DNA Strands Modified Into Tiny Fiber-Optic Cables
holy_calamity writes "New Scientist reports on the latest idea from researchers trying to make microcomputers use photons in place of electrons — to make optical interconnects from strands of DNA. Mixing DNA strands with the right dye molecule upgrades them into wires for light, like microscopic optical fibers, able to absorb photons at one end and transmit them to the other. One of the neat things about using DNA is it is the right scale to play nicely with existing and future chip lithography. Quoting: 'The result is similar to natural photonic wires found inside organisms like algae, where they are used to transport photons to parts of a cell where their energy can be tapped. In these wires, chromophores are lined up in chains to channel photons.'"
Ok great, yeah, give the robots DNA too. Like we'll have any chance now.
c++;
Hmmm...I'm no biologist, but I'll bet it's the right scale for human-implanted computing. Wow. Be afraid...very afraid...
My blog
This will be the beginning of the Cylons..
We had this ability already built into our biology and we instead use chemical signals for our nervous system? It is a pity we didn't have an intelligent designer (one with degrees in electrical engineering and physics).
This of course is not evidence for or against any kind of theology in general, because theology is a much more diverse (and interesting) subject than the Creationists and IDers would have you believe. But it does look as though the question "how did life get started", which is vague and ill defined, is gradually resolving down to the question "under what circumstances can ribose nucleic acids form spontaneously, and how many other small molecules can we find which can spontaneously arrange themselves in the presence of ribose nucleic acids?" which is testable.
From scarped cliff or quarried stone she cries "A thousand types are gone, I care for nothing, no not one."
This gives new meaning to a man in the middle attack.
Who's DNA did they use? Does this mean we'll have a true Father or Mother of modern optical computing. And, if we continue down this line, how long before we are creating computers that blur the line between machine/organism. Or to sum it up...ZOMG!!!11!!!
-=Bang Bang=-
As I understand it, fiber optic works because there is minimal signal (light) loss due to total internal reflection, which is a consequence of differences in the refractive indices of the glass and the cladding used in the fiber. Does the structure of DNA somehow support reflecting light in the same way? Pretty cool stuff.
Didn't Voyager use some kind of bio pack to help power the ship?
Does this mean I can (eventually) get modified to shoot lasers from my eyes?
or fingertips?
How amazed would you be to suddenly find that you just forgot what I wrote and you needed to reread my post.... again.
So, eventually this DNA fiber optics will evolve into beings that have nervous systems that operate at the speed of light and therefore can think at the speed of light? Which leads to them being vastly superior to us and them pushing us to extinction?
I don't think the comparison with optic fibres is valid. This is no reflection phenomenon. The so-called natural optic wires are not reflection based, but rather a series of chromophores chained together. Photon transport is a series of absorption-emission-events channeling the energy down the chain.
The same is most likely the case with this stuff. The light transport is no intrinsic property of the DNA, but rather of chromophores coupled to it. DNA just serves as a scaffold to arrange the absorption-emission centres.
Ofc, build this into a computer and I will show you the true meaning of "virus".... Biochemical hacking, oh yes, I am looking forward to that...
Ubi solitudinem faciunt, pacem appellant.
I created DNA for this express purpose. I'm from a planet near a place you call Fomalhaut, and I am the intelligent designer some of the more clever amongst you call the creator. Unfortunatly you are simply a bi-product of our search for the perfect computing system. Yes - you're an accident, sorry.
How exactly does implanting optic wires into your brain do anything except give you a possible headache.
We have had electrodes for ages, so anyone wanting to create a brain-computer interface already had the tech. Oooh, and they already done it.
Mind you, you are the perfect sample for my next paper. "Tinfoil-hats linked to permanent brain damage."
MMO Quests are like orgasms:
You may solo them, I prefer them in a group.
for a CYBORG! cybernetic interfaces here we come.
They're using their grammar skills there.
These modified DNA strands seem to act more like the photosynthetic electron-transport system than they do optical fibers. In fact, one of the applications listed is "light harvesting in artificial photosynthetic systems." It is curious that TFA describes this as a fiber optics corollary.
Fiber optics works based on the principles that photons will reflect off of a surface given a sufficient difference in refractive index and approach angle, allowing high-bandwidth communication. This new DNA photon transport system seems to have very little resemblance. I would guess that using DNA for communication would be very slow and very low bandwidth, to the point of being practically infeasible.
- Demosthenes
cynicsreport.com
1. Use DNA-based fiber-optics in the major backbones of the internet
2. Spread rumor that the DNA comes from fetal stem cells from forcibly aborted babies, white christian babies!
3. Watch right-wingers shut down their sites and flee the internet so they won't be taking part in the satanic evil of telecommunications.
4. Remind them that their phone calls go over that same satanic fiber so they can't use phones, either.
5. Gin up a new rumor that the power lines are being replaced by baby DNA fiber-optics, too, mail that to them in a chain letter.
6. Watch them become the new Amish, shunning baby DNA-based demon technology, spinning their hate into hand-crafted quilts sold by the roadside.
7. ??? Maybe if we're still feeling malicious, convince them buttons use baby DNA, too.
8. Profit!
Kwisatz Haderach
Sell the spice to CHOAM
This Mahdi took Shaddam's Throne
OK, but don't DNA strands decay when hit by any number of high-energy rays? Aren't they organic molecules that various organisms eat? Would we trading the benefits of using this molecule for a whole new set of failure types and the cost and weight of shielding?
How can this be tagged flamebait?
My UID is prime. Hah!
Aren't we allowed to view and modify the code {...} ?
Yeah, but you can count on fundamentalists and puritans to try to restrict us from copying and sharing around the code freely. (Or at least before a proper exclusive contract called "wedding" has been signed).
"Sufficiently advanced satire is indistinguishable from reality." - [Tips: 1DrYakQDKCQ6y52z6QbnkxHXAocMZJE61o ]
Unfortunatly you are simply a b[y]-product of our search for the perfect computing system
42 ! Fourty-two !
The answers to the computations is "42" !
See ? We're still good at computing.
Now please remove your finger from the button labelled "destroy failed computing project in order to build a hyper-space by-pass on the free place"
"Sufficiently advanced satire is indistinguishable from reality." - [Tips: 1DrYakQDKCQ6y52z6QbnkxHXAocMZJE61o ]
So either we have to believe that the Jehovah's Witnesses and other "fundamentalists" have been supplied with a heavily corrected version of the Hebrew Bible by a God who keeps supplying different versions in different versions of English (King James, Revised etc.) or that they have been misled by a series of incompetent scholars who never bothered to learn Hebrew.
It's strange, is it not, that Roman Catholic and Episcopalian priests (most of whom do know Hebrew) are quite comfortable with the age of the Universe and the Theory of Evolution, and it is the unlettered fundamentalists, who don't know their k'thibh from their qu're, who aren't?
From scarped cliff or quarried stone she cries "A thousand types are gone, I care for nothing, no not one."
I have yet to see an opto-actuated opto-switch. I haven't been paying attention to the opto domain for a while, but this was the case the last time I was searching. Anyone here know a potential (pure opto) switch technology?
long 73rm survival marketing surveys
The second issue is quite basic. Fundamentalists, to preserve their interpretation against the evidence, have to pretend that the Bible is literally correct. If you preserve an actual mistake - because the word Jehovah is a mistake, not a mispronunciation - you are admitting to your Bible something that is not literally correct. And if you have done that, how many other scribes and copyists may have done the same?
It's OK. Mit der Dummheit kaempfen Goetter selbst vergebens, and I know the battle is unwinnable. I wouldn't have bothered, had not your original post been so ridiculous.
From scarped cliff or quarried stone she cries "A thousand types are gone, I care for nothing, no not one."
the AI level to make robots smarter than us?
If we store a sufficient amount of morality code, replete with case-by-case deviations to spare the condemnable and condemn the innocent, and if we train these robots or computers to sit SIMULTANEOUSLY on hundreds of US and thousands of foreign nations' civil and criminal court proceedings, and teach the robots all we know about science, law, logic, crimes, and more, it's inevitable that within about 15 years these machines could corral our asses and threaten human's "right of self-determination".
I kind of look forward to that day to be imposed upon humans. So long as the programming has various overlapping overrides to morally satisfy that the machine that deviates (to kill or destroy truly innocent, mostly-law-abiding human citizens/residents of Earth) is doing so on purpose, then most of us could rest assured that such machines might eradicate not only assholes but asshole DNA from humanity as much as possible. That, i look forward too as well.
Next, with enough gyros, motors, and flexibility and lightweight yet durable structure (ability to telescope/adjust height, pop-up, drop-down, bend, leap) and provided with balance better than a standing, weight-loaded combat-equipped soldier, these machines could be viable as law enforcers, and built in sufficient numbers, could hold whole neighborhoods accountable for failing to report on any sufficiently criminal humans.
There is not a shortage of AI, there is a plethora of human greed and fear standing in the way. The machines don't need to be artists, exquisite love-makers, and nuanced in poetry, but enforcers of basic right and wrong, to correct malignant human pettiness, maldistribution of protein and other nutritional needs, proper assignment/allocation of jobs to humans qualified rather than given them by cronyism....
Previously: "Linux... Toward the Sunrise..." Now: "Linux... Toward the-- No, now, part of Every Sunrise"
This got me wondering so I looked it up. Apparently research has shown that it took a volunteer between 550 and 750 milliseconds to begin to understand a pictured object in tests. That's pretty quick, if not light-speed.
Smivs on the intertubes!
MEN! Amen. Without a DOUBT, one of THE best postings of substance on slashdot. There should be a once-a-month super-mod button so that there is a global ranking/display of the best minds (based on account name or person behind it) on slashdot, for those of us who need a true beacon here.
Previously: "Linux... Toward the Sunrise..." Now: "Linux... Toward the-- No, now, part of Every Sunrise"
This guy could make something more fun out of it. His work uses DNA (really, just RNA) plus staples that automatically hit the right points due to DNA's matching. It can easily be folded into sheets, and now those sheets can have embedded wiring. The only thing missing is hanging functional parts off of the staples, and computer science tells us that it takes very few different basic components to become computationally complete.
I can't wait until an employee sick with the cold or flu shows up to work, and their PC gets sick, infecting the whole network.
Remember that Star Trek Voyager episode the Voyager's bioneural gel packs got sick, and the whole ship went haywire?
I don't know what you had in your breakfast today, but you seem to be too bitter. I was talking about intelligence, not morality. We still can't make them smart/fast/strong enough to practice all this immorality you're talking about.
Am I eval()? - http://www.monst3r.com.br
I was just thinking, if they actually wanted to implement this they would have to worry about G4 complexes. That would rule out long stretches of guanine-cytosine, which is a shame as they have a triple hydrogen bonding and would be much stronger for such applications. They could use adenine and thymine or possibly uracil as the bulk of the wire with infrequent GC pairs as reinforcement... something like 5'-(AAA GCG UUU AAA CGC UUU)n -3'
It is doubtful that anyone will be putting these into living organisms... intercalating dyes tend to be serious mutagens and there is really no way to prevent such agents from diffusing out of the "fiber optic" and into the DNA of adjacent cells (cancer anyone?).
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
âoeThe system goes online August 4th, 1997. Human decisions are removed from strategic defense. Skynet begins to learn at a geometric rate. It becomes self-aware at 2:14 a.m. Eastern time, August 29th. In a panic, they try to pull the plug.â
Mr. Bond, they have a saying in Chicago: Once is happenstance. Twice is coincidence. The third time is enemy action.
Maybe my breakfast was substandard rather than tainted with something. I kinda feel we *think* were all smart and cute, but that's relative to other life forms and things we observe. Any machines given intelligence (say, by other life forms eons ahead of us -- if they exist, that is --) can at some point just cut to the chase at solutions, whether intelligence or morality-based. We're driven by politics, economics, favoritism and more. I would assume intelligent machines would not be mired by such encumbrances. Human ego would be dashed if some other human figured out how to super-endow intelligent machines to out-intelligence humans. I would dare say the DOD and other agencies would either kill or seek to totally control any human they found out was trying to "work outside the system" to enable computers to be more intelligent than us, come to their own conclusions about what their intelligence means relative to ours, whether or not we're to be considered an annoyance to them, or a complementarity thing.
Intelligence or morality, it doesn't matter if machines never match us. But, if humans threaten to design something that will outclass the smartest human, and this threat begins to look like the Forbin Project, or something from Terminator, intelligence probably won't be the issues. Human independence survival might become the issue.
Anyway, i'm still probably not making sense...
Previously: "Linux... Toward the Sunrise..." Now: "Linux... Toward the-- No, now, part of Every Sunrise"
Seeing the category definitely made me smile. Now just give me a laptop, and let me hack my own code.