Slashdot Mirror

← Back to Stories (view on slashdot.org)

DNA-Radio, Tune In To Your Chromosomes

Posted by samzenpus on from the because-we-can dept.

An anonymous reader writes "The folks behind the DNA-Rainbow project (discussed on Slashdot before) apparently have some time to play around with genome data. After creating amazing pictures from the human DNA code they are now transforming all chromosomes to audio and streaming them to the Internet. Every base is read and broadcasted instead converting it to a color. Seemingly this artistic project will last a while. After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."

77 comments

  1. CCCCCAGCAAGCCCA by Praedon · · Score: 3, Funny

    I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA

    --
    Just me
    1. Re:CCCCCAGCAAGCCCA by !coward · · Score: 4, Interesting

      I was actually a little disappointed when I heard the feed.. Hadn't expected it to be just a robotic reader spelling out the sequence.

      Thought they might have just used the fact that three of the bases start with letters that are also musical notes in the english notation (A, C and G).. Choose a suitable 4th note for Thymine (maybe E, its last letter) and then run it through a midi sampler..

      To spice it up, they could do some fun stuff with combinations, for example altering the tempo when you found repetitions of the same base, something for sharp/flat (just to mix it up a bit), etc..

      Maybe not the point of this experiment (well, if you can call it that -- this isn't exactly science anyway), but as with the previous graphics experiment, it might even produce some interesting tune somewhere down the line.

      As it is, though a nice code hack I'm sure, the result is a tad boring.

    2. Re:CCCCCAGCAAGCCCA by master5o1 · · Score: 1

      I was expecting something like C= note C. A= note A. G= note G. T= note B or E or D.

      Sounds retarded when it's a voice going C C C C A G T C C C C C T C C C C G G G G G G blah blah blah

      --
      signature is pants
    3. Re:CCCCCAGCAAGCCCA by gravos · · Score: 2, Funny

      Your comments are pure CACA you GAT! You have as much TACT and a rubber CAT with a GATTACA TAT.

      --
      This game will waste your life. Don't clicky!
    4. Re:CCCCCAGCAAGCCCA by Mal-2 · · Score: 1

      It could be interesting to play all three members of each base triplet simultaneously, in three different octaves, one "chord" after another. This might even help researchers listen for specific amino acid combinations, which some people might find easier than reading row upon row of CCATGCCAAGAT.

      The triplets might also be translated into different chords not directly related to the A minor 7 chord (A C E G). This would help when two bases of a triplet are the same, as it is generally more difficult to hear pure octaves as distinct tones than it is to hear differing pitch classes, but not so difficult to tell, say, F7 from G7. Synonymous base triplets could be assigned different inversions of the same chord. For those lacking a sense of absolute pitch (most of you -- and it's not always the blessing it might seem), a pedal tone could give a point of reference while having no direct relation to the data.

      Assign common amino acid sequences to harmonious chord sequences, and unusual combinations would jump out at the listener. Once again, researchers could listen for "clams" instead of having to read strings of letters on a screen or page. I know not everything is a coding sequence, so other methods of translation might be necessary.

      Mal-2

      --
      How is the Riemann zeta function like Trump rallies? Both have an endless number of trivial zeros.
    5. Re:CCCCCAGCAAGCCCA by TapeCutter · · Score: 1

      One things a given. Any of your sugestions would certainly have been more interesting than something that sounds like my telephone companies help desk.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    6. Re:CCCCCAGCAAGCCCA by Samah · · Score: 1

      Steve Vai released a limited edition "DNA" model guitar with his DNA as the paint job. Now that is extreme epic win.
      http://www.vai.com/Machines/guitarpages/guitar117.html

      --
      Homonyms are fun!
      You're driving your car, but they're riding their bikes there.
    7. Re:CCCCCAGCAAGCCCA by Squeeonline · · Score: 0

      Nitrogenous base solo, AGTCAGTGCAGCACCCAGAGTGACGACGATGGTGTTTTTTTGAGTG

      If this makes it to the end of something, i want my royalties! *edit: Damn the "too many caps" filter. This was really cool!

    8. Re:CCCCCAGCAAGCCCA by LingNoi · · Score: 1

      Yeah, I'm disappointed too.. Just some women harping on about the GCC compiler..

    9. Re:CCCCCAGCAAGCCCA by CrashandDie · · Score: 1

      We're lucky the scientists were creative with the ACGT thingy.

      I would've hated listening to ABBA for 23.5 years.

    10. Re:CCCCCAGCAAGCCCA by Anonymous Coward · · Score: 0

      G!

    11. Re:CCCCCAGCAAGCCCA by sorak · · Score: 1

      Maybe not the point of this experiment (well, if you can call it that -- this isn't exactly science anyway), but as with the previous graphics experiment, it might even produce some interesting tune somewhere down the line.

      That would be awesome. If they have enough data to broadcast for decades, then it is likely that something would appear during that time.

      I wouldn't want to have to argue with the people who say "year 12, month 2, day 7, 7:31:59am sounded kinda like Beethoven for thirty seconds, only god could make that happen", but it would still be interesting to see the patterns that must be there.

  2. Nice. by Creepy+Crawler · · Score: 3, Insightful

    So now, YOUR dna isnt just covered be somebody else's patents, but now your DNA is someone else's copyrights.

    --
    1. Re:Nice. by Creepy+Crawler · · Score: 1

      That wasnt supposed to be funny.

      This is the result when one attempts to "reform patents", as we see in a prior article. Remember that patents only have a life of around 17 years. Copyright is, what, 150 years or so, if owned by a corporation. If the corps cant own it via patents, they'll own it via copyright. It's simply the Tragedy of the Anticommons., and was guessed if patent rights were, or perceived to be weakened.

      -- a poem from the opening of Distress, by Greg Egan

      It is not true that the map of freedom will be complete
      with the erasure of the last invidious border
      when it remains for us to chart the attractors of thunder
      and delineate the arrhythmias of drought
      to reveal the molecular dialects of forest and savanna
      as rich as a thousand human tongues
      and to comprehend the deepest history of our passions
      ancient beyond mythology's reach

      So I declare that no corporation holds a monopoly on numbers
      no patent can encompass zero and one
      no nation has sovereignty over adenine and guanine
      no empire rules the quantum waves

      And there must be room for all at the celebration of understanding
      for there is a truth which cannot be bought or sold
      imposed by force, resisted
      or escaped.

      --
    2. Re:Nice. by dwywit · · Score: 5, Funny

      Hence - all your base are belong to us!

      --
      They sentenced me to twenty years of boredom
    3. Re:Nice. by keeboo · · Score: 1

      Hmm... Imagine the possibilities:

      Like, a couple want to have kids, but they have to pay for a "DNA combination license" prior to the conception.
      Since sex carries the risk of conception, even non-conceptive sex will need a proper authorization and a ID (specifying, among other things, sexual orientation). Gay people don't like that and say it does not apply to them, but so is the law.

      Parents would not only worry with feeding, paying school etc. There will be a regular tax which would go to a RIAA-like organization, just in case (how can they be sure your DNA is not owned by them)

      Your DNA will entitle you to certain activities, jobs etc and restrict other ones. Much like GATTACA, except that in the real world you will be ugly and sick. But you will have pay anyway.

      Then, after you lived a glorious life, you unexpectedly die.
      Since your death lacked prior notification, your descendants will have to pay a fine for "unauthorized deactivation of a DNA-carrying device".

    4. Re:Nice. by sowth · · Score: 1

      It would be: "All your base pair are belong to us!"

    5. Re:Nice. by Ginger+Unicorn · · Score: 1

      whoosh

      --
      (1.21 gigawatts) / (88 miles per hour) = 30 757 874 newtons
    6. Re:Nice. by Anonymous Coward · · Score: 0

      Somewhere an RIAA lawyer is drooling over this:

      1. Offer free gene sequencing to yourself and your partner (you get the data, RIAA gets the copyright)

      2. Wait for you to reproduce

      3. Sue your offspring (they are doing mash-ups of the data)

      4. Profit!

  3. Douglas Adams by GrahamCox · · Score: 3, Informative

    Douglas Adams (also DNA) used this idea in one of the Dirk Gently books - turning arbitrary data into beautiful audio. Then again he may have nicked it from Brian Eno, who was also talking about something similar in the 70s.

    1. Re:Douglas Adams by v1 · · Score: 3, Informative

      I was hoping they'd be playing some sort of music created from the sequences. listening to some monotone voice recite letters of the alphabet ad-nausium isn't going to attract anyone

      --
      I work for the Department of Redundancy Department.
    2. Re:Douglas Adams by clang_jangle · · Score: 3, Informative

      Agreed, it's very disappointing. I guess samzenpus calling it an "artistic project" in TFS set me up to expect more. Wonder if he actually lisened to it? Here's a direct link to the stream, for sam and whomever else wants to hear.

      --
      Caveat Utilitor
    3. Re:Douglas Adams by Amouth · · Score: 3, Informative

      to be honest i was thinking the same thing.. after seeng some of the patterns in the image versions i was wondering if they where going to take either the individual pairs and match them with and instrament or have one modify the other or something - kinda like the network analyser that turns logs and box loads into clasical music..

      if they did that and it was remotely nice to listen to.. i would have it book marked - but after 30seconds of that thing i will never touch it again except maybe to troll someone

      --
      '...if only "Jumping to a Conclusion" was an event in the Olympics.'
    4. Re:Douglas Adams by sneilan · · Score: 0

      The audio keeps skipping. They must be getting slashdotted :)

      --
      "I like it when the red water comes out.."
  4. This project is overrated. by gravos · · Score: 4, Insightful

    I can't figure out why this project is so interesting. The audio sounds like weird computer-generated noise to me and the images look like colored noise with some weird patterns in them. Who cares? It looks like the data segment of a program when I dump it to video memory accidentally. Yeah there are patterns but what is the value in them? Not much.

    --
    This game will waste your life. Don't clicky!
    1. Re:This project is overrated. by sneilan · · Score: 1, Interesting

      Well, this art definitely isn't worth much. It would be worth our time if it was interesting to look at or fun to listen to. I think that's the real hard part about this. If it were so easy to make something truly magnificient (that takes raw crap and makes something beautiful), then, maybe some of these people would get into galleries. This is more like it: http://www.tinywonderstudios.com/

      --
      "I like it when the red water comes out.."
    2. Re:This project is overrated. by Walpurgiss · · Score: 1

      It would be pretty awesome if they could write some software that takes the person's dna sequence as input, and outputs one of those composite picture of you made up of pictures of you things. But I guess some kind of fractal pattern is the best one could really hope for.

    3. Re:This project is overrated. by sneilan · · Score: 0

      You mean like render their face? That'd be intense. Maybe they can do at least parts of their face, like their eyes or their skin color.

      --
      "I like it when the red water comes out.."
    4. Re:This project is overrated. by Anonymous Coward · · Score: 0

      they might accidentally bump into a new discovery... like a misterious new pattern that could have a message sent by the aliens who made us (or some other LOL-ish entity)

    5. Re:This project is overrated. by Anonymous Coward · · Score: 1, Funny

      Do you realize that the value in those patterns enables you to use a computer and write that?

      Seriously, I heard a great pattern

      CCAAAAA
      CCCTAGT
      TCAGTCA
      GATTACA
      GATTACA
      GATTACA
      GATTACA
      CGAAACT

    6. Re:This project is overrated. by Lloyd_Bryant · · Score: 1

      They could do the eye, skin, and hair color.

      --
      Don't tell me to get a life. I had one once. It sucked.
    7. Re:This project is overrated. by Anonymous Coward · · Score: 0

      Thanks! Your inability to see past rhe literal has overwhelmed us!

    8. Re:This project is overrated. by initialE · · Score: 1

      You can make a bajillion dollars out of that, just ask Trent Reznor.

      --
      Starbucks, Harbuckle of Breath.
    9. Re:This project is overrated. by zygotic+mitosis · · Score: 2, Funny

      This sounded great on my guitar until I came to the T chord.

    10. Re:This project is overrated. by interstellar_donkey · · Score: 1

      It wouldn't surprise me if people found images in the sequences depending on how they were displayed because they want to see them.

      People can look at things a certain ordered sequence and "decode it" into something different that seems ordered. For example, the Bible code.

      There is no doubt that will all that raw data, eventually someone will claim to have found a picture of Jesus in the Human DNA sequence.

      --
      The Internet is generally stupid
  5. this art is lame, and uninspired by Anonymous Coward · · Score: 0

    as a bioinformatist and an artist, this is stupid and uninspired.

    how about using sequence conservation to dictate chord progression? or SNP data that determines the genetic profile for a genetic-algorithms like graphics generator? correlate the noncoding DNA vs coding DNA to the ratio of thoughtful vs thoughtless youtube comments. even these ideas are stupid and could be implemented in a day, but they are more thoughtful then this garbage.

    the only reason this is getting /.'d is the use of the genome in art. i'm guessing you could combine your boogers with the genome, and you would get press.

    get a job.

    1. Re:this art is lame, and uninspired by 4D6963 · · Score: 1

      Yeah, here's a better idea : play a note, if A is the next note, go down 4 semitones, if T, go up 4, if C, go up 2, if G, go down 2.

      Then elaborate by adding rules, wrap around min/max notes (you don't want it to end up too low or high), and if a certain sequences appears then do something special, or even use pairs of letters to have more options.

      --
      You just got troll'd!
  6. The wanty gene. by Ostracus · · Score: 1

    "After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."

    And yet it'll still be torrented.

    --
    Shai Schticks:"You don't make peace with friends, you make peace with enemies"
    1. Re:The wanty gene. by Hognoxious · · Score: 1

      But will it be available on Guitar Hero?

      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
  7. Staring at Hex Dumps by Anonymous Coward · · Score: 0, Interesting

    Staring at that code reminds me of staring at binary executables converted to hex. You see all sorts of nonrandom structures that are obviously meaningful in some way, but you can't tell what's going on by looking at the whole thing. In my view, it's an indication that we are biomechanical things, and that that DNA sequence is a program for building one of us. The implication, though a little hard to face, is that we get conscious awareness for free as a side effect of the feedback loops in the design of our hardware, and that it'll stop when the hardware breaks.

  8. Re:This project is overrated. - Modem hacked genes by Anonymous Coward · · Score: 2, Funny

    Bring the 14.4 modem out of the closet and demodulate the audio sequence data.

    Then, when you've got the entire code backed up locally, sue them for releasing
    sensitive medical data over the internet without authorization.

    Step 4: profit.

  9. Little do we know... by gsmalleus · · Score: 2, Funny

    It is actually just some kid with a broken Speak & Spell.

    1. Re:Little do we know... by Kozz · · Score: 1

      It's not broken. It's been given to a two-year-old. Parents of two-year-olds can back me up on this one.

      ("would you please stop pushing that same f@%*#&$ button!?")

      --
      I only post comments when someone on the internet is wrong.
  10. A bit behind... by minvaren · · Score: 1

    The Shamen did this with their song S2 Translation almost 15 years ago. Granted, it was a segment of a protein instead of the full genome, but it sure sounded better.

    --
    Big! Strong! Wow! Tada-O!
    1. Re:A bit behind... by maccallr · · Score: 1

      Hey, I even know the guy who worked with the Shamen on this. He would probably agree with me that "DNA music" is never going to be more than a gimmick (although there's probably a huge market for it in the magnet/crystal/copper pendant brigade).

      Now, what is much much more interesting is proper evolutionary music, like my recently released (on Darwin Day, of course) site which has four channels of real time streaming evolving electronica. The link's in the sig...

  11. older by BorgCopyeditor · · Score: 1

    John Cage wasn't just talking about it, he was doing it (including radios and other aleatory elements in his performances) back in the 1940s.

    --
    Shop as usual. And avoid panic buying.
  12. Destruction by Anonymous Coward · · Score: 0

    Well, looks like it's only another 23.5 years until Lavos is born then...

  13. I don't get it... by iluvcapra · · Score: 2, Insightful

    It sounds like a numbers station, but at that it's still not very useful.

    The problem with this and DNA-rainbow is that it doesn't transform the domain of the raw base pairs into a domain of human vision (or audition) in such a way that actual higher-order patterns occur. We take long strings of tabular numbers that have no pattern at all and transform it into a beautiful curve, and this gives us insight into what the numbers may mean, what they may do in the future, etc. But this stuff adds nothing to the noisy junk it's built on... imho

    --
    Don't blame me, I voted for Baltar.
    1. Re:I don't get it... by cekander · · Score: 1

      Yeah, a higher order audio signal could be constructed, and that 23.5 years could be greatly reduced.

      I wonder, if mapping DNA to more a complex audio signal, what's the shortest signal (or "song") that could be produced, such that the song is both pleasant and distinct (to human ears) for each DNA sequence? I wonder if people would have a natural tendency to enjoy such a song based on their own DNA.

      But of course, that's silly. DNA doesn't sequence songs, it sequences people. Ahhh... the song of life. :)

  14. Numbers Station by Penguinshit · · Score: 2, Interesting

    It's the ultimate numbers station!

    --

    I have something in common with Stephen Hawking...

  15. So, if your DNA is fscked up and you dial into it by davidsyes · · Score: 1

    like it's a radio show, then woulld you be a "freak show"?

    --
    Previously: "Linux... Toward the Sunrise..." Now: "Linux... Toward the-- No, now, part of Every Sunrise"
  16. Bit boring really by BungaDunga · · Score: 1

    Just as interesting as looking at the base pairs... which isn't very. Someone needs to put this into Songsmith somehow.

  17. It has to be said by INeededALogin · · Score: 1

    Karma be damned! That was hella lame. I want my 12 seconds back.

  18. DNA to Sound by PoolOfThought · · Score: 2, Informative

    I did a dna to sound project as a graduate student that actually played notes for a given chromosome. In fact I created an entire virtual orchestra (multiple machines) that were able to sync up and play from the same piece of sheet music (DNA). I don't remember exactly how I encoded the notes (If I recall the user was able to (1) select how many alleles should be in a note (2) the program would then break a given strand up according to the value entered (3) the user would choose the frequency to apply to each generated collection of alleles (4) the strand would be played. It didn't sound too bad. Kind of random, but not too bad. Definitely better than just reading them outloud.

    The idea was that while LOOKING at the string ACTGGGAACCTTA a person may not see (consciously) anything of interest... not even repeated sequences of characters if they were sufficiently far apart... However, humans are VERY good at noticing patterns in sounds. So are animals. I won't get in to exactly what we were trying to accomplish at the time other than pattern recognition of good and bad DNA (for one purpose or another), but I will say that these folks should be able to create "music" if they wanted.

    [Now I'm going to have to dig through the archives to see if I can find my program]

    --
    My present is the activity I am currently engaged in with the purpose of turning the future into a better past.
    1. Re:DNA to Sound by PoolOfThought · · Score: 1

      I'll be darned. I actually found the source code for the "dna sonification project". It turns out it was INTENDED to be a "dna" program, but it will allow any string... for example it could play the text on slashdot as "music".

      I'm not sure it isn't an early version (some debugging message boxes occasionally pop up) but it works once the libraries are installed. If anyone is interested let me know... I'll gladly provide the JAVA source code and other libraries as I'm not doing much with it these days other than having it stashed away in a box. I don't have a java development environment on any of my machines anymore so it will come in it's current state or not at all.

      It could actually make some pretty cool sound sequences. It allowed you to define the number of nucleotides that defined a note. Then it let you break those apart into a duration component and a frequency component. The frequency ranged 8 octaves and the durations were WholeNote, Half, Quarter, Eighth, 1/16, 1/32.

      --
      My present is the activity I am currently engaged in with the purpose of turning the future into a better past.
  19. As long as you don't forget to... by Anonymous Coward · · Score: 0

    ...LISTEN to the phat base!

  20. Made up words... by spike1 · · Score: 1

    So, as the project itself is so boring and uninspired...

    BROADCASTED?!
    Please don't tell me people have actually started using that. The word is BROADCAST.
    The sounds will be broadcast, the sounds are being broadcast, the sounds WERE broadcast.
    There is no past tense for that word.

    1. Re:Made up words... by bumby · · Score: 1

      (double)spike1
      I typecasted you!

      --
      Hey! That's my sig you're smoking there!
    2. Re:Made up words... by Anonymous Coward · · Score: 0

      There is no past tense for that word.

      If I say "it was broadcast yesterday", that sure sounds like past tense to me.

    3. Re:Made up words... by spike1 · · Score: 1

      The word remains unmodified though.
      You didn't say "It was broadcasted yesterday" did you?

    4. Re:Made up words... by Scribbler'sEmporium · · Score: 1

      New Scientist has a good article on the changing nature of English language. One of the trends is to reduce the variability in non-standard verbs. ie make all verbs work the same way. "Run" will become "runned" on day. The trend starts with big words that people dont know well or dont know the rules for... like broadcast. Change is coming!!!

    5. Re:Made up words... by spike1 · · Score: 1

      Change which I will resist to my last breath.
      Education is what's needed, not bowing to the ignorant.

  21. broadcasted? by Anonymous Coward · · Score: 0

    Speak English!

  22. Can you hear the codes in the feed?! by Anonymous Coward · · Score: 0

    This feed is trying to drill some message into my mind, but what.....But what.....

  23. id card for humans to ETs by Anonymous Coward · · Score: 0

    It's being broadcast on radio so that extraterrestrials can pick up the signal and reconstruct human DNA on their end.

  24. Microsoft tests by Cathbard · · Score: 1
    When Ballmer's DNA was fed in all that was heard was "developers, developers, developers"

    We don't know what Gates' DNA sounded like because it opened up a gateway to hell that swallowed everybody in the room.

    --
    "A cynic is what an idealist calls a realist" - Sir Humphrey Appleby
  25. Longest Song in Guitar hero EVER by Technopaladin · · Score: 1

    Who else would download it?

  26. Real DNA Music by axeldot · · Score: 1

    This has been done before, but in the way that we all expected.

    http://whozoo.org/mac/Music/samples.htm

    These make good background music while I'm working. And I'm really fascinated by the fact that I even mildly enjoy music that wasn't written by a human being.

  27. premise of Species movies by peter303 · · Score: 2, Informative

    Scientist implant DNA sequence downloaded by SETI. They didnt understand it, but it turns out to be BAD. Thats how the evil aliens propagate themselves.

  28. The Fools! by Iowan41 · · Score: 1

    Now the aliens can create a slave race of humans without even having to travel here to kidnap any! ;-)

  29. The patterns are just repetative sequences by Scribbler'sEmporium · · Score: 1

    The patterns are just repetative sequences. They have been known for many years. Nothing new here... move along now.