Slashdot Mirror


UK-Developed 'DNA Spray' Marks Dutch Thieves With Trackable Water

eldavojohn writes "In Rotterdam, there's a new technology in place that dispenses a barely visible mist over those around it and alerts the police. The purpose? To tag robbers and link them back to the scene of the crime. From the article, 'The mist — visible only under ultraviolet light — carries DNA markers particular to the location, enabling the police to match the burglar with the place burgled. Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence: "You Steal, You're Marked."' Developed in Britain, it's yet to nab a criminal but it will be interesting to see whether or not synthesized DNA will hold up as sufficient evidence in an actual court of law." So it's not just for copper thieves.

191 comments

  1. So, worse than 1 MILLION CCTVs? by Anonymous Coward · · Score: 0

    How uplifting !!

  2. idiotic, as usual when it's for Queen&Country$ by Adolf+Hitroll · · Score: -1, Troll

    nt

    --
    Smile, don't click...
  3. Water? by Anonymous Coward · · Score: 0

    Seriously? I'm no scientist, but it seems like a good scrubbing and you'd make a clean getaway. Har har...

    1. Re:Water? by jandersen · · Score: 4, Interesting

      Seriously? I'm no scientist, but it seems like a good scrubbing and you'd make a clean getaway. Har har...

      Good joke; but since you are no scientist, perhaps you wouldn't know that they even think about these trivial, blindingly obvious things and test for them.

      Nope, mate, what you see here is a bloody clever thing, and not something you can easily find a way out of. DNA sequences can be purpose built nowadays, and soon it will be cheap enough for everybody to buy. The number of variations are practically unlimited, so you could more or less mark every brick in London with their own, individual marker, and you can't just wash it off and be sure not to carry it around with you; plus of course they don't put a big sticker on the outside of marked objects to warn you. If you want to avoid carrying this stuff around with you, you will have to put on a full environment suit, and since you never know where you can come across this stuff, you will have to do it every time you do something you don't want to be nicked for. The problem with environment suits is, they tend to stand out, of course.

    2. Re:Water? by Eraesr · · Score: 1

      I read somewhere that it doesn't come of by simply washing with water and soap. I know, I know, [citation needed] etc, but I don't have a source right now.

    3. Re:Water? by ledow · · Score: 5, Interesting

      Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag, the tools, the stolen property. So you'd need to do a job and then ditch everything you have in a forensically secure way. I've used a similar competing product called SmartWater.

      The beauty of things like SmartWater is that its a suspension of fine molecules that can be *uniquely* identified to a particular user (i.e. you get a coded bottle with a unique number and a unique solution). The UV is just there to light up when people go through police stations but the chemical itself is, supposedly, uniquely identifiable.

      Answering "How did you come to have UV marker solution on your clothes?" is easy. You were security marking your own equipment, you work with the stuff all the time, it must have been on something you picked up, maybe someone was playing a prank. Answering "How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X, when there was a burglary at Company X last night, when you claim to have been at home and never near Company X?" is a bit more tricky, especially if it's a fine mist that soaks into anything and everything it touches.

      I've used the SmartWater stuff, which is very similar to this, and it's a wonderful deterrent. They claim to have a 100% conviction rate when property / people are found by police with SmartWater on them and given that they are often used in bank security vans, that's quite impressive. I don't know if that was true, or still is, but it's plausible. Basically if the police find the tiniest forensic trace of that stuff on property / people they question, they can take a sample, send it to the company, who will tell them who bought that EXACT pot of tracer ink. I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years.

      This stuff isn't just a UV-tracer. It puts you, forensically, at the exact scene of a particular crime. And given that I know of no lawsuits with any of these stuff being in question, they must have a pretty cast-iron chemical description that can satisfy a court of law or, at least, people who are caught with it on their clothes that it wouldn't be worth challenging.

      It's also very good for equipment recovery. It basically guarantees identificiation / return of stolen property if it comes into police hands. Before, even if your stuff was security marked, it wasn't guaranteed that you would get it back (the first thing is that people try to file off the security marks - I've had police tell me of cases where they had to return goods with obviously filed-off security marks because they couldn't prove it WASN'T the suspected thieves and couldn't trace the actual owner), but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner.

    4. Re:Water? by nunojsilva · · Score: 1

      DNA sequences can be purpose built nowadays, and soon it will be cheap enough for everybody to buy.

      So, soon not only the robbed people will be able to buy one of those markers - other people will be able to do it too.

      This probably means, even if this now has some chance of being accepted in court, it will (I hope) be droped when they find anyone can be framed by the real burglar, if she gets the chance to build the same sequence with the same environmental markers.

      A good question is, perhaps, whether it will be easy or hard to do so.

    5. Re:Water? by Thanshin · · Score: 1

      Answering "How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X, when there was a burglary at Company X last night, when you claim to have been at home and never near Company X?" is a bit more tricky

      A: Yesterday, a guy in the street sprayed me with a substance I didn't identify. I tried to chase down the guy to ask for an explanation but he ran faster than me.

    6. Re:Water? by zwarte+piet · · Score: 1

      I'd say, buy your own spray system and get a nice dose of the stuff on your clothes to mask company X's tag before you start scrubbing.

    7. Re:Water? by arivanov · · Score: 2, Interesting

      It does. To an extent. Not enough though.

      The PCR techniques used to amplify it for detection purposes are so sensitive that enough remains can be picked up by crimelab.

      The only way to reliably "clean" clothing that has come into contact with this is to dip it in DNAases (enzymes that specifically hydrolise DNA). These are actually quite easy to come by in Holland. Holland is one of the world capitals of developing "pumped up" chicken meat. That used to be "pumped up" with crude pork and beef proteins extracts, however labs started picking up pork or beef based on DNA (very similar to this detection method). So now the extracts are treated with DNAase so that the tests do not work. As a result DNAase is actually not that difficult to come by. Just talk to your "halal" (quotes intended as it is stuffed with pork to the hilt) cheap chicken supplier.

      Not that it would matter anyway as this is mostly against petty criminals.

      --
      Baker's Law: Misery no longer loves company. Nowadays it insists on it
      http://www.sigsegv.cx/
    8. Re:Water? by DrXym · · Score: 1
      I read somewhere that it doesn't come of by simply washing with water and soap. I know, I know, [citation needed] etc, but I don't have a source right now.

      Thieves are not generally known for their intelligence. Even if they were aware of the magic dye, they would have to arm themselves with a black light and literally scrub everything - themselves, their clothes, their shoes, their car, the trail of drips / prints, and anything they touched for the police to be no better off than if the dye system had not deployed. I bet you could be at it for hours and still leave traces. Even if you think you've washed the dye off, there might stuff left that can be swabbed and detected in a lab.

    9. Re:Water? by Moraelin · · Score: 5, Insightful

      Actually I'd expect it to be even worse, thanks to the CSI effect. Basically the same blind belief that if it's some hi-tech shit, then it's more infallible than the Pope and those scientists 100% thought of and prevented every possible problem or false positive, that you can see in the GP post.

      Someone _will_ get sent to jail by some idiot jury because the real burglar -- who, for example, is an employee and didn't even need to synthetise anything: he just nicked the bottle that the PHB cleverly hid in his desk drawer -- sprayed them with it.

      That's actually the important part: often when it looks like there's some impossible hurdle like synthetising DNA, there are often _much_ simpler ways to plant it, _and_ you can rely on some idiots still thinking that only the really complicated way exists. E.g., people have already planted DNA at a crime scene by just taking a cigarette butt from a bus station and dropping it there. Here you don't even have to do that.

      Or as an even more trivial example, if a co-worker you really don't like leaves his coat behind and his wallet in it, spray the coat and banknotes in the wallet, steal the same amount from the cash register, tip someone off that you saw them stealing again. Double profit. You got the money, and got rid of that guy or gal you don't like.

      Yeah, they'll end up having to convince a jury that those scientists and their hi-tech solution are fallible after all. Good luck with that in a world being told the opposite by PR. And where they saw on TV every week that you can take a hair you found on a carpet and know exactly that it belongs to the killer (and not, say, to one of the guests the victim had two days before that, or some guy in the bus leaving hair on her coat) and run a DNA analysis to tell you exactly what the killer looks like. Or that you can take a two by two pixel image of the back of someone's head from a security camera, enhance it to a clear 1600x1200 image and, with a couple more mouse clicks, turn it around to see the culprit's face.

      Seriously, we're already at the point where some juries acquit because you didn't do that, or conversely people who spent time on the death row because some pseudo-science mumbo-jumbo must be 100% correct and accurate like on CSI.

      --
      A polar bear is a cartesian bear after a coordinate transform.
    10. Re:Water? by N1AK · · Score: 2, Insightful

      And as long as you didn't fit the CCTV footage, have a record for that type of crime, find it hard to show evidence of the spraying, had a remotely plausible alibi, leave any DNA or fingerprint evidence at the site etc I'm sure you might have a chance with that defence.

      I'm very sceptical about DNA evidence being used to convict. I'm a lot less sceptical about evidence like this being used to build a compelling case alongside other evidence, or to narrow enquiries. You can, never, ever, 100% prove someone committed a crime even if they admit it, did it in public and on CCTV. You can however be confident the odds of a false conviction are vanishingly small, requiring any more that isn't plausible.

    11. Re:Water? by cgenman · · Score: 4, Funny

      Whew! And here I was afraid the spray was just cat pee.

      Nothing gets that stuff off.

    12. Re:Water? by Anonymous Coward · · Score: 0

      In another Dutch city (Utrecht) people get a free DNA kit from the police, to mark their valuable belongings. I assume they allready are cheap. It can't take long before anyone can just buy one and start playing with it.

    13. Re:Water? by ByteSlicer · · Score: 1

      The only way to reliably "clean" clothing that has come into contact with this is to dip it in DNAases

      Just use bleach. It will do the job faster, more reliant and cheaper.

    14. Re:Water? by AmiMoJo · · Score: 2, Informative

      Why not just buy some of this spray, covertly spray some around a jewellery shop and then report them to the police for handling your stolen property?

      Most thieves either get caught at the scene or they get away and the police eventually track them down much later. After multiple showers and scrubbing I doubt that there would be enough of this stuff left to get a positive DNA match. Don't forget that the police have lied about the accuracy and reliability of DNA. The Omagh bombing trial collapsed because the DNA "amplification" technique was shown to be unreliable and because it threw up two matches from the database anyway which implies that the odds of a match are much lower than the 1 in 100,000,000 they were claiming.

      You could probably just buy some of this stuff and then apply it to yourself. There would be little chance of getting a reliable clean sample.

      Sounds like snakeoil to me.

      --
      const int one = 65536; (Silvermoon, Texture.cs)
      SJW, n: "Someone I don't like, and by the way I'm a fuckwit" - AC
    15. Re:Water? by Stooshie · · Score: 2, Informative

      " ... plus of course they don't put a big sticker on the outside of marked objects to warn you ... ".

      Err, yes the do. RTFA and see the big orange sign.

      Also, DNA can degrade fairly quickly if it is not part of a living cell and there are many chemicals that can break DNA down.

      --
      America, Home of the Brave. ... .and the Squaw.
    16. Re:Water? by delinear · · Score: 2, Interesting

      My chief concern is, if this is deployed as a "mist", how easy is it for others to get wrongly tagged. Can it get into aircon units and spread around the building? Can it escape the building and tag people in the street? Depending how blunt an instrument this is, it might not be enough to show a few drops, we might expect that only people who are literally drenched in the stuff are likely to be found guilty (and even then, who's to say the real criminal didn't lift a bottle of the stuff and toss it over the most likely suspect). If this is used purely for detection, fair enough; if it's used for conviction I'd be pretty worried.

    17. Re:Water? by Thanshin · · Score: 1

      And as long as you didn't fit the CCTV footage, have a record for that type of crime, find it hard to show evidence of the spraying, had a remotely plausible alibi, leave any DNA or fingerprint evidence at the site etc I'm sure you might have a chance with that defence.

      You mean criminals have a hard time finding a single friend who owns any kind of spraying bottle and a hooded sweatshirt?

    18. Re:Water? by digitig · · Score: 1

      plus of course they don't put a big sticker on the outside of marked objects to warn you.

      From the summary: "Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence".

      --
      Quidnam Latine loqui modo coepi?
    19. Re:Water? by Mr.+Freeman · · Score: 5, Interesting

      ""How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X"

      Are you sure it was only issued to company X? Show my evidence that no other bottle could possibly contain the same solution. See, with humans this process occurs naturally, everyone has different DNA (with extremely high probability) because of how biology works. Once you start making your own, you've shown that it's possible to duplicate DNA, thus the solution is NOT necessarily unique.

      "I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years."

      So, you have now just told us that you have the ability to put the SAME SOLUTION on multiple DIFFERENT ENTITIES MULTIPLE TIMES PER YER for years on end. Thus, anyone could, with only a tiny amount of this stuff, frame any number of different people with extreme ease.

      "but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner."

      No, it will link it to whoever managed to get their hands on one of these bottles and spray it on whatever the fuck they felt like. I could go mark every computer at my local university with this stuff and then claim that the entire computer lab belonged to me because only I have this bottle of magic property-identifying liquid.

      --
      -1 disagree is not a modifier for a reason. -1 troll, flaimbait, redundant, overrated are NOT acceptable substitutes.
    20. Re:Water? by digitig · · Score: 1

      Thieves that get caught are not generally known for their intelligence.

      Fixed that for ya.

      --
      Quidnam Latine loqui modo coepi?
    21. Re:Water? by ccguy · · Score: 1

      Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag,

      Well, any store that wants me to come home with their mist can go fuck themselves. Hopefully they'll make it mandatory to warn about that crap being in the air at least.

    22. Re:Water? by 1s44c · · Score: 1

      Just talk to your "halal" (quotes intended as it is stuffed with pork to the hilt) cheap chicken supplier.

      You seriously think they use denatured beef and pork protein in halal chicken? If that's true it would upset the Jews, Muslims, and Hindu's something crazy.

      Do you have any evidence chicken producers do that? A URL or anything?

    23. Re:Water? by Sulphur · · Score: 1

      A: Yesterday, a guy in the street sprayed me with a substance I didn't identify. I tried to chase down the guy to ask for an explanation but he ran faster than me.

      Maybe that's what the crooks were doing at the track. They were qualifying runners.

    24. Re:Water? by Joce640k · · Score: 1

      ...and more harmful to the colors!

      --
      No sig today...
    25. Re:Water? by Joce640k · · Score: 2, Insightful

      Maybe we're overestimating the intelligence of people who'll walk past a big orange sign in broad daylight and rob a McDonalds.

      --
      No sig today...
    26. Re:Water? by Anonymous Coward · · Score: 0

      Cheesing is bad, mmmmmkay?

    27. Re:Water? by Joce640k · · Score: 1

      Why would it mask it? You'd just have two different markers on you, that's all.

      --
      No sig today...
    28. Re:Water? by mapkinase · · Score: 1

      It's interesting how technology developed from personalized crafts where each creation was unique to the mass manufacture with identical copies of the same product (often fully automated, which insures that those copies are indistinguishable) to the artificially personalized copies of the product - unique id tags, serial numbers were superficial and mostly easily removable from the product, but those two recent developments indicate that manufacturers and owners will go at length to make sure that the added uniqueness stay thoroughly embedded to and unalienable from any given copy of the product.

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    29. Re:Water? by DrXym · · Score: 1
      Fixed that for ya.

      Who do you think would be busting into a run down McDonalds? Raffles the Gentleman Thief?

      It's probably a gang of scumbags from the nearest housing estate. Chances are the cops would suspect who did it and presence of the dye on any of them would easily confirm it.

    30. Re:Water? by Joce640k · · Score: 1

      The shop will have their receipts in good order, will you have yours?

      --
      No sig today...
    31. Re:Water? by mapkinase · · Score: 1

      Similar technology is used by dogs to mark they trees they own in the park.

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    32. Re:Water? by Joce640k · · Score: 2, Insightful

      That's a pretty massive 'if'.

      I think you overestimate the sort of person who robs McDonalds, if they had a second brain cell to keep the first one company they wouldn't be doing it.

      Masterminding some sort of DNA-resequencing plan? Not so much.

      --
      No sig today...
    33. Re:Water? by Anonymous Coward · · Score: 0

      Or just put it all under a UV light...

      We use a UV light in our PCR hoods to destroy any lingering DNA so we don't get any extraneous signals in our sequencing.

    34. Re:Water? by flyneye · · Score: 1

      Clean?
                I believe I would fill the DNA tank from my bladder.
      It really makes good ironic sense. Piss on 'em.

      --
      *Repent!Quit Your Job!Slack Off!The World Ends Tomorrow and You May Die!
    35. Re:Water? by dave420 · · Score: 1

      *crickets chirping*

    36. Re:Water? by dave420 · · Score: 1

      No, they have a hard time filling the spray bottle with a substance that is only issued to a single, specific company.

    37. Re:Water? by inca34 · · Score: 1

      pH-adjusted bleach should do it. For example, chlorox and vinegar.

    38. Re:Water? by dave420 · · Score: 1

      This is not the same DNA as you are made of. It doesn't behave the same way.

      This is not evidence all on its own, it's used to further investigation.

    39. Re:Water? by Anonymous Coward · · Score: 0

      Masterminding some sort of DNA-resequencing plan? Not so much.
      --

      If it is script-kiddie level easy (like, buy it at the seven-eleven, put a drop of original dna in, get a spray in 10 minutes), it will be used.

    40. Re:Water? by sempir · · Score: 1

      APB...if you can't read the suspects DNA check if they are dressed all in white and carrying fish and chips!

      --
      A closed mouth gathers no foot.
    41. Re:Water? by Jurily · · Score: 1

      Couldn't agree with you more. It's a sad day when xkcd can be used legitimately in court.

    42. Re:Water? by mayberry42 · · Score: 1

      I've used a similar competing product called SmartWater.

      The beauty of things like SmartWater is that its a suspension of fine molecules that can be *uniquely* identified to a particular user (i.e. you get a coded bottle with a unique number and a unique solution). The UV is just there to light up when people go through police stations but the chemical itself is, supposedly, uniquely identifiable.

      You mean this smartwater? Wow, i had no idea flavoured vitamin water could do such things! And i thought it was to make you smart...

    43. Re:Water? by beh · · Score: 5, Informative

      I would guess, the product in question is http://smartwater.com/

      Living in the UK a few years back, I had started using it to mark belongings of mine, after a friend working for the police recommended it.

      The stuff is almost transparent - but, when I applied it to a grey camera lens - it's still easily visible on it -- on black or white lenses it's not much of a problem.

      On the greyish lens, I tried to wash it off - and have found that I couldn't (wet wipes, ...).

      The stuff sticks fairly well - I can't even say I managed to get a noticable amount of it off.

      As far as marking belongings goes - you literally only need a very small spot of it; and you can pick some place where it isn't too obvious. On my Nikon lenses, I sometimes put the spot on the 'o' in the Nikon logo. Trying to get this off would probably seriously (cosmetically) harm the lens; scratch off part of the logo - and the resale value will drop massively: No point trying to call it 'near mint condition' afterwards.

      Under UV light, the spot is easily visible - under normal light, it's near invisible.

      From another friend who works as a shop fitter for jewellers, he's tried it in alarm systems, and he told me, that it will take a few days/weeks before you get all of it off (i.e. small amounts still lodged in skin pores are almost impossible to get out easily).

    44. Re:Water? by CarpetShark · · Score: 1

      DNA sequences can be purpose built nowadays

      Yes, but not always understood.

    45. Re:Water? by Thinboy00 · · Score: 1

      Do you have any evidence chicken producers do that? A URL or anything?

      What are you, crazy? This is /.!

      --
      $ make available
    46. Re:Water? by breagerey · · Score: 1

      This is silly.

      How likely is is that the police are going to wave UV lights over suspected stolen property?
      or that they will wave the light in proper place?
      or that they will even know what to do if something fluoresces?

      And assuming they *do know about the stuff AND look for it AND find it ... how likely is it that they will take the time (and money) to get a sample and send it off?
      Not to mention the legal shakiness of the solution actually being unique ... or that it actually identifies anything as belonging to you.

      I can see this as a deterrent but the odds of anybody actually running a PCR on suspected marker on a suspected stolen laptop seem to make it not much more.

    47. Re:Water? by RMH101 · · Score: 1

      Thank you. I've been reading the completely naive "explanations" of how this must work and was working up to attempting a post like yours. It's obvious that after even a moment's introspection that this stuff does have a use, and isn't simply an excuse to arrest anyone covered in UV paint. Cheers

    48. Re:Water? by Anonymous Coward · · Score: 0

      And you believe the suppliers don't know this?

      I have a couple of Jordanian acquaintances, who run small ($3-4 mil a year in sales) businesses buying cheap meat from Eastern Europe for import to several Middle Eastern countries.

      Guess if they care if it contains pork protein as long as the price is right.

      To quote one of them, "In Jordan, no bork, here no Jordan, eat bork".

    49. Re:Water? by RMH101 · · Score: 1

      Just think of it as a marker that contains a guaranteed unique identifier. backed up by a system that records which company is associated with that uniique identifier, and records to prove that they were the only company who has access to that identifier. It's millions of tiny (unique to that instance) serial numbers mixed up in a solution of UV-flourescent glue. This isn't that hard to understand, surely?

    50. Re:Water? by AaxelB · · Score: 1

      I'd bet this would be used (well, in a reasonable world) in conjunction with witness reports or camera footage to gather suspects, or to determine the owner of recovered goods. I am curious, though... if you get sprayed accidentally while holding your camera, then your camera gets stolen, will it be returned to the owner of the spray without question?

      1. Buy your own unique DNA spray
      2. Steal shit
      3. Tag the stolen goods with your spray, and maybe scratch off serial numbers or other identifying information
      4. Leave them with some homeless guy and report them stolen (maybe spray the homeless guy too)
      5. The police notice the homeless guy with professional photography gear matching your description, confiscate it and find the DNA tag
      6. The police helpfully deliver your stolen goods to your door
      7. Profit!

      Probably this isn't nearly worth anyone's time, and there are so many ways it could go wrong, but it seems like it could work...

    51. Re:Water? by ledow · · Score: 1

      Given my contact with UK police officers (specifically London ones) in terms of security marking:

      I was warned never to go into a police station soon after I'd done the marking because I *WOULD* be pulled as they have UV lights in reception (where they deal with ordinary queries) for just this purpose and I was lighting up like a Christmas tree. They get them as they enter the building. They even stopped the guy who works for the company because the same thing happened when he walked into a station to demonstrate the stuff for them. It's standard procedure to scan ALL recovered property (and even lost property) for UV tracers and has been for a long while.

      When something fluoresces that's been recovered / handed in, and they suspect it's stolen, they send it to the labs unless it's just a postcode marker (and then they follow up with anyone who was found with it and/or anyone who comes to claim it) - by that time it's evidence and they have to follow the rules of preservation of evidence. UV lights are standard tests when they raid a property and / or catch someone they think is a thief - they check everything. It's part of the standard "put your belongings on the desk" procedure and also followed up to the issuance of a warrant to search their house under suspicious circumstances. The officers I saw even carried key-fob UV LED's to check things like driving licenses (apparently ours have a security marking that fluoresces). Even my driving instructors and examiner did the same before letting me in the car.

      In London, all local police forces know and use SmartWater and will actually attend demo's by the SmartWater people to show how to mark property. Some of the local borough's give it away to their residents. Most security vans now have a big "SmartWater Inside"-type noticeboard, so they use it too. School insurers generally demand that SmartWater is deployed in all schools on any equipment of value. I know - I'm the guy who's had to do it for half-a-dozen schools as part of my IT work and come home covered in UV-flourescent flecks.

      Just because your local cops haven't heard of it, doesn't mean that it's not well known in it's home country.

    52. Re:Water? by AaxelB · · Score: 1

      If they have CCTV footage of an anonymous person on the street spraying them and running away, it doesn't matter what's in the bottle. They can still successfully use the "crazy guy sprayed me" defense, assuming there's not other strong evidence linking them to the crime.

    53. Re:Water? by AmiMoJo · · Score: 1

      Fortunately that tends not to happen in the UK. Unfortunately the alternative isn't that much better.

      We rely on experts to testify about evidence. Thus it is down to your defence team to get a good expert to contest the bullshit that the prosecution's expert is saying.

      That tends to happen during the appeal phase, well after the innocent person has already served years in jail. The most high profile case recently was Barry George. The police said that a single spec of gunpowder on his clothes proves he fired a gun (not necessarily the one used in the murder, BTW) but it was later shown that it could have got there while the garment was in police possession or any number of other ways. One spec is not enough to prove anything, and sure enough he was eventually released after several years behind bars.

      It has happened with fingerprints too. There was a case in Scotland where a man did 3 years because they found "his" fingerprints at the scene. He eventually got an expert from the US to contradict the police's expert who said the prints were a match. Fingerprint matching is an art - it isn't like CSI where the computer matches it perfectly for you. It might be okay-ish for logging in to your laptop but in this case even that primitive test would have failed. Actually, I'd love to see that in a court: a demonstration of how the prints don't match because the little scanner on the laptop says they don't. It could be acompanied by a CSI-style graphical display of hundreds of prints as it tries to match them all, then flash up "NO MATCH" in big bold red letters with a loud beeping sound just to hammer home the point.

      --
      const int one = 65536; (Silvermoon, Texture.cs)
      SJW, n: "Someone I don't like, and by the way I'm a fuckwit" - AC
    54. Re:Water? by AmiMoJo · · Score: 1

      I have news for you: you can print your own receipts!

      Shops don't have magical receipt printing machines. They are the same printers everyone else can buy.

      --
      const int one = 65536; (Silvermoon, Texture.cs)
      SJW, n: "Someone I don't like, and by the way I'm a fuckwit" - AC
    55. Re:Water? by NotOverHere · · Score: 1

      This will be usable for a few years, then you'll eventually have some plausible deniablity when it it over used

      I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years.

      It's also very good for equipment recovery. It basically guarantees identification / return of stolen property if it comes into police hands. but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner.

      If this stuff spreads with the ease that TFA describes, it's going to get everywhere. How many law enforcement agencies do you think are going to take Joe Blow's word that they "only touched something that was touched by someone else, who I shook hands with?

      Experiment: Spill some powered detergent with color safe bleach. Leave it in a public space for a day. Use a UV light to track its spread. Count how many people are now "marked" that were not the original spilling "criminal".

      Yes, this product is uniquely identified, and easily indiscriminately spread. Just use Monsanto as an example of a unique item is being spread by the wind to people being accused of stealing.

    56. Re:Water? by xaxa · · Score: 1

      Companies like this one sell a DNA "paint" which you can use to mark your belongings.

      Microdot security paint (like this) isn't DNA, but can last through a fire.

    57. Re:Water? by AmonTheMetalhead · · Score: 1

      I would guess, the product in question is http://smartwater.com/

      Given the right DNA sequence? Sure, i guess it could be smart!

    58. Re:Water? by mcgrew · · Score: 1

      Most thieves don't get caught at all; I think the statistic is one in ten get caught.

    59. Re:Water? by Anonymous Coward · · Score: 0

      Wait...the same UV light that they use to see if something was sprayed?

    60. Re:Water? by mrjb · · Score: 1

      5. The police notice the homeless guy with professional photography gear matching your description, confiscate it and find the DNA tag
      6. The police helpfully deliver your stolen goods to your door

      Step 5 and 6 are more likely to be "5. The police give you a case number to chalk up for your insurance, which will then go up, and never look at the case again" and "6. Homeless guy gets away with your fancy equipment and is never to be seen again".

      Why do you think the police don't care? Because they're too busy. Why are they too busy? Because the crime rates are too high. Why are the crime rates too high? Because the criminals can get away with their crimes. Why can the criminals get away with their crimes? Because the police don't care. It's not getting any better either. Now get off my lawn.

      --
      Visit http://ringbreak.dnd.utwente.nl/~mrjb/growingbettersoftware to download your free copy of the book
    61. Re:Water? by Builder · · Score: 1

      Once it dries, it doesn't spread like you seem to think.

    62. Re:Water? by Anonymous Coward · · Score: 1, Interesting

      Just curious: did he try going to one of those spas where they completely cover you in exfoliating mud and then take it off? Someone should. You get to prove one or the other ineffective...

    63. Re:Water? by matfud · · Score: 1

      They do. If it ends up being sold as halal/kosher is a different matter. It would not surprise me as it is rarely labled as such and is often repackaged in the country that imports it.
      http://news.bbc.co.uk/1/hi/uk/3006192.stm

    64. Re:Water? by Joce640k · · Score: 1

      Duh! Let me spell it out: I think the police know how to check a paper trail. Expensive jewelery in a shop will have more than a thermal paper till receipt behind it.

      Besides, there's no way you'd be able to spray it without being noticed and just leaving a few fingerprints on it from looking at it wouldn't be the same.

      --
      No sig today...
    65. Re:Water? by ian_from_brisbane · · Score: 0

      Just think of it as a marker that contains a guaranteed unique identifier. ... This isn't that hard to understand, surely?

      I don't understand how you can rely on a company 'guarantee' as proof of anything.

    66. Re:Water? by grumbel · · Score: 1

      Be aware of Printer steganography, which makes it easy to detect that you forged all your receipts with the same printer.

    67. Re:Water? by grumbel · · Score: 1

      Why are the crime rates too high?

      The crimerates are mainly high because a lot of stuff is classified as crime which shouldn't. Stop the War on Drugs and a lot of problems with crime would solve themselves, giving cops time to deal with real criminals.

    68. Re:Water? by anUnhandledException · · Score: 1

      Crime rates in US are at 30 year low. So what is this about crime is too high?

      Perception due to 24/7 media exposure is that crime rates are high. Then again reality doesn't really care about perception.

    69. Re:Water? by RMH101 · · Score: 1

      How do you function in society?
      You accept a company's guarantee to behave in a certain way from your bank, you expect your legal system to behave in a certain way.
      You expect the company that produces any pharmaceuticals you take to make certain guarantees as to quality, testing, efficacy and manufacture.
      It's a forensic tool. Company X will certify that smartwater product ID 12345678abc was manufactured on a set date, track its packaging and dispatch to a specific customer, and then retain their records and full audit trail for inspection by law enforcement.

    70. Re:Water? by anUnhandledException · · Score: 1

      Nobody except you is claiming it is an "auto win" button for crime and property recovery.

      You spraying someone elses property is stupid because you don't have chain of evidence indicating you legally own said property.

      It is the combination of property records + marking liquid + company w/ high level of trust (if smart water company trust is worthless so is the product) that increases likelihood of recovery.

      Sometimes it isn't even about criminal charges. Stolen property ends up in pawn shops all the time missing the serial number. Now if it has been sprayed w/ DNA tagged liquid then one can verify the owner of the property and return it.

      Invoice + police record + smart DNA tag record + stolen property w/ smart DNA tag = pretty good chance that is the original owner.

      vs
      Stolen property missing serial number = never recovered/returned.

    71. Re:Water? by SydShamino · · Score: 1

      Yes, but with Nature's Miracle you don't have to. Just leave it there and no one will ever know.

      http://www.colbertnation.com/the-colbert-report-videos/49811/january-18-2006/bring--em-back-or-leave--em-dead---teacher-s-edition

      --
      It doesn't hurt to be nice.
    72. Re:Water? by smellsofbikes · · Score: 1

      ""How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X" Are you sure it was only issued to company X? Show my evidence that no other bottle could possibly contain the same solution. See, with humans this process occurs naturally, everyone has different DNA (with extremely high probability) because of how biology works. Once you start making your own, you've shown that it's possible to duplicate DNA, thus the solution is NOT necessarily unique.

      It's fairly trivial to synthesize a chunk of DNA that is extremely unlikely to be natural: a couple kilobases of repeated GGGTTTCCCAAAGGGTTTCCCAAA is as unlikely to appear in nature as a monkey typing a couple kilobytes of Shakespeare. Of course it's *possible*, just as it's *possible* that someone else out there has exactly the same fingerprints as you do and that person was the one who left the fingerprints at the scene, but this is why we invented statistics.

      Add to that huge long repeating sequence, a 30 base sequence for actually identifying which customer bought this particular batch, and you have something that is at least as accurate as fingerprinting.

      --
      Nostalgia's not what it used to be.
    73. Re:Water? by SydShamino · · Score: 1

      It's far more likely to be used along with other evidence, i.e. used to refute a police statement where they denied being in that part of town that day, or if they claim to have been in the bank (but a few tellers down, and hence sprayed), used with video surveillance to show weren't.

      --
      It doesn't hurt to be nice.
    74. Re:Water? by Anonymous Coward · · Score: 0

      Admittedly, it's not very hard to be more infallible than the Pope.

    75. Re:Water? by Anonymous Coward · · Score: 0

      Heavens! An entire school's worth of electronics?

      So... what do you do when a student steals something? And what do you do when someone who isn't a student steals something, but you've got smartwater all over the kiddies?

    76. Re:Water? by Christian+Henry · · Score: 1

      Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag, the tools, the stolen property. So you'd need to do a job and then ditch everything you have in a forensically secure way.

      Or simply wear the same clothes to attack / burgle at least one other location that might use a similar spray.

      In other words, what happens when the original layer is obscured by multiple, overlapping layers from some other site? Or, just as bad, if the layers mix, producing a chemical similar to, but sufficiently different from, the original layers?

    77. Re:Water? by radtea · · Score: 2, Insightful

      Just think of it as a marker that contains a guaranteed unique identifier. backed up by a system that records which company is associated with that uniique identifier, and records to prove that they were the only company who has access to that identifier.

      Many people have already pointed this out here, but since apparently it is too hard for you to understand I'll point it out again: no system of identification is more secure than its weakest link. In the case of SmartWater and other similar systems, the weakest link is the end user. Unless you can prove beyond reasonable doubt that no one in the shop in question has had any access to the source bottle, and you can further prove that no one who has been sprayed has ever transfered any of the material to anyone else, ever, you have a very poor identification system.

      The number of people in this discussion who are telling us it is possible to amplify minute traces of this stuff for forensic purposes as if that was a good thing--rather than an open door to false conviction due to accidental transfer of minute traces of this stuff--is depressing.

      This is just another insane scheme by ignorant people who think that "zero" is a tolerance, and it will fail for the same reasons. Every American $100 bill purportedly has non-zero traces of cocaine on it. In a few years of widespread use every person will have a few dozen DNA traces on them, including many from places they have never been due to accidental transfer.

      This isn't that hard to understand, surely?

      --
      Blasphemy is a human right. Blasphemophobia kills.
    78. Re:Water? by L3370 · · Score: 1

      Many sane, functioning members of society don't trust the very government they vote for, let alone a for-profit company.

      Quoting ian_from_brisbane:

      "I don't understand how you can rely on a company 'guarantee' as proof of anything."

      Why should we trust a for profit company's proprietary method of tracking (regulated or unregulated) as gospel? Would you be willing to bet someones life or freedom for that? br>
      If there was some regulatory process that documents the production and distribution of said product, then verification was done by a third party with no stake in the profit *MAYBE* we could trust it. The first question I'd ask, is how do I know product id 12345678abc was not created twice? Who verifies this, and does that person collect a paycheck from the same company that produces it?

      But that doesn't solve the issue that anyone with a few bucks can buy this and spray it over anything they want. So you'd also have to regulate and track purchase and USAGE of the product.
      The very existence of the technology proves this tracker can be duplicated...a terrible product that could never be foolproof.

    79. Re:Water? by RMH101 · · Score: 1

      Becasuse the business model of the company depends on them demonstrating that level of audit! Think!

    80. Re:Water? by GameboyRMH · · Score: 1

      I told you yesterday, get an account!

      http://slashdot.org/comments.pl?sid=1827580&cid=33949006

      --
      "When information is power, privacy is freedom" - Jah-Wren Ryel
    81. Re:Water? by L3370 · · Score: 1

      Circular logic is circular!

      Again, why in the world would I (OR ANYONE) trust a company's [business model] to dictate the freedoms of a suspect?

      The companies business model doesn't necessarily depend on them demonstrating that level of audit. It depends on its ability to continue convincing their buyers that product will catch criminals. They can prove it can tag criminals, so theres no false info there. What they can't prove is that it can catch ONLY criminals.

      Thats fantastic if they can in fact demonstrate their audit process. But are they demonstrating this audit process to the people that matter, like the organization charged with the task of sending criminals to prison? Can they demonstrate the product is infallible? If they can, are they demonstrating this to the right people? Are they being certified on a regular basis?

      How about the buyers? Are they being certified to use it correctly? Have they been certified that they bought the product using their real name and identity? Have they been background checked for criminal history?

    82. Re:Water? by Anonymous Coward · · Score: 0

      This is silly.

      How likely is is that the police are going to wave UV lights over suspected stolen property?

      Actually, probably quite likely given that the police (in the UK) give away UV marker pens so you can write your contact details on your property.

    83. Re:Water? by treeves · · Score: 1

      I should think that once it's hydrolyzed, it's no longer beef or pork anyway, technically. Isn't that good enough for Jews and Muslims?

      --
      ...the future crusty old bastards are already drinking the Kool-Aid.
    84. Re:Water? by matfud · · Score: 1

      The thing is that until recently it wasn't. It was what ever was blasted off and boiled out of the carcases. Now it is the same stuff but you can no longer use DNA to identify which kind of animal it came from.

      Does boiling pork bones down make them halal? You are not talking science here you are talking doctorine. But if they do dont want to eat pork that is fine and I really don't think "pork extracts" should be pushed on them unknowing. Even if it is curshed, boilded down to a pulp, pushed though filters to remove the teath and then put in to thier chicken. I don't want it in my chicken. I don't even want the salt walter that is comonly put into meat in my food.

      matfud

    85. Re:Water? by matfud · · Score: 1

      I must not have read it correctlt the first time.
      The link I gave earlier to the BBC says that the FSA in thier tests half the chicken marked as halal destined for catering was found to contain pork. Here is an earlier report http://news.bbc.co.uk/1/hi/programmes/panorama/3047159.stm

    86. Re:Water? by breagerey · · Score: 1

      I'm glad to hear that the London police are so on top of things.

      My experience is with the LAPD and various smaller LEAs around the US... and I can tell you the likelihood of anything besides deterrence coming of that here is slight at best.
      Most of them are understaffed, underfunded, and overworked... CSI is a TV show and nothing more.

    87. Re:Water? by breagerey · · Score: 1

      lol
      so what happens when I surreptitiously write some other name and address on your possessions?

      this sounds ripe for 'fun' pranks

    88. Re:Water? by jandersen · · Score: 1

      Someone _will_ get sent to jail by some idiot jury because the real burglar -- who, for example, is an employee and didn't even need to synthetise anything: he just nicked the bottle that the PHB cleverly hid in his desk drawer -- sprayed them with it.

      I don't think so; it will not be enough on its own to convict a person on its own; but that is not the point either. The point is to 1) make objects traceable, and 2) make it easier to link people with places in a criminal investigation. So, the police can prove that person was (or was VERY likely to have been) in contact with a marked object.

      And of course, if things are marked with a bespoke DNA that nobody else can (easily) get hold of, you can't just buy a can of the stuff and frame somebody. I imagine they can (and will) sell unique DNA profiles in individual cans marked with a serial number, so each new can will be different.

  4. "visible only under ultraviolet light" by psergiu · · Score: 1

    "visible only under ultraviolet light"

    Then it can't be used in the night clubs as those "black lights" will make-it VERY visible.

    --
    1% APY, No fees, Online Bank https://captl1.co/2uIErYq Don't let your $$$ sit in a no-interest acct.
    1. Re:"visible only under ultraviolet light" by mutube · · Score: 1

      Where do you go clubbing? 1990?

    2. Re:"visible only under ultraviolet light" by Gizzmonic · · Score: 1

      Where do you go clubbing? 1990?

      Why yes, at the 1990 Club. How did you know? Are you reading my DNA?!?

      --
      (-1, Raw and Uncut is the only way to read)
  5. Thus solving the problem once and for all. by Anonymous Coward · · Score: 0

    In other news, a recent surge in sales has sent stock prices of latex glove and raincoat manufacturers through the roof...

  6. Beef spray by Pflipp · · Score: 4, Funny

    Well, that's the first thing they'll serve with actual DNA in it, then.

    --
    "We can confirm that Debian does *not* ship the version with the trojan horse. Our version predates it." [CA-2002-28]
  7. But why ? by twisteddk · · Score: 1

    I understand new tech is nice and all.... But what's wrong with a simple camera ? Or a burglar alarm ? Why bother with these high flying ideas ? I understand that insurance is practically non existant for comanies, but how high costs do you really need to incur to "secure" yourself ?
    You can't even trace the burglar as I understand it, you have to actually find him, and then test people for the presense of the mist. I dont see this a commercially viable product, even if it pans out as permissable in a court of law.

    --
    --- To err is human... Am I more human than most ?
    1. Re:But why ? by EdZ · · Score: 4, Informative

      I've seen stickers in buildings 'armed' with this stuff since the early 90s (my old primary school used it, it came in little bottles with a felt applicator, and the stuff dried out almost instantly so opening one resulted in a mad rush to tag everything). Generally, the idea was not to tag burglars, but instead to stick a dab onto valuable equipment. Because vanishingly few burglars would bother to go over stolen goods with a UV lamp looking for a little glowing patch, and even fewer would then go and acquire the solvents required to remove all traces of the stuff, it generally sticks around better than a simple unpeelable sticker or sand-able etched number. If it got stolen and subsequently recovered, it could then be definitively traced back to a crime. Makes prosecution easier, and helps with insurance (and even getting your stuff back if you can definitively prove it's yours).

    2. Re:But why ? by AlecC · · Score: 2, Informative

      Thieves wear hoods, motorcycle helmets, stockings... Alarms go off so often that responses are slow, if at all: a burglar can be in and out long before the alarm is responded to,

      Since the spray is highly personalized, you can shine an ultra-violet light on a suspect - which they will have difficulty objecting to - and trace them back to a crime for which you may not even have suspected them. If it is the case, as commonly alleged, that the majority of crime is committed by a small number of people, then you may well be able to nab them for crimes for which you have not (yet) suspected them when you question them for a different crime.

      That said, I always have my suspicions of such "miracle inventions". It is worth a try - I look forward to seeing how it works out in practice.

      --
      Consciousness is an illusion caused by an excess of self consciousness.
    3. Re:But why ? by Thanshin · · Score: 1

      1 - Buy spray synthesiser machine.
      2 - Make it known that you offer a safety service to bank robbers: they come to you once sprayed and you make 100l of the substance for them to spray on the streets for a week.
      3 - Profit.
      4 - ???

    4. Re:But why ? by Anonymous Coward · · Score: 0

      Alarms can be disabled or worked around by a cunning burglar - they wait until you're closing or opening and jump you while you're setting the alarms up, or disable the land lines and jam the cell towers. They don't need to avoid the alarm being raised - just delay it enough to get in and out. Cameras can't see through hoods or balaclavas, and so serve little purpose when it comes to identifying the culprits - they just serve as a record of what occurred.

      Basically, it's only the dumb crooks that get caught out by alarms and cameras - the smarter ones will run recon first so they know what precautions to take.

      Even then, a lot of the time the Police will identify a repeat offender, but if they can't *prove* it was them to the degree the courts require then the crim can get off scot free. Offenders know this and so pass on stolen goods before the Police can get a warrant and catch up with them - it's then just a case of denying it and hoping the police don't learn who they passed it onto.

      The trick to stuff like this mist is that it marks not only the clothes, but any exposed skin as well, which increases the amount of work the offender has to do to avoid being prosecuted (destroy clothes, scrub the ink off their skin - not easy to do the latter). It still requires policing and detection to actually find them, but should serve to increase the rate of successful prosecutions.

      Just as in Network security, if your security is harder to beat than someone else's, you're less likely to be targeted. That is the ultimate purpose of tools like this - to deter someone intent on theft from stealing from _you_.

    5. Re:But why ? by 91degrees · · Score: 1

      Cameras are defeated with masks. Alarms are defeated by getting in and out quickly enough.

      Not sure about how useful this is in actual detection and prosecution but I should think an expert witness could quite justfiably state that it is beyond reasonable doubt that they were in that vicinity at the time the mist was being released. If the police do have a suspect with the dye on them they can be reasonably certain they have the right guy and can start building a case.

      But I agree. The police do have to catch the guy in the first place.

    6. Re:But why ? by twisteddk · · Score: 1

      Indeed they wear hoods. And disguise themselves. But if you dont catch the culprit, then what's the point of this particular peiece of invention ? I concur, when you gather up "the usual suspects", you're likely to get a hit once in a while, but IMO an ounce of prevention is orth a pound of cure. I dont really see this product as something the local macdonalds will want to invest in to protect their friers, or even households to protect their TV.

      In essense (and I may be wrong here), this product only seems to be able to help with positively idetifying people as having been at a location at a specific time. This is all good and well, for identification and evidence. But we still need to solve the crime and catch the criminal first. So this technology might augment current security measures, but personally, I see a lot of limitations in the usability of the product as a countermeasure against theft.

      For home owners, a dog might be cheaper and have a higher preventative effect. If you're not a dog person, marking all of your valuables will perhaps not catch the thief, but have some preventative effect, and let you have your stuff back when the police does their usual cleanups.

      For businesses, again this tech is not standalone, so you still have to invest in alarms, cameras, security doors, sensors and what not.

      Rahter than look at how well this holds up in court, I'm more intrested in seeing how many crimes this will help solve, that would otherwise have been dropped due to lack of evidence, as that seems to be the "target demographic"

      --
      --- To err is human... Am I more human than most ?
    7. Re:But why ? by Mr.+Freeman · · Score: 1

      "The trick to stuff like this mist is that it marks not only the clothes, but any exposed skin as well, which increases the amount of work the offender has to do to avoid being prosecuted (destroy clothes, scrub the ink off their skin - not easy to do the latter). It still requires policing and detection to actually find them, but should serve to increase the rate of successful prosecutions."

      If you can stop an alarm then you can stop this device from spraying you. Somehow this device has to be set off, whether that's linked to a security system, or manually triggered or whatever. If you can stop a guy from arming an alarm system or from hitting a panic button then you can stop him from hitting the "spray the dude with the water" button.

      --
      -1 disagree is not a modifier for a reason. -1 troll, flaimbait, redundant, overrated are NOT acceptable substitutes.
    8. Re:But why ? by Threni · · Score: 1

      Well, you're wrong, aren't you. This stuff has been around years, you see it on security vans next to the words "100% conviction rate". Why have a simple camera? Because they're shit - you ever recognized anyone from a picture from one? Burgler alarm? What's that going to do - make a bit of a noisewhile the burglar is stealing stuff? Why would the thief care about that? When the police eventually manage to capture a thief, they can check his skin/clothes for this stuff and know where he's been stealing from - why else would he have this marker on him?

    9. Re:But why ? by Sulphur · · Score: 1

      1 - Buy spray synthesiser machine.
      2 - Make it known that you offer a safety service to bank robbers: they come to you once sprayed and you make 100l of the substance for them to spray on the streets for a week.
      3 - Profit.
      4 - ???

      5 - Cops find trail ten miles long to lab. They seen interested in sales records.

    10. Re:But why ? by SydShamino · · Score: 1

      Shining an ultraviolet light on someone can be done without a warrant. You can approach every group of teens/thugs in a two mile radius and check them, and then have probable cause for an arrest. Otherwise it's less legal to detain a group of kids walking two block away when there's no proof they were involved at all.

      --
      It doesn't hurt to be nice.
    11. Re:But why ? by anUnhandledException · · Score: 1

      Because Alarms don't follow thieves.

      Defense in depth. I doubt any company is going to remove their CCTV and alarms but this provides yet another layer of defense. This layer also follows the theif & stolen property. Better yet use them in conjuction. Tag property w/ the marker and also have mister which goes off when alarm sounds.

      It is all about defense in depth.

      As DNA technology gets cheaper and more advanced who knows in 20-30 years Police dept might have a device they swab the marker, put it on a slide and in ten minutes it comes back w/ a code which can be used to lookup the owner/purchaser of the liquid.

      This is little more than billions of serial numbers in liquid solution. Why is current property tagged w/ serial numbers and property logs kept? To aid in recovery and assist in criminal conviction. This is just a liquid owner number which happens to be difficult to remove completely. Get 99.9% of it oops there are still millions of owner ID on your tools, clothes, car, etc.

    12. Re:But why ? by anUnhandledException · · Score: 1

      The point is the liquid can be both actively deployed and passively used to mark fluid.

      Also a hybrid system could be used. Imagine a safe which contains liquid between layers of glass on inside of safe. Drilling the safe, cracks layer and releases mist over property in safe and person stealing it.

      Nothing is foolproof it is just another layer in a layered defense.

  8. Of All Places by citoxE · · Score: 1

    Of all places for this to be implemented, it has to be McDonalds. How about implementing this system in places where it actually makes sense, like banks and retail stores? The fact the liquid is visible under UV light seems to be irrelevant because last time I checked, people could easily wash it off or change clothes, and if the evidence is gone, there's an infinite amount of explanations that would satiate a police officer's inquiries.

    1. Re:Of All Places by Anonymous Coward · · Score: 0

      According to the article, the system is installed in other stores besides McDonald's.

    2. Re:Of All Places by JoeInnes · · Score: 1

      In the UK, it is being implemented in banks. There are places where to enter, you have to walk through (or drive through) a fine spray of this. They've started distributing it in areas with a high incidence of burglaries (round me), and the statistics the policeman who came round to instruct us in its use were fascinating (although I haven't verified them). He said that in the area they were first deployed, they were averaging 200 burglaries a week. By the end of the pilot, that was down to 2 a MONTH. Admittedly, this was as part of an anti-burglary drive, and so cause and effect, etc. The policeman also told me that although you could wash off earlier versions with solvents, this needed to be physically sanded off. How much that's just FUD, I don't know, but still...

      The UV light is only intended to indicate that SmartWater is present, it's not supposed to be anything other than a quick, easy-to-check, sign that property has been tagged.

    3. Re:Of All Places by KingOfTheMoon · · Score: 1

      Of all places for this to be implemented, it has to be McDonalds.

      That choice can be explained in one word: Hamburgler.

  9. One Giant Step... by Braintrust · · Score: 1

    ... way too far.

    I don't recall there being a referendum on whether the general public would like to inhale synthetic DNA daily. I might have been sleeping.

    Needs to be said, however trite, but tech like this is far, far beyond anything Orwell imagined.

     

    --
    Years later, a doctor will tell me that I have an I.Q. of 48, and am what some people call "mentally retarded".
    1. Re:One Giant Step... by GameboyRMH · · Score: 1

      Haha yeah if they have a problem with eating genetically modified foods they're REALLY not going to like this...

      --
      "When information is power, privacy is freedom" - Jah-Wren Ryel
  10. Oh sure... by Anonymous Coward · · Score: 0

    But when i go around spraying DNA on random strangers, Even thieves...

    They call me a sex offender and put me on a list...

  11. More corporate protection by Anonymous Coward · · Score: 0

    Meanwhile the average householder just has to submit his insurance claim for stolen property and hope that the thief doesn't return too soon.

  12. What an excellent idea! by mim · · Score: 1

    Our apartment parking lot has seen more than it's share of youth trespass and several vehicles have sustained damage & theft, but the local police say they need "proof" (though we know who they are, apparently, an eye-witness account is not good enough these days) and I thought a similar strategy would work. Lacking funds for a surveillance system, I strategized that filling a super-soaker type water gun with food colouring & spraying the rotten little thugs could be one solution. "Officer, just look for the purple kid that lives down the street."

    1. Re:What an excellent idea! by Mr.+Freeman · · Score: 1

      "apparently, an eye-witness account is not good enough these days"
      Of course it's not good enough. I could say that I saw you steal my car, you certainly wouldn't want to be arrested based on that, would you?

      The question is, why didn't you go ahead with the super soaker idea? Sounds like it would actually work. If nothing else, it would keep them from coming back.

      --
      -1 disagree is not a modifier for a reason. -1 troll, flaimbait, redundant, overrated are NOT acceptable substitutes.
    2. Re:What an excellent idea! by Dr_Barnowl · · Score: 1

      Alas, if he went ahead with this idea, the only thing that would be provable was that he engaged in assault (by squirting the kids) and destruction of property (by ruining their clothes with dye). And the culprits likely know this, and being familiar with the justice system, probably know how to pursue a charge.

      People in the UK have been afraid to defend themselves and their property for years because they perceive that the law is on the side of the criminal in such matters.

    3. Re:What an excellent idea! by Builder · · Score: 1

      People in the UK have been afraid to defend themselves and their property for years because they perceive that the law is on the side of the criminal in such matters

      Perceive? Gimme a break - it flat out is. Persistent offenders keep getting given community sentences and never see jail time. How can you get to 50 separate convictions without spending life in jail?

      And yet more and more people are arrested for assault for defending themselves. Sure, mostly the charges are eventually dropped, but in many cases a simple arrest is enough to destroy your career or life. So why risk it? Let the kids kill the little old lady - as long as I make my train on time :(

    4. Re:What an excellent idea! by SydShamino · · Score: 1

      Eye witness accounts are shit. That's especially true when the suspected criminals are the only youth/elderly/whites/blacks/asians/gays/straights in the area and the police think you might be biased against them.

      --
      It doesn't hurt to be nice.
    5. Re:What an excellent idea! by Myopic · · Score: 1

      Oh, you are talking about the UK.

      If you were talking about America, I would suggest skipping the squirt gun and get a gun with bullets. When someone breaks into your car, shoot them in the head. Done and done -- only one story to tell in court, that the punk was killed during the commission of theft.

      But yeah, people in the UK don't have the legal right to self defense, much less defense of property, so over there it's probably best to go out to your car, thank the robber kindly, and offer him some extra money before he goes on his merry way. Some US states are that way, too, but not the free ones.

    6. Re:What an excellent idea! by mim · · Score: 1

      Hm, hadn't thought about the assault angle, and since they are just kids, 16 & 14, and known repeat offenders at that, I highly doubt that *they* know anything about the justice system. Their deviant & abusive parents might...but since there is clearly a large "No Trespassing," sign on the front of the building and they have been warned before I don't see how I could possibly be held liable in any way for squirting a super-soaker in my backyard or off my balcony onto private property.

  13. A More Rational Use of DNA to Fight Crime by Anonymous Coward · · Score: -1, Troll

    As usual Britain is doing everything backwards. They should be focused on prevention and not just react after the fact. If the Brits really wanted to be tough on crime they would take people's DNA before an offense is committed, and then analyze said DNA to determine if it has any crime genes in it. This way criminals could be arrested before any a burglary, rape, or illegal download of RIAA music. An ounce of prevention is worth a British pound of cure.

    Signed,

    A.C. Troll

    1. Re:A More Rational Use of DNA to Fight Crime by AlecC · · Score: 1

      No, what they should do is get a magic wand, wave it, and magic all those criminal genes out of people. And they all lived happily ever after.

      --
      Consciousness is an illusion caused by an excess of self consciousness.
    2. Re:A More Rational Use of DNA to Fight Crime by RDW · · Score: 1

      'If the Brits really wanted to be tough on crime they would take people's DNA before an offense is committed, and then analyze said DNA to determine if it has any crime genes in it.'

      Recent research has shown that the vast majority of criminals carry a single copy of the SRY gene:

      http://en.wikipedia.org/wiki/SRY

      but less than half of people in the general UK population do! We should round up these 'SRY carriers' before they can do any more damage, and re-direct their anti-social tendencies into alternative activities that may still be obnoxious, but should be relatively harmless:

      http://www.topgear.com/uk/

    3. Re:A More Rational Use of DNA to Fight Crime by Anonymous Coward · · Score: 0

      Recent research has shown that the vast majority of criminals carry a single copy of the SRY gene:

      The joke here is that "crime" is a purely political construct (hence I added the RIAA reference for good measure... I figured the Moderators would be more apt to 'get it', where-as DNA can only really have unique alleles for specific biological traits (not POLITICAL or social traits; like the tendency of some people to download music, loiter, or watch BSDM videos, which is also now a crime in Britain).

      signed,

      A.C. Troll

    4. Re:A More Rational Use of DNA to Fight Crime by Anonymous Coward · · Score: 0

      And the woosh here is that RDW saw your joke and raised: SRY is the bit of the Y chromosome responsible for balls, which in turn are responsible for maleness in general. (See the wikipedia article he linked for the actual caveats...)

      signed,

      AC with intact sense of humor

    5. Re:A More Rational Use of DNA to Fight Crime by geminidomino · · Score: 1

      We should round up these 'SRY carriers' before they can do any more damage, and re-direct their anti-social tendencies into alternative activities that may still be obnoxious, but should be relatively harmless

      We already do. "Televised professional sports".

  14. Beware my tiger repellant rock by pwilli · · Score: 5, Insightful

    "The police acknowledge that they have yet to make an arrest based on the DNA mist, which was developed in Britain by two brothers, one a policeman and the other a chemist. But they credit its presence — and signs posted prominently warning of its use — for what they call a precipitous decline in crime rates (though they could not provide actual figures to back that up).

    I don't see any burglars, so it has to be working.

    1. Re:Beware my tiger repellant rock by sanderb · · Score: 1

      Your tiger repellant rock does not have all the properties this stuff has. There have been several news stories of this in the Netherlands because a shop owner got killed in a burglary (quite rare over here), and apparently none of the stores that have this system (and have this fact advertised) have been robbed since. And since jewelry stores are hit often apparently that figure is statistically relevant.

  15. No criminals nabbed? No robberies! by SunMar · · Score: 1

    The pilot with the spray was already announced in november 2008, and over I believe 60 stores in Rotterdam have been using it for a while now. McDonalds only recently installed it as well. But to supplement the original article, the DNA-spray has not yet caused a criminal to be nabbed, probably because stores that are outfitted with the spray haven't been robbed in the first place since they installed the spray. Though it still has to be seen how effective the spray is at catching robbers, it for now seems to be at least a great deterrent. Source (translated): http://translate.google.nl/translate?js=n&prev=_t&hl=en&ie=UTF-8&layout=2&eotf=1&sl=nl&tl=en&u=http%3A%2F%2Fwww.nu.nl%2Fbinnenland%2F2332929%2Fwinkels-met-dna-douche-niet-meer-overvallen.html&act=url

    1. Re:No criminals nabbed? No robberies! by delinear · · Score: 1

      It's only really a deterrent in as much as putting a lock on your door when everyone else on the street doesn't have locks is a deterrent. It only works while market penetration is small enough that there are easier targets elsewhere. If this DNA water ever becomes popular enough that it's the norm for everyone to use it, criminals will stop looking for alternative targets and will instead focus on ways to beat the system - that's when we'll see if it's actually any good or not.

  16. The jokes are too obvious by vidnet · · Score: 3, Funny

    They're spraying their DNA over customers, and it shows up under a blacklight?

    Oh, come on! This is just too easy.

  17. that is a one-time success by kubitus · · Score: 1
    they will have to change the DNA marker after one use.

    otherwise it will be duplicated and sprayed freely - f.e. on court-staff

    Also checking for duplicate natural DNA showing the same pattern has to be done - no one can exclude this!

    1. Re:that is a one-time success by Shimbo · · Score: 2, Informative

      they will have to change the DNA marker after one use....Also checking for duplicate natural DNA

      Smartwater uses various methods to encode a unique signature. No actual DNA is involved.

  18. Handcuffs? by greenlead · · Score: 1

    Can we assign each officer a tag, and have them spray their cuffs with the marker, to prove in court that a particular person was restrained with a particular pair of handcuffs at a particular time? This would be useful for identifying escaped prisoners, especially in cases where a police officer is murdered. If this spray is inexpensive and discrete, it would also be useful for identifying vehicles and similar objects.

  19. "DNA spray" ? by nstlgc · · Score: 1

    So, "DNA spray" that is visible under ultraviolet light? They jizz on my pants?

    --
    I'm Rocco. I'm the +5 Funny man.
    1. Re:"DNA spray" ? by snspdaarf · · Score: 1

      They jizz on my pants?

      No, only your blue dress.

      --
      Why, without your clothes, you're naked, Miss Dudley!
  20. kimyadersi by Anonymous Coward · · Score: -1

    Thanks Admin kimya dersi

  21. Old news is old by fridaynightsmoke · · Score: 2, Informative

    I first heard of this stuff about 10 years ago, under the name "SmartWater" - http://en.wikipedia.org/wiki/SmartWater

    IIRC it won some kind of 'Millenium Award' in 1999 or 2000

    --
    This is a substitute for a clever sig that fits within the maximum number of characters.
  22. Fantastic by JockTroll · · Score: -1

    It will be used against protesters: spray the crowd, then arrest them one by one afterwards when they're all alone. Then subject them to the same old ritual: beating, beating, beating, interrogation, beating, beating, beating, humiliation, beating, beating, beating, defenestration.

    --
    Geeks are so full of shit that "beating the crap out of them" takes a whole new meaning.
  23. So it's even better? by Moraelin · · Score: 2, Interesting

    So it's even better?

    Just as I was reading that story, I was thinking, "WTF, why McDonald?" I mean in retail the majority of thefts are by employees, not some guy charging in to snatch a plastic cup and run.

    So now you just need to figure how to trip the spray on some lone guy who came for a burger at 2 AM, pocket a thousand and claim he robbed you. Or you can get even more creative if the miracle bottle that the PHB marks everything with is easily accessible by just, say, opening his desk drawer.

    Thanks to idiot juries who, thanks to what now is called the "CSI effect" will blindly convict if there's some high-tech shit they don't understand as evidence -- and just as sadly occasionally won't convict even with six witnesses if you don't also some techno-magic involved to finger the culprit -- you're almost guaranteed to have the scheme work unless you overdo it and become the store that's robbed at 2AM every night.

    --
    A polar bear is a cartesian bear after a coordinate transform.
  24. Perfect security? by MonoSynth · · Score: 1

    And again, here's the typical 'It's perfect because nobody robbed us yet' argument. If only a few percent of the stores are equiped with this 'DNA spray', I'm pretty sure that the criminals will target the other 95+% of the stores with more traditional security measures.

    We'll only know if this works if a significant percentage of the jewelries and retail stores in the neighbourhood are equiped with this. Criminals are creative, but above all they're lazy, just like us developers :P

  25. Not just Rotterdam by nickruiz · · Score: 1

    The spray is also used in several other big cities in the Netherlands, including Amsterdam. I saw several locations near Museumplein that had similar spray warnings when I was there this summer.

  26. Last I heard... by Anonymous Coward · · Score: 0

    DNA doesn't hold up too well against bleach. One trip through the laundry and this thing would be rendered useless. Of course if you got nailed with a full body spray, you'd best throw away anything that doesn't go in the washing machine.

  27. Criminals Exchange DNA as well as goods by Anonymous Coward · · Score: 1, Interesting

    Nearly every dollar bill contains traces of cocaine. You have them in your wallet. Does that make you both a dealer and a criminal and associating with criminals?

    Criminal 'does' a bank. Criminal is nabbed, but claims because he works or spends way too much time at Mc D's, or the local gym, community basketball court - and some must have rubbed off, or off a local hooker, where the real criminal may have passed on something, plus some dna marker.

    All it proves is a circumstantial contact - bring in a few local bank tellers or McD workers - and they will have the same tagging.

    Some criminals wear hoodies. Same crim runs out and gets away (rare) then rubs hoods with mates at local skateboard park. Who did it?

    I think this proves keeping CCV cameras well maintained and working - is cheaper and better

    1. Re:Criminals Exchange DNA as well as goods by digitig · · Score: 1

      I think this proves keeping CCV cameras well maintained and working - is cheaper and better

      Except the popularity of hoodies is partly down to the fact that they obscure the face from CCTV cameras (and partly down to them being comfortable and convenient, of course).

      --
      Quidnam Latine loqui modo coepi?
    2. Re:Criminals Exchange DNA as well as goods by Anonymous Coward · · Score: 0

      no it';s not.

      Hoodies are popular with the hoodie crowd because most of that crowd has serious self confidince and self respect problems.

      They want to hide from the world.

      All you have to do is look at any highschool or college. The kids that are confident dont wear hoodies up all the time. the afraid of their own shadow ones do.

    3. Re:Criminals Exchange DNA as well as goods by Theoboley · · Score: 1

      Or the fact that they might be cold...? I used to wear one all the time back in high school due to that fact. Also because it was convenient to carry my calculator and CD player in the big pocket through the front.

      --
      Stupidity only gets you so far, then you've gotta try
    4. Re:Criminals Exchange DNA as well as goods by Anonymous Coward · · Score: 0

      They're also kinda warm and give more protection from a sudden spell of rain than the average sweater. But then I'm not a highschooler.

    5. Re:Criminals Exchange DNA as well as goods by digitig · · Score: 1

      I think that's covered by my "comfortable and convenient", don't you? I'm in my 50s, don't need to hide from CCTVs, and I sometimes wear a hoodie.

      --
      Quidnam Latine loqui modo coepi?
    6. Re:Criminals Exchange DNA as well as goods by Theoboley · · Score: 1

      Most definitely covered. i mostly wore my hood up to cover the fact that i was listening to my CD player during class, rather than "having serious self confidence problems or self respect problems" as our AC Friend mentioned.
       

      --
      Stupidity only gets you so far, then you've gotta try
  28. get away from my sweat you false positive zealot by Anonymous Coward · · Score: 0

    you have the right to remain silent. we (US) seem to be the world champs at that too. we see the queen decommissioning a couple of harriers, etc,,,,,. fuel bills (for the palace) come first? leave the crusading to the annexed colonies for a while?

    the corepirate nazi freemason holycost (life, liberty etc...) is increasing by the minute. you call this 'weather'?

    continue to add immeasurable amounts of MISinformation, rhetoric & fluff, & there you have IT? that's US? thou shalt not... oh forget it. fake weather (censored?), fake money, fake god(s), what's next? fake ?aliens? ahhaha. seeing as we (have been told that) came from monkeys, the only possible clue we would have to anything being out of order, we would get from the weather. that, & all the other monkeys tipping over/exploding around US.

    the search continues; on any search engine

    weather+manipulation

    bush+cheney+wolfowitz+rumsfeld+wmd+oil+freemason+blair+obama+weather+authors

    meanwhile (as it may take a while longer to finish wrecking this place); the corepirate nazi illuminati (remember, (we have been told) we came from monkeys, & 'they' believe they DIDN'T), continues to demand that we learn to live on less/nothing while they continue to consume/waste/destroy immeasurable amounts of stuff/life, & feast on nubile virgins while worshipping themselves (& evile in general (baal to be exact)). they're always hunting that patch of red on almost everyones' neck. if they cannot find yours (greed, fear ego etc...) then you can go starve. that's their (slippery/slimy) 'platform' now. see also: http://en.wikipedia.org/wiki/Antisocial_personality_disorder

    never a better time to consult with/trust in our creators. the lights are coming up rapidly all over now. see you there?

    greed, fear & ego (in any order) are unprecedented evile's primary weapons. those, along with deception & coercion, helps most of us remain (unwittingly?) dependent on its' life0cidal hired goons' agenda. most of our dwindling resources are being squandered on the 'wars', & continuation of the billionerrors stock markup FraUD/pyramid schemes. nobody ever mentions the real long term costs of those debacles in both life & any notion of prosperity for us, or our children. not to mention the abuse of the consciences of those of us who still have one, & the terminal damage to our atmosphere/planet (see also: manufactured 'weather', hot etc...). see you on the other side of it? the lights are coming up all over now. the fairytail is winding down now. let your conscience be your guide. you can be more helpful than you might have imagined. we now have some choices. meanwhile; don't forget to get a little more oxygen on your brain, & look up in the sky from time to time, starting early in the day. there's lots going on up there.

    "The current rate of extinction is around 10 to 100 times the usual background level, and has been elevated above the background level since the Pleistocene. The current extinction rate is more rapid than in any other extinction event in earth history, and 50% of species could be extinct by the end of this century. While the role of humans is unclear in the longer-term extinction pattern, it is clear that factors such as deforestation, habitat destruction, hunting, the introduction of non-native species, pollution and climate change have reduced biodiversity profoundly.' (wiki)

    "I think the bottom line is, what kind of a world do you want to leave for your children," Andrew Smith, a professor in the Arizona State University School of Life Sciences, said in a telephone interview. "How impoverished we would be if we lost 25 percent of the world's mammals," said Smith, one of more than 100 co-authors of the report. "Within our lifetime hundreds of species could be lost as a result of our own actions, a frightening sign of what is happening to the ecosystems where they live," added Julia Marton-Lefevre, IUCN director general. "We must now set clear targets for the future to reverse

  29. pfirst.. by Anonymous Coward · · Score: -1, Flamebait

    partner. And 1f

  30. http://www.jerseys-2010.com by amanda5211 · · Score: -1

    [url=http://www.jerseys-2010.com/wholesale nfl jerseys[/url] [url=http://www.jerseys-2010.com/cheap nhl jerseys[/url] [url=http://www.jerseys-2010.com/football jerseys[/url] [url=http://www.jerseys-2010.com/nba shop[/url] wholesale nfl jerseys, cheap nhl jerseys, football jerseys, nba shop, wholesale nfl jerseys cheap nhl jerseys football jerseys nba shop [url=http://www.hatonsale.com/winter cap[/url] [url=http://www.hatonsale.com/red bull cap[/url] [url=http://www.hatonsale.com/monster hat[/url] [url=http://www.hatonsale.com/new era hats[/url] winter cap, red bull cap, monster hat, new era hats, winter cap red bull cap monster hat new era hats Monster Energy Hats Dc Shoes Ken Block 43 Ford Monster Dc Shoes Ken Block 43 Ford Monster NBA Detroit Pistons Reebok NFL Jerseys Philadelphia Eagles Kids Kansas City Royals PHILLES http://www.jerseys-2010.com/ http://www.hatonsale.com/

  31. Hamburgler's beware by Anonymous Coward · · Score: 0

    although I still dont think it will stop him

  32. In use since 2005!!! by Anonymous Coward · · Score: 0

    I'm sure I read an article in the last few days saying it had been successful in catching some thieves, which is a good job since it's been in use since 2005: http://news.bbc.co.uk/1/hi/england/london/4458717.stm

  33. Not just for law enforcement by Anonymous Coward · · Score: 0

    How long before this shit gets into the hands of marketers? Imagine RFID chips that tag everything they touch, and can't be easily removed. Just need to invent some kind of passive DNA sniffer and it would be like tracking cookies for meatspace. Bloody marvellous.

    Oh, and how long before someone tells us this shit causes cancer or something? Not before everything we eat, wear and handle is drenched in it, I can assure you of that.

    Yeah, the future's so fucking bright I'll have to live in an airtight concrete bunker.

  34. Hamburglar by GodWasAnAlien · · Score: 2, Funny

    This is an elaborate scheme to finally stop the Hamburglar, the masked hamburger stealer, who the company strangely uses as a commercial icon.

    1. Re:Hamburglar by SydShamino · · Score: 1

      It's no different than the Lucky Charms leprechaun or the Trix rabbit.

      --
      It doesn't hurt to be nice.
  35. Simpler solution by Anonymous Coward · · Score: 0

    How about simple compressed air?

    I know for a fact that if you get stuck in a room where a high pressure fire suppression system discharges, you will get burst eardrums and a bloody nose. That blood will link you to that place rather efficiently. No need for fancy custom DNA-laced water and what have you.

    In other words: Just install such a system and you'll get free DNA evidence. If you put old-fashioned Halon in the system, the theif won't run away...

    1. Re:Simpler solution by GameboyRMH · · Score: 1

      That could work for a bank vault but not a bank lobby or a McDonalds...

      --
      "When information is power, privacy is freedom" - Jah-Wren Ryel
  36. Can we put this spray on corporate lobbyists? by digitaldc · · Score: 3, Funny

    If we can spray this on corporate lobbyists, we can finally identify who is stealing money from our citizen taxpayers.

    --
    He who knows best knows how little he knows. - Thomas Jefferson
    1. Re:Can we put this spray on corporate lobbyists? by Anonymous Coward · · Score: 0

      All of them.

      And I didn't even need to use water!

  37. 100% conviction rate? by Anonymous Coward · · Score: 0

    In the UK they claim a 100% conviction rate. Hard to have that if it has never been tested in court.

  38. ! DNA by arth1 · · Score: 2, Informative

    As far as I can tell, it's not only not new, but it also has nothing to do with DNA. The marker is either a unique proportion of certain non-evaporating particles, or small engraved chips with a number on them.
    DNA has nothing to do with this, even in an abstract sense -- it is not self-replicating, and certainly not biological.

  39. Ah the nostalgia by Anonymous Coward · · Score: 0

    "Tag you're it!"

  40. Silly Slashdot crowd even goes for the buzzwords by bluefoxlucid · · Score: 5, Informative

    This shit doesn't contain "DNA," it contains a chemical sequence that's sufficiently unique. They say "DNA" because DNA is so variant no two people who aren't clones (such as twins) have the same DNA. But it catches idiots with buzzwords.

  41. Who's DNA are they using? by Migraineman · · Score: 1

    Who's DNA are they using?

    Prawo Jazdy's?

    1. Re:Who's DNA are they using? by Anonymous Coward · · Score: 0

      Yours. Jerk off less often.

  42. Really? by Moraelin · · Score: 1

    This is not the same DNA as you are made of. It doesn't behave the same way.

    Really? What other kinds of DNA are there? And shouldn't that raise more questions that for normal DNA we already know the answers, but which a new technology would have still unclear?

    This is not evidence all on its own, it's used to further investigation.

    That's exactly what some of us hope, but I'd say it's not a given. Really, look just in this thread how many people take it for some kind of magical marker that can't possibly be wrong.

    And I don't just mean taking for granted that it's unique, but also such issues as that nobody else will use their bottle for some malicious mischief, or that you won't end up with a nightmare when millions of marked PCs get sold without removing the markers, etc. It's assumptions which aren't even scientific or technical, but plain old suspending skepticism completely.

    Will the same apply when the first jury has to judge such a case? That's the big question.

    --
    A polar bear is a cartesian bear after a coordinate transform.
  43. How about... by TrisexualPuppy · · Score: 1

    A mask for the CCTVs...
    ...and a raincoat for the DNA spray?

    --TSP

  44. That's actually standard procedure by Moraelin · · Score: 1

    That you get to listen to expert witnesses is AFAIK standard procedure in all of the western world. It still didn't prevent jury nullification because the jury thought the prosecutor must be full of it if they don't have some techno-magic CSI-style analysis to go with all the witnesses, or conversely convicted based on misunderstanding how reliable some piece of techno-babble really is. I doubt that the UK or any other country is immune to that, and judging by your examples, you're basically saying the same thing.

    --
    A polar bear is a cartesian bear after a coordinate transform.
  45. Patent SmartClean by glittermage · · Score: 1

    Patent using a bleach misting device to remove any trace.

  46. Already several sprayed criminals arrested by Anonymous Coward · · Score: 0

    Several criminals have already been arrested and identified using this spray. For example, see:

    http://www.dutchdailynews.com/dutch-car-thief-caught-by-dna-spray/

    Another incident contains the arrest of a super market robber, who lighted up nice and bright under the UV light.

  47. Cancer? by Half-pint+HAL · · Score: 1

    Somebody will be suing claiming it causes cancer. Or bronchitis at the very least.

    We've been waiting for the first major nanotech lawsuit for a while, and this may be it.

    HAL.

    --
    Got them moderator blues I blieve I walk out the do', With these mod-points I been gettin', I 'most never post no mo'
  48. marking your posessions by Thud457 · · Score: 2, Funny

    I usually just pee on everything I own.
    I mean, why pay some company for synthetic markers, when you already have your own custom-tailored ones for free?

    --

    the preceding comment is my own and in no way reflects the opinion of the Joint Chiefs of Staff

  49. People ARE SmartWATER!? by WebHikerOriginal · · Score: 1

    Why bother buying that expensive solution to tag your goods? Simply bleed on them (or use other imaginative sources of bodily provided DNA sources likely spread around a focused spot in your mothers basement). It will also be harder for crooks to "steal your bottle of SmartWater"

  50. Bruce Scheier got here first, but: by fsck! · · Score: 1

    What's stopping me from getting my own DNA water, and spraying it all over your stuff that I want to steal?

  51. McDonald's? by Bobfrankly1 · · Score: 1

    Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence: "You Steal, You're Marked."

    But, nothing tastes quite as good as the McRib you make yourself for free!

  52. Great - Macdonalds pissing on its customers by Eunuchswear · · Score: 1

    "fine mist with trace of DNA" my arse.

    --
    Watch this Heartland Institute video
  53. They used it in college by Anonymous Coward · · Score: 0

    In my freshman year dorm they used this trick to catch the kids who were pulling the fire alarm. It was very simple: brush some UV-sensitive powder on the alarm, then wait for someone to pull it. Campus security would go to the hallway, turn off the lights, and then shine a blacklight on every doorknob. When they saw a glow they'd knock on the offender's door and usually get a confession.

  54. Re:Silly Slashdot crowd even goes for the buzzword by gknoy · · Score: 1

    Just wait for someone to get a black market supply of various ones of these and just go around spraying crowds of people... or figure out how to make the sprayers malfunction and spray random people.

  55. Spray it on the burgers by bugs2squash · · Score: 1

    Scientists get to test new gene delivery techniques on willing subjects, the local sewer company can make millions through market research and street lighting costs will be reduced when all McDonalds customers glow brightly, not to mention the reduction in traffic accident fatalities when pedestrians are more visible after dark.

    --
    Nullius in verba
  56. This gave me an idea... by mutube · · Score: 1

    Evil masterplan (sorry, no ????)

    1. Set up business selling things (ebay, whatever)
    2. Tag everything you sell
    3. Presumably a percentage of this stuff will be stolen
    4. It finds its way back to you
    5. Sell it on ebay

    Who said crime doesn't pay?

  57. Doesn't make sense... by Anonymous Coward · · Score: 0

    This thing will tag the thieves... but also anyone else present. How are you going to investigate everyone? Makes no sense.

  58. Excellent! by ThatsNotPudding · · Score: 1

    Now the cops won't have to synthesize DNA for framing anymore; just get a matching sample of this stuff from the former cop co-inventor and boom! Case Closed!
    I beginning to realize, this is not the greatest time to be alive anymore and the future is looking effing grim as well.

  59. Anonymous Coward by Anonymous Coward · · Score: -1, Offtopic

    What about putting something like this in food or drink and giving it to the Taliban leaders that are currently negotiating with Afgan and NATO authorities? If the talks don't pan out, you wait until they return to their bases and then bomb the crap out of any place where their UV glowing urine can be detected by a drone?

  60. Step 1: by Geminii · · Score: 1

    Steal a company's Smartwater and transparently replace it with something which looks the same, at least cosmetically.

    Step 2: Steal something valuable from the company and use the Smartwater to frame whoever else you want. Or just spread it around a lot so that a whole bunch of high-profile people are found to have it on them.

    Step 3: Get away with it, maybe?