serious mutagens and there is really no way to prevent such agents from diffusing out of the "fiber optic" and into the DNA of adjacent cells (cancer anyone?).

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  33. Sound familiar? by nycroft · · Score: 1

    âoeThe system goes online August 4th, 1997. Human decisions are removed from strategic defense. Skynet begins to learn at a geometric rate. It becomes self-aware at 2:14 a.m. Eastern time, August 29th. In a panic, they try to pull the plug.â

    --
    Mr. Bond, they have a saying in Chicago: Once is happenstance. Twice is coincidence. The third time is enemy action.
  34. Re:Light beings What do you mean we don't have by davidsyes · · Score: 1

    Maybe my breakfast was substandard rather than tainted with something. I kinda feel we *think* were all smart and cute, but that's relative to other life forms and things we observe. Any machines given intelligence (say, by other life forms eons ahead of us -- if they exist, that is --) can at some point just cut to the chase at solutions, whether intelligence or morality-based. We're driven by politics, economics, favoritism and more. I would assume intelligent machines would not be mired by such encumbrances. Human ego would be dashed if some other human figured out how to super-endow intelligent machines to out-intelligence humans. I would dare say the DOD and other agencies would either kill or seek to totally control any human they found out was trying to "work outside the system" to enable computers to be more intelligent than us, come to their own conclusions about what their intelligence means relative to ours, whether or not we're to be considered an annoyance to them, or a complementarity thing.

    Intelligence or morality, it doesn't matter if machines never match us. But, if humans threaten to design something that will outclass the smartest human, and this threat begins to look like the Forbin Project, or something from Terminator, intelligence probably won't be the issues. Human independence survival might become the issue.

    Anyway, i'm still probably not making sense...

    --
    Previously: "Linux... Toward the Sunrise..." Now: "Linux... Toward the-- No, now, part of Every Sunrise"
  35. Category: Hardware Hacking by Lord+Kestrel · · Score: 1

    Seeing the category definitely made me smile. Now just give me a laptop, and let me hack my own code.