Slashdot Mirror
UK-Developed 'DNA Spray' Marks Dutch Thieves With Trackable Water
eldavojohn writes "In Rotterdam, there's a new technology in place that dispenses a barely visible mist over those around it and alerts the police. The purpose? To tag robbers and link them back to the scene of the crime. From the article, 'The mist — visible only under ultraviolet light — carries DNA markers particular to the location, enabling the police to match the burglar with the place burgled. Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence: "You Steal, You're Marked."' Developed in Britain, it's yet to nab a criminal but it will be interesting to see whether or not synthesized DNA will hold up as sufficient evidence in an actual court of law." So it's not just for copper thieves.
"visible only under ultraviolet light"
Then it can't be used in the night clubs as those "black lights" will make-it VERY visible.
1% APY, No fees, Online Bank https://captl1.co/2uIErYq Don't let your $$$ sit in a no-interest acct.
Well, that's the first thing they'll serve with actual DNA in it, then.
"We can confirm that Debian does *not* ship the version with the trojan horse. Our version predates it." [CA-2002-28]
I understand new tech is nice and all.... But what's wrong with a simple camera ? Or a burglar alarm ? Why bother with these high flying ideas ? I understand that insurance is practically non existant for comanies, but how high costs do you really need to incur to "secure" yourself ?
You can't even trace the burglar as I understand it, you have to actually find him, and then test people for the presense of the mist. I dont see this a commercially viable product, even if it pans out as permissable in a court of law.
--- To err is human... Am I more human than most ?
Of all places for this to be implemented, it has to be McDonalds. How about implementing this system in places where it actually makes sense, like banks and retail stores? The fact the liquid is visible under UV light seems to be irrelevant because last time I checked, people could easily wash it off or change clothes, and if the evidence is gone, there's an infinite amount of explanations that would satiate a police officer's inquiries.
I don't recall there being a referendum on whether the general public would like to inhale synthetic DNA daily. I might have been sleeping.
Needs to be said, however trite, but tech like this is far, far beyond anything Orwell imagined.
Years later, a doctor will tell me that I have an I.Q. of 48, and am what some people call "mentally retarded".
Seriously? I'm no scientist, but it seems like a good scrubbing and you'd make a clean getaway. Har har...
Good joke; but since you are no scientist, perhaps you wouldn't know that they even think about these trivial, blindingly obvious things and test for them.
Nope, mate, what you see here is a bloody clever thing, and not something you can easily find a way out of. DNA sequences can be purpose built nowadays, and soon it will be cheap enough for everybody to buy. The number of variations are practically unlimited, so you could more or less mark every brick in London with their own, individual marker, and you can't just wash it off and be sure not to carry it around with you; plus of course they don't put a big sticker on the outside of marked objects to warn you. If you want to avoid carrying this stuff around with you, you will have to put on a full environment suit, and since you never know where you can come across this stuff, you will have to do it every time you do something you don't want to be nicked for. The problem with environment suits is, they tend to stand out, of course.
I read somewhere that it doesn't come of by simply washing with water and soap. I know, I know, [citation needed] etc, but I don't have a source right now.
Our apartment parking lot has seen more than it's share of youth trespass and several vehicles have sustained damage & theft, but the local police say they need "proof" (though we know who they are, apparently, an eye-witness account is not good enough these days) and I thought a similar strategy would work. Lacking funds for a surveillance system, I strategized that filling a super-soaker type water gun with food colouring & spraying the rotten little thugs could be one solution. "Officer, just look for the purple kid that lives down the street."
"The police acknowledge that they have yet to make an arrest based on the DNA mist, which was developed in Britain by two brothers, one a policeman and the other a chemist. But they credit its presence — and signs posted prominently warning of its use — for what they call a precipitous decline in crime rates (though they could not provide actual figures to back that up).
I don't see any burglars, so it has to be working.
The pilot with the spray was already announced in november 2008, and over I believe 60 stores in Rotterdam have been using it for a while now. McDonalds only recently installed it as well. But to supplement the original article, the DNA-spray has not yet caused a criminal to be nabbed, probably because stores that are outfitted with the spray haven't been robbed in the first place since they installed the spray. Though it still has to be seen how effective the spray is at catching robbers, it for now seems to be at least a great deterrent. Source (translated): http://translate.google.nl/translate?js=n&prev=_t&hl=en&ie=UTF-8&layout=2&eotf=1&sl=nl&tl=en&u=http%3A%2F%2Fwww.nu.nl%2Fbinnenland%2F2332929%2Fwinkels-met-dna-douche-niet-meer-overvallen.html&act=url
They're spraying their DNA over customers, and it shows up under a blacklight?
Oh, come on! This is just too easy.
otherwise it will be duplicated and sprayed freely - f.e. on court-staff
Also checking for duplicate natural DNA showing the same pattern has to be done - no one can exclude this!
Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag, the tools, the stolen property. So you'd need to do a job and then ditch everything you have in a forensically secure way. I've used a similar competing product called SmartWater.
The beauty of things like SmartWater is that its a suspension of fine molecules that can be *uniquely* identified to a particular user (i.e. you get a coded bottle with a unique number and a unique solution). The UV is just there to light up when people go through police stations but the chemical itself is, supposedly, uniquely identifiable.
Answering "How did you come to have UV marker solution on your clothes?" is easy. You were security marking your own equipment, you work with the stuff all the time, it must have been on something you picked up, maybe someone was playing a prank. Answering "How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X, when there was a burglary at Company X last night, when you claim to have been at home and never near Company X?" is a bit more tricky, especially if it's a fine mist that soaks into anything and everything it touches.
I've used the SmartWater stuff, which is very similar to this, and it's a wonderful deterrent. They claim to have a 100% conviction rate when property / people are found by police with SmartWater on them and given that they are often used in bank security vans, that's quite impressive. I don't know if that was true, or still is, but it's plausible. Basically if the police find the tiniest forensic trace of that stuff on property / people they question, they can take a sample, send it to the company, who will tell them who bought that EXACT pot of tracer ink. I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years.
This stuff isn't just a UV-tracer. It puts you, forensically, at the exact scene of a particular crime. And given that I know of no lawsuits with any of these stuff being in question, they must have a pretty cast-iron chemical description that can satisfy a court of law or, at least, people who are caught with it on their clothes that it wouldn't be worth challenging.
It's also very good for equipment recovery. It basically guarantees identificiation / return of stolen property if it comes into police hands. Before, even if your stuff was security marked, it wasn't guaranteed that you would get it back (the first thing is that people try to file off the security marks - I've had police tell me of cases where they had to return goods with obviously filed-off security marks because they couldn't prove it WASN'T the suspected thieves and couldn't trace the actual owner), but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner.
Can we assign each officer a tag, and have them spray their cuffs with the marker, to prove in court that a particular person was restrained with a particular pair of handcuffs at a particular time? This would be useful for identifying escaped prisoners, especially in cases where a police officer is murdered. If this spray is inexpensive and discrete, it would also be useful for identifying vehicles and similar objects.
So, "DNA spray" that is visible under ultraviolet light? They jizz on my pants?
I'm Rocco. I'm the +5 Funny man.
So, soon not only the robbed people will be able to buy one of those markers - other people will be able to do it too.
This probably means, even if this now has some chance of being accepted in court, it will (I hope) be droped when they find anyone can be framed by the real burglar, if she gets the chance to build the same sequence with the same environmental markers.
A good question is, perhaps, whether it will be easy or hard to do so.
No, what they should do is get a magic wand, wave it, and magic all those criminal genes out of people. And they all lived happily ever after.
Consciousness is an illusion caused by an excess of self consciousness.
Answering "How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X, when there was a burglary at Company X last night, when you claim to have been at home and never near Company X?" is a bit more tricky
A: Yesterday, a guy in the street sprayed me with a substance I didn't identify. I tried to chase down the guy to ask for an explanation but he ran faster than me.
I'd say, buy your own spray system and get a nice dose of the stuff on your clothes to mask company X's tag before you start scrubbing.
I first heard of this stuff about 10 years ago, under the name "SmartWater" - http://en.wikipedia.org/wiki/SmartWater
IIRC it won some kind of 'Millenium Award' in 1999 or 2000
This is a substitute for a clever sig that fits within the maximum number of characters.
So it's even better?
Just as I was reading that story, I was thinking, "WTF, why McDonald?" I mean in retail the majority of thefts are by employees, not some guy charging in to snatch a plastic cup and run.
So now you just need to figure how to trip the spray on some lone guy who came for a burger at 2 AM, pocket a thousand and claim he robbed you. Or you can get even more creative if the miracle bottle that the PHB marks everything with is easily accessible by just, say, opening his desk drawer.
Thanks to idiot juries who, thanks to what now is called the "CSI effect" will blindly convict if there's some high-tech shit they don't understand as evidence -- and just as sadly occasionally won't convict even with six witnesses if you don't also some techno-magic involved to finger the culprit -- you're almost guaranteed to have the scheme work unless you overdo it and become the store that's robbed at 2AM every night.
A polar bear is a cartesian bear after a coordinate transform.
And again, here's the typical 'It's perfect because nobody robbed us yet' argument. If only a few percent of the stores are equiped with this 'DNA spray', I'm pretty sure that the criminals will target the other 95+% of the stores with more traditional security measures.
We'll only know if this works if a significant percentage of the jewelries and retail stores in the neighbourhood are equiped with this. Criminals are creative, but above all they're lazy, just like us developers :P
It does. To an extent. Not enough though.
The PCR techniques used to amplify it for detection purposes are so sensitive that enough remains can be picked up by crimelab.
The only way to reliably "clean" clothing that has come into contact with this is to dip it in DNAases (enzymes that specifically hydrolise DNA). These are actually quite easy to come by in Holland. Holland is one of the world capitals of developing "pumped up" chicken meat. That used to be "pumped up" with crude pork and beef proteins extracts, however labs started picking up pork or beef based on DNA (very similar to this detection method). So now the extracts are treated with DNAase so that the tests do not work. As a result DNAase is actually not that difficult to come by. Just talk to your "halal" (quotes intended as it is stuffed with pork to the hilt) cheap chicken supplier.
Not that it would matter anyway as this is mostly against petty criminals.
Baker's Law: Misery no longer loves company. Nowadays it insists on it
http://www.sigsegv.cx/
The spray is also used in several other big cities in the Netherlands, including Amsterdam. I saw several locations near Museumplein that had similar spray warnings when I was there this summer.
Nearly every dollar bill contains traces of cocaine. You have them in your wallet. Does that make you both a dealer and a criminal and associating with criminals?
Criminal 'does' a bank. Criminal is nabbed, but claims because he works or spends way too much time at Mc D's, or the local gym, community basketball court - and some must have rubbed off, or off a local hooker, where the real criminal may have passed on something, plus some dna marker.
All it proves is a circumstantial contact - bring in a few local bank tellers or McD workers - and they will have the same tagging.
Some criminals wear hoodies. Same crim runs out and gets away (rare) then rubs hoods with mates at local skateboard park. Who did it?
I think this proves keeping CCV cameras well maintained and working - is cheaper and better
Thieves are not generally known for their intelligence. Even if they were aware of the magic dye, they would have to arm themselves with a black light and literally scrub everything - themselves, their clothes, their shoes, their car, the trail of drips / prints, and anything they touched for the police to be no better off than if the dye system had not deployed. I bet you could be at it for hours and still leave traces. Even if you think you've washed the dye off, there might stuff left that can be swabbed and detected in a lab.
Actually I'd expect it to be even worse, thanks to the CSI effect. Basically the same blind belief that if it's some hi-tech shit, then it's more infallible than the Pope and those scientists 100% thought of and prevented every possible problem or false positive, that you can see in the GP post.
Someone _will_ get sent to jail by some idiot jury because the real burglar -- who, for example, is an employee and didn't even need to synthetise anything: he just nicked the bottle that the PHB cleverly hid in his desk drawer -- sprayed them with it.
That's actually the important part: often when it looks like there's some impossible hurdle like synthetising DNA, there are often _much_ simpler ways to plant it, _and_ you can rely on some idiots still thinking that only the really complicated way exists. E.g., people have already planted DNA at a crime scene by just taking a cigarette butt from a bus station and dropping it there. Here you don't even have to do that.
Or as an even more trivial example, if a co-worker you really don't like leaves his coat behind and his wallet in it, spray the coat and banknotes in the wallet, steal the same amount from the cash register, tip someone off that you saw them stealing again. Double profit. You got the money, and got rid of that guy or gal you don't like.
Yeah, they'll end up having to convince a jury that those scientists and their hi-tech solution are fallible after all. Good luck with that in a world being told the opposite by PR. And where they saw on TV every week that you can take a hair you found on a carpet and know exactly that it belongs to the killer (and not, say, to one of the guests the victim had two days before that, or some guy in the bus leaving hair on her coat) and run a DNA analysis to tell you exactly what the killer looks like. Or that you can take a two by two pixel image of the back of someone's head from a security camera, enhance it to a clear 1600x1200 image and, with a couple more mouse clicks, turn it around to see the culprit's face.
Seriously, we're already at the point where some juries acquit because you didn't do that, or conversely people who spent time on the death row because some pseudo-science mumbo-jumbo must be 100% correct and accurate like on CSI.
A polar bear is a cartesian bear after a coordinate transform.
And as long as you didn't fit the CCTV footage, have a record for that type of crime, find it hard to show evidence of the spraying, had a remotely plausible alibi, leave any DNA or fingerprint evidence at the site etc I'm sure you might have a chance with that defence.
I'm very sceptical about DNA evidence being used to convict. I'm a lot less sceptical about evidence like this being used to build a compelling case alongside other evidence, or to narrow enquiries. You can, never, ever, 100% prove someone committed a crime even if they admit it, did it in public and on CCTV. You can however be confident the odds of a false conviction are vanishingly small, requiring any more that isn't plausible.
Whew! And here I was afraid the spray was just cat pee.
Nothing gets that stuff off.
The ______ Agenda
Just use bleach. It will do the job faster, more reliant and cheaper.
'If the Brits really wanted to be tough on crime they would take people's DNA before an offense is committed, and then analyze said DNA to determine if it has any crime genes in it.'
Recent research has shown that the vast majority of criminals carry a single copy of the SRY gene:
http://en.wikipedia.org/wiki/SRY
but less than half of people in the general UK population do! We should round up these 'SRY carriers' before they can do any more damage, and re-direct their anti-social tendencies into alternative activities that may still be obnoxious, but should be relatively harmless:
http://www.topgear.com/uk/
Why not just buy some of this spray, covertly spray some around a jewellery shop and then report them to the police for handling your stolen property?
Most thieves either get caught at the scene or they get away and the police eventually track them down much later. After multiple showers and scrubbing I doubt that there would be enough of this stuff left to get a positive DNA match. Don't forget that the police have lied about the accuracy and reliability of DNA. The Omagh bombing trial collapsed because the DNA "amplification" technique was shown to be unreliable and because it threw up two matches from the database anyway which implies that the odds of a match are much lower than the 1 in 100,000,000 they were claiming.
You could probably just buy some of this stuff and then apply it to yourself. There would be little chance of getting a reliable clean sample.
Sounds like snakeoil to me.
const int one = 65536; (Silvermoon, Texture.cs)
SJW, n: "Someone I don't like, and by the way I'm a fuckwit" - AC
" ... plus of course they don't put a big sticker on the outside of marked objects to warn you ... ".
Err, yes the do. RTFA and see the big orange sign.
Also, DNA can degrade fairly quickly if it is not part of a living cell and there are many chemicals that can break DNA down.
America, Home of the Brave.
My chief concern is, if this is deployed as a "mist", how easy is it for others to get wrongly tagged. Can it get into aircon units and spread around the building? Can it escape the building and tag people in the street? Depending how blunt an instrument this is, it might not be enough to show a few drops, we might expect that only people who are literally drenched in the stuff are likely to be found guilty (and even then, who's to say the real criminal didn't lift a bottle of the stuff and toss it over the most likely suspect). If this is used purely for detection, fair enough; if it's used for conviction I'd be pretty worried.
And as long as you didn't fit the CCTV footage, have a record for that type of crime, find it hard to show evidence of the spraying, had a remotely plausible alibi, leave any DNA or fingerprint evidence at the site etc I'm sure you might have a chance with that defence.
You mean criminals have a hard time finding a single friend who owns any kind of spraying bottle and a hooded sweatshirt?
plus of course they don't put a big sticker on the outside of marked objects to warn you.
From the summary: "Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence".
Quidnam Latine loqui modo coepi?
""How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X"
Are you sure it was only issued to company X? Show my evidence that no other bottle could possibly contain the same solution. See, with humans this process occurs naturally, everyone has different DNA (with extremely high probability) because of how biology works. Once you start making your own, you've shown that it's possible to duplicate DNA, thus the solution is NOT necessarily unique.
"I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years."
So, you have now just told us that you have the ability to put the SAME SOLUTION on multiple DIFFERENT ENTITIES MULTIPLE TIMES PER YER for years on end. Thus, anyone could, with only a tiny amount of this stuff, frame any number of different people with extreme ease.
"but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner."
No, it will link it to whoever managed to get their hands on one of these bottles and spray it on whatever the fuck they felt like. I could go mark every computer at my local university with this stuff and then claim that the entire computer lab belonged to me because only I have this bottle of magic property-identifying liquid.
-1 disagree is not a modifier for a reason. -1 troll, flaimbait, redundant, overrated are NOT acceptable substitutes.
Thieves that get caught are not generally known for their intelligence.
Fixed that for ya.
Quidnam Latine loqui modo coepi?
Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag,
Well, any store that wants me to come home with their mist can go fuck themselves. Hopefully they'll make it mandatory to warn about that crap being in the air at least.
This is an elaborate scheme to finally stop the Hamburglar, the masked hamburger stealer, who the company strangely uses as a commercial icon.
Just talk to your "halal" (quotes intended as it is stuffed with pork to the hilt) cheap chicken supplier.
You seriously think they use denatured beef and pork protein in halal chicken? If that's true it would upset the Jews, Muslims, and Hindu's something crazy.
Do you have any evidence chicken producers do that? A URL or anything?
A: Yesterday, a guy in the street sprayed me with a substance I didn't identify. I tried to chase down the guy to ask for an explanation but he ran faster than me.
Maybe that's what the crooks were doing at the track. They were qualifying runners.
If we can spray this on corporate lobbyists, we can finally identify who is stealing money from our citizen taxpayers.
He who knows best knows how little he knows. - Thomas Jefferson
...and more harmful to the colors!
No sig today...
Maybe we're overestimating the intelligence of people who'll walk past a big orange sign in broad daylight and rob a McDonalds.
No sig today...
Why would it mask it? You'd just have two different markers on you, that's all.
No sig today...
It's interesting how technology developed from personalized crafts where each creation was unique to the mass manufacture with identical copies of the same product (often fully automated, which insures that those copies are indistinguishable) to the artificially personalized copies of the product - unique id tags, serial numbers were superficial and mostly easily removable from the product, but those two recent developments indicate that manufacturers and owners will go at length to make sure that the added uniqueness stay thoroughly embedded to and unalienable from any given copy of the product.
I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
Who do you think would be busting into a run down McDonalds? Raffles the Gentleman Thief?
It's probably a gang of scumbags from the nearest housing estate. Chances are the cops would suspect who did it and presence of the dye on any of them would easily confirm it.
The shop will have their receipts in good order, will you have yours?
No sig today...
Similar technology is used by dogs to mark they trees they own in the park.
I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
We should round up these 'SRY carriers' before they can do any more damage, and re-direct their anti-social tendencies into alternative activities that may still be obnoxious, but should be relatively harmless
We already do. "Televised professional sports".
That's a pretty massive 'if'.
I think you overestimate the sort of person who robs McDonalds, if they had a second brain cell to keep the first one company they wouldn't be doing it.
Masterminding some sort of DNA-resequencing plan? Not so much.
No sig today...
Clean?
I believe I would fill the DNA tank from my bladder.
It really makes good ironic sense. Piss on 'em.
*Repent!Quit Your Job!Slack Off!The World Ends Tomorrow and You May Die!
*crickets chirping*
No, they have a hard time filling the spray bottle with a substance that is only issued to a single, specific company.
pH-adjusted bleach should do it. For example, chlorox and vinegar.
This is not the same DNA as you are made of. It doesn't behave the same way.
This is not evidence all on its own, it's used to further investigation.
As far as I can tell, it's not only not new, but it also has nothing to do with DNA. The marker is either a unique proportion of certain non-evaporating particles, or small engraved chips with a number on them.
DNA has nothing to do with this, even in an abstract sense -- it is not self-replicating, and certainly not biological.
APB...if you can't read the suspects DNA check if they are dressed all in white and carrying fish and chips!
A closed mouth gathers no foot.
Couldn't agree with you more. It's a sad day when xkcd can be used legitimately in court.
I've used a similar competing product called SmartWater.
The beauty of things like SmartWater is that its a suspension of fine molecules that can be *uniquely* identified to a particular user (i.e. you get a coded bottle with a unique number and a unique solution). The UV is just there to light up when people go through police stations but the chemical itself is, supposedly, uniquely identifiable.
You mean this smartwater? Wow, i had no idea flavoured vitamin water could do such things! And i thought it was to make you smart...
I would guess, the product in question is http://smartwater.com/
Living in the UK a few years back, I had started using it to mark belongings of mine, after a friend working for the police recommended it.
The stuff is almost transparent - but, when I applied it to a grey camera lens - it's still easily visible on it -- on black or white lenses it's not much of a problem.
On the greyish lens, I tried to wash it off - and have found that I couldn't (wet wipes, ...).
The stuff sticks fairly well - I can't even say I managed to get a noticable amount of it off.
As far as marking belongings goes - you literally only need a very small spot of it; and you can pick some place where it isn't too obvious. On my Nikon lenses, I sometimes put the spot on the 'o' in the Nikon logo. Trying to get this off would probably seriously (cosmetically) harm the lens; scratch off part of the logo - and the resale value will drop massively: No point trying to call it 'near mint condition' afterwards.
Under UV light, the spot is easily visible - under normal light, it's near invisible.
From another friend who works as a shop fitter for jewellers, he's tried it in alarm systems, and he told me, that it will take a few days/weeks before you get all of it off (i.e. small amounts still lodged in skin pores are almost impossible to get out easily).
Yes, but not always understood.
Do you have any evidence chicken producers do that? A URL or anything?
What are you, crazy? This is /.!
$ make available
This shit doesn't contain "DNA," it contains a chemical sequence that's sufficiently unique. They say "DNA" because DNA is so variant no two people who aren't clones (such as twins) have the same DNA. But it catches idiots with buzzwords.
Support my political activism on Patreon.
This is silly.
... how likely is it that they will take the time (and money) to get a sample and send it off? ... or that it actually identifies anything as belonging to you.
How likely is is that the police are going to wave UV lights over suspected stolen property?
or that they will wave the light in proper place?
or that they will even know what to do if something fluoresces?
And assuming they *do know about the stuff AND look for it AND find it
Not to mention the legal shakiness of the solution actually being unique
I can see this as a deterrent but the odds of anybody actually running a PCR on suspected marker on a suspected stolen laptop seem to make it not much more.
Who's DNA are they using?
Prawo Jazdy's?
Thank you. I've been reading the completely naive "explanations" of how this must work and was working up to attempting a post like yours. It's obvious that after even a moment's introspection that this stuff does have a use, and isn't simply an excuse to arrest anyone covered in UV paint. Cheers
Really? What other kinds of DNA are there? And shouldn't that raise more questions that for normal DNA we already know the answers, but which a new technology would have still unclear?
That's exactly what some of us hope, but I'd say it's not a given. Really, look just in this thread how many people take it for some kind of magical marker that can't possibly be wrong.
And I don't just mean taking for granted that it's unique, but also such issues as that nobody else will use their bottle for some malicious mischief, or that you won't end up with a nightmare when millions of marked PCs get sold without removing the markers, etc. It's assumptions which aren't even scientific or technical, but plain old suspending skepticism completely.
Will the same apply when the first jury has to judge such a case? That's the big question.
A polar bear is a cartesian bear after a coordinate transform.
Just think of it as a marker that contains a guaranteed unique identifier. backed up by a system that records which company is associated with that uniique identifier, and records to prove that they were the only company who has access to that identifier. It's millions of tiny (unique to that instance) serial numbers mixed up in a solution of UV-flourescent glue. This isn't that hard to understand, surely?
I'd bet this would be used (well, in a reasonable world) in conjunction with witness reports or camera footage to gather suspects, or to determine the owner of recovered goods. I am curious, though... if you get sprayed accidentally while holding your camera, then your camera gets stolen, will it be returned to the owner of the spray without question?
1. Buy your own unique DNA spray
2. Steal shit
3. Tag the stolen goods with your spray, and maybe scratch off serial numbers or other identifying information
4. Leave them with some homeless guy and report them stolen (maybe spray the homeless guy too)
5. The police notice the homeless guy with professional photography gear matching your description, confiscate it and find the DNA tag
6. The police helpfully deliver your stolen goods to your door
7. Profit!
Probably this isn't nearly worth anyone's time, and there are so many ways it could go wrong, but it seems like it could work...
Given my contact with UK police officers (specifically London ones) in terms of security marking:
I was warned never to go into a police station soon after I'd done the marking because I *WOULD* be pulled as they have UV lights in reception (where they deal with ordinary queries) for just this purpose and I was lighting up like a Christmas tree. They get them as they enter the building. They even stopped the guy who works for the company because the same thing happened when he walked into a station to demonstrate the stuff for them. It's standard procedure to scan ALL recovered property (and even lost property) for UV tracers and has been for a long while.
When something fluoresces that's been recovered / handed in, and they suspect it's stolen, they send it to the labs unless it's just a postcode marker (and then they follow up with anyone who was found with it and/or anyone who comes to claim it) - by that time it's evidence and they have to follow the rules of preservation of evidence. UV lights are standard tests when they raid a property and / or catch someone they think is a thief - they check everything. It's part of the standard "put your belongings on the desk" procedure and also followed up to the issuance of a warrant to search their house under suspicious circumstances. The officers I saw even carried key-fob UV LED's to check things like driving licenses (apparently ours have a security marking that fluoresces). Even my driving instructors and examiner did the same before letting me in the car.
In London, all local police forces know and use SmartWater and will actually attend demo's by the SmartWater people to show how to mark property. Some of the local borough's give it away to their residents. Most security vans now have a big "SmartWater Inside"-type noticeboard, so they use it too. School insurers generally demand that SmartWater is deployed in all schools on any equipment of value. I know - I'm the guy who's had to do it for half-a-dozen schools as part of my IT work and come home covered in UV-flourescent flecks.
Just because your local cops haven't heard of it, doesn't mean that it's not well known in it's home country.
If they have CCTV footage of an anonymous person on the street spraying them and running away, it doesn't matter what's in the bottle. They can still successfully use the "crazy guy sprayed me" defense, assuming there's not other strong evidence linking them to the crime.
Fortunately that tends not to happen in the UK. Unfortunately the alternative isn't that much better.
We rely on experts to testify about evidence. Thus it is down to your defence team to get a good expert to contest the bullshit that the prosecution's expert is saying.
That tends to happen during the appeal phase, well after the innocent person has already served years in jail. The most high profile case recently was Barry George. The police said that a single spec of gunpowder on his clothes proves he fired a gun (not necessarily the one used in the murder, BTW) but it was later shown that it could have got there while the garment was in police possession or any number of other ways. One spec is not enough to prove anything, and sure enough he was eventually released after several years behind bars.
It has happened with fingerprints too. There was a case in Scotland where a man did 3 years because they found "his" fingerprints at the scene. He eventually got an expert from the US to contradict the police's expert who said the prints were a match. Fingerprint matching is an art - it isn't like CSI where the computer matches it perfectly for you. It might be okay-ish for logging in to your laptop but in this case even that primitive test would have failed. Actually, I'd love to see that in a court: a demonstration of how the prints don't match because the little scanner on the laptop says they don't. It could be acompanied by a CSI-style graphical display of hundreds of prints as it tries to match them all, then flash up "NO MATCH" in big bold red letters with a loud beeping sound just to hammer home the point.
const int one = 65536; (Silvermoon, Texture.cs)
SJW, n: "Someone I don't like, and by the way I'm a fuckwit" - AC
A mask for the CCTVs...
...and a raincoat for the DNA spray?
--TSP
I have news for you: you can print your own receipts!
Shops don't have magical receipt printing machines. They are the same printers everyone else can buy.
const int one = 65536; (Silvermoon, Texture.cs)
SJW, n: "Someone I don't like, and by the way I'm a fuckwit" - AC
This will be usable for a few years, then you'll eventually have some plausible deniablity when it it over used
I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years.
It's also very good for equipment recovery. It basically guarantees identification / return of stolen property if it comes into police hands. but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner.
If this stuff spreads with the ease that TFA describes, it's going to get everywhere. How many law enforcement agencies do you think are going to take Joe Blow's word that they "only touched something that was touched by someone else, who I shook hands with?
Experiment: Spill some powered detergent with color safe bleach. Leave it in a public space for a day. Use a UV light to track its spread. Count how many people are now "marked" that were not the original spilling "criminal".
Yes, this product is uniquely identified, and easily indiscriminately spread. Just use Monsanto as an example of a unique item is being spread by the wind to people being accused of stealing.
Companies like this one sell a DNA "paint" which you can use to mark your belongings.
Microdot security paint (like this) isn't DNA, but can last through a fire.
That you get to listen to expert witnesses is AFAIK standard procedure in all of the western world. It still didn't prevent jury nullification because the jury thought the prosecutor must be full of it if they don't have some techno-magic CSI-style analysis to go with all the witnesses, or conversely convicted based on misunderstanding how reliable some piece of techno-babble really is. I doubt that the UK or any other country is immune to that, and judging by your examples, you're basically saying the same thing.
A polar bear is a cartesian bear after a coordinate transform.
I would guess, the product in question is http://smartwater.com/
Given the right DNA sequence? Sure, i guess it could be smart!
Patent using a bleach misting device to remove any trace.
Somebody will be suing claiming it causes cancer. Or bronchitis at the very least.
We've been waiting for the first major nanotech lawsuit for a while, and this may be it.
HAL.
Got them moderator blues I blieve I walk out the do', With these mod-points I been gettin', I 'most never post no mo'
Most thieves don't get caught at all; I think the statistic is one in ten get caught.
Free Martian Whores!
Step 5 and 6 are more likely to be "5. The police give you a case number to chalk up for your insurance, which will then go up, and never look at the case again" and "6. Homeless guy gets away with your fancy equipment and is never to be seen again".
Why do you think the police don't care? Because they're too busy. Why are they too busy? Because the crime rates are too high. Why are the crime rates too high? Because the criminals can get away with their crimes. Why can the criminals get away with their crimes? Because the police don't care. It's not getting any better either. Now get off my lawn.
Visit http://ringbreak.dnd.utwente.nl/~mrjb/growingbettersoftware to download your free copy of the book
I usually just pee on everything I own.
I mean, why pay some company for synthetic markers, when you already have your own custom-tailored ones for free?
the preceding comment is my own and in no way reflects the opinion of the Joint Chiefs of Staff
Once it dries, it doesn't spread like you seem to think.
Why bother buying that expensive solution to tag your goods? Simply bleed on them (or use other imaginative sources of bodily provided DNA sources likely spread around a focused spot in your mothers basement). It will also be harder for crooks to "steal your bottle of SmartWater"
Just curious: did he try going to one of those spas where they completely cover you in exfoliating mud and then take it off? Someone should. You get to prove one or the other ineffective...
They do. If it ends up being sold as halal/kosher is a different matter. It would not surprise me as it is rarely labled as such and is often repackaged in the country that imports it.
http://news.bbc.co.uk/1/hi/uk/3006192.stm
Duh! Let me spell it out: I think the police know how to check a paper trail. Expensive jewelery in a shop will have more than a thermal paper till receipt behind it.
Besides, there's no way you'd be able to spray it without being noticed and just leaving a few fingerprints on it from looking at it wouldn't be the same.
No sig today...
What's stopping me from getting my own DNA water, and spraying it all over your stuff that I want to steal?
Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence: "You Steal, You're Marked."
But, nothing tastes quite as good as the McRib you make yourself for free!
Be aware of Printer steganography, which makes it easy to detect that you forged all your receipts with the same printer.
Why are the crime rates too high?
The crimerates are mainly high because a lot of stuff is classified as crime which shouldn't. Stop the War on Drugs and a lot of problems with crime would solve themselves, giving cops time to deal with real criminals.
Crime rates in US are at 30 year low. So what is this about crime is too high?
Perception due to 24/7 media exposure is that crime rates are high. Then again reality doesn't really care about perception.
How do you function in society?
You accept a company's guarantee to behave in a certain way from your bank, you expect your legal system to behave in a certain way.
You expect the company that produces any pharmaceuticals you take to make certain guarantees as to quality, testing, efficacy and manufacture.
It's a forensic tool. Company X will certify that smartwater product ID 12345678abc was manufactured on a set date, track its packaging and dispatch to a specific customer, and then retain their records and full audit trail for inspection by law enforcement.
Nobody except you is claiming it is an "auto win" button for crime and property recovery.
You spraying someone elses property is stupid because you don't have chain of evidence indicating you legally own said property.
It is the combination of property records + marking liquid + company w/ high level of trust (if smart water company trust is worthless so is the product) that increases likelihood of recovery.
Sometimes it isn't even about criminal charges. Stolen property ends up in pawn shops all the time missing the serial number. Now if it has been sprayed w/ DNA tagged liquid then one can verify the owner of the property and return it.
Invoice + police record + smart DNA tag record + stolen property w/ smart DNA tag = pretty good chance that is the original owner.
vs
Stolen property missing serial number = never recovered/returned.
Yes, but with Nature's Miracle you don't have to. Just leave it there and no one will ever know.
http://www.colbertnation.com/the-colbert-report-videos/49811/january-18-2006/bring--em-back-or-leave--em-dead---teacher-s-edition
It doesn't hurt to be nice.
""How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X" Are you sure it was only issued to company X? Show my evidence that no other bottle could possibly contain the same solution. See, with humans this process occurs naturally, everyone has different DNA (with extremely high probability) because of how biology works. Once you start making your own, you've shown that it's possible to duplicate DNA, thus the solution is NOT necessarily unique.
It's fairly trivial to synthesize a chunk of DNA that is extremely unlikely to be natural: a couple kilobases of repeated GGGTTTCCCAAAGGGTTTCCCAAA is as unlikely to appear in nature as a monkey typing a couple kilobytes of Shakespeare. Of course it's *possible*, just as it's *possible* that someone else out there has exactly the same fingerprints as you do and that person was the one who left the fingerprints at the scene, but this is why we invented statistics.
Add to that huge long repeating sequence, a 30 base sequence for actually identifying which customer bought this particular batch, and you have something that is at least as accurate as fingerprinting.
Nostalgia's not what it used to be.
"fine mist with trace of DNA" my arse.
Watch this Heartland Institute video
It's far more likely to be used along with other evidence, i.e. used to refute a police statement where they denied being in that part of town that day, or if they claim to have been in the bank (but a few tellers down, and hence sprayed), used with video surveillance to show weren't.
It doesn't hurt to be nice.
Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag, the tools, the stolen property. So you'd need to do a job and then ditch everything you have in a forensically secure way.
Or simply wear the same clothes to attack / burgle at least one other location that might use a similar spray.
In other words, what happens when the original layer is obscured by multiple, overlapping layers from some other site? Or, just as bad, if the layers mix, producing a chemical similar to, but sufficiently different from, the original layers?
Just think of it as a marker that contains a guaranteed unique identifier. backed up by a system that records which company is associated with that uniique identifier, and records to prove that they were the only company who has access to that identifier.
Many people have already pointed this out here, but since apparently it is too hard for you to understand I'll point it out again: no system of identification is more secure than its weakest link. In the case of SmartWater and other similar systems, the weakest link is the end user. Unless you can prove beyond reasonable doubt that no one in the shop in question has had any access to the source bottle, and you can further prove that no one who has been sprayed has ever transfered any of the material to anyone else, ever, you have a very poor identification system.
The number of people in this discussion who are telling us it is possible to amplify minute traces of this stuff for forensic purposes as if that was a good thing--rather than an open door to false conviction due to accidental transfer of minute traces of this stuff--is depressing.
This is just another insane scheme by ignorant people who think that "zero" is a tolerance, and it will fail for the same reasons. Every American $100 bill purportedly has non-zero traces of cocaine on it. In a few years of widespread use every person will have a few dozen DNA traces on them, including many from places they have never been due to accidental transfer.
This isn't that hard to understand, surely?
Blasphemy is a human right. Blasphemophobia kills.
Many sane, functioning members of society don't trust the very government they vote for, let alone a for-profit company.
Quoting ian_from_brisbane:
"I don't understand how you can rely on a company 'guarantee' as proof of anything."
Why should we trust a for profit company's proprietary method of tracking (regulated or unregulated) as gospel? Would you be willing to bet someones life or freedom for that? br>
If there was some regulatory process that documents the production and distribution of said product, then verification was done by a third party with no stake in the profit *MAYBE* we could trust it. The first question I'd ask, is how do I know product id 12345678abc was not created twice? Who verifies this, and does that person collect a paycheck from the same company that produces it?
But that doesn't solve the issue that anyone with a few bucks can buy this and spray it over anything they want. So you'd also have to regulate and track purchase and USAGE of the product.
The very existence of the technology proves this tracker can be duplicated...a terrible product that could never be foolproof.
Becasuse the business model of the company depends on them demonstrating that level of audit! Think!
Just wait for someone to get a black market supply of various ones of these and just go around spraying crowds of people... or figure out how to make the sprayers malfunction and spray random people.
Scientists get to test new gene delivery techniques on willing subjects, the local sewer company can make millions through market research and street lighting costs will be reduced when all McDonalds customers glow brightly, not to mention the reduction in traffic accident fatalities when pedestrians are more visible after dark.
Nullius in verba
Evil masterplan (sorry, no ????)
1. Set up business selling things (ebay, whatever)
2. Tag everything you sell
3. Presumably a percentage of this stuff will be stolen
4. It finds its way back to you
5. Sell it on ebay
Who said crime doesn't pay?
Python coder | PyQt Applications | Writer
Now the cops won't have to synthesize DNA for framing anymore; just get a matching sample of this stuff from the former cop co-inventor and boom! Case Closed!
I beginning to realize, this is not the greatest time to be alive anymore and the future is looking effing grim as well.
I told you yesterday, get an account!
http://slashdot.org/comments.pl?sid=1827580&cid=33949006
"When information is power, privacy is freedom" - Jah-Wren Ryel
Circular logic is circular!
Again, why in the world would I (OR ANYONE) trust a company's [business model] to dictate the freedoms of a suspect?
The companies business model doesn't necessarily depend on them demonstrating that level of audit. It depends on its ability to continue convincing their buyers that product will catch criminals. They can prove it can tag criminals, so theres no false info there. What they can't prove is that it can catch ONLY criminals.
Thats fantastic if they can in fact demonstrate their audit process. But are they demonstrating this audit process to the people that matter, like the organization charged with the task of sending criminals to prison? Can they demonstrate the product is infallible? If they can, are they demonstrating this to the right people? Are they being certified on a regular basis?
How about the buyers? Are they being certified to use it correctly? Have they been certified that they bought the product using their real name and identity? Have they been background checked for criminal history?
That could work for a bank vault but not a bank lobby or a McDonalds...
"When information is power, privacy is freedom" - Jah-Wren Ryel
I should think that once it's hydrolyzed, it's no longer beef or pork anyway, technically. Isn't that good enough for Jews and Muslims?
...the future crusty old bastards are already drinking the Kool-Aid.
The thing is that until recently it wasn't. It was what ever was blasted off and boiled out of the carcases. Now it is the same stuff but you can no longer use DNA to identify which kind of animal it came from.
Does boiling pork bones down make them halal? You are not talking science here you are talking doctorine. But if they do dont want to eat pork that is fine and I really don't think "pork extracts" should be pushed on them unknowing. Even if it is curshed, boilded down to a pulp, pushed though filters to remove the teath and then put in to thier chicken. I don't want it in my chicken. I don't even want the salt walter that is comonly put into meat in my food.
matfud
I must not have read it correctlt the first time.
The link I gave earlier to the BBC says that the FSA in thier tests half the chicken marked as halal destined for catering was found to contain pork. Here is an earlier report http://news.bbc.co.uk/1/hi/programmes/panorama/3047159.stm
I'm glad to hear that the London police are so on top of things.
My experience is with the LAPD and various smaller LEAs around the US... and I can tell you the likelihood of anything besides deterrence coming of that here is slight at best.
Most of them are understaffed, underfunded, and overworked... CSI is a TV show and nothing more.
lol
so what happens when I surreptitiously write some other name and address on your possessions?
this sounds ripe for 'fun' pranks
Steal a company's Smartwater and transparently replace it with something which looks the same, at least cosmetically.
Step 2: Steal something valuable from the company and use the Smartwater to frame whoever else you want. Or just spread it around a lot so that a whole bunch of high-profile people are found to have it on them.
Step 3: Get away with it, maybe?
Someone _will_ get sent to jail by some idiot jury because the real burglar -- who, for example, is an employee and didn't even need to synthetise anything: he just nicked the bottle that the PHB cleverly hid in his desk drawer -- sprayed them with it.
I don't think so; it will not be enough on its own to convict a person on its own; but that is not the point either. The point is to 1) make objects traceable, and 2) make it easier to link people with places in a criminal investigation. So, the police can prove that person was (or was VERY likely to have been) in contact with a marked object.
And of course, if things are marked with a bespoke DNA that nobody else can (easily) get hold of, you can't just buy a can of the stuff and frame somebody. I imagine they can (and will) sell unique DNA profiles in individual cans marked with a serial number, so each new can will be different.