Slashdot Mirror


DNA Fog Helps Identify Trespassers, Thieves, and Brigands

Zothecula writes "Applied DNA Sciences (ADNAS) has developed a new approach to solve crimes using DNA tagging. The difference is that instead of tagging the objects being stolen, the company's system tags the perpetrator with DNA. While this has been tried before by applying the DNA to a fleeing criminal with a gun, ADNAS has adopted a more subtle approach."

80 of 129 comments (clear)

  1. Why stop there? by goombah99 · · Score: 1

    Why not fog the warehouse with cold viruses that give you flourescent green boogers?

    --
    Some drink at the fountain of knowledge. Others just gargle.
    1. Re:Why stop there? by LifesABeach · · Score: 1

      A "Man Trap" is considered legal to have?

    2. Re:Why stop there? by K.+S.+Kyosuke · · Score: 1

      Don't you think that a potent laxative would be less prosecutable? It would also be more fun to watch, especially when combined with a strong diuretic.

      --
      Ezekiel 23:20
    3. Re:Why stop there? by PRMan · · Score: 1

      A guy was prosecuted and jailed for putting ipecac syrup in his own lunch.

      --
      Peter predicted that you would "deliberately forget" creation 2000 years ago...
    4. Re:Why stop there? by NatasRevol · · Score: 1

      That doesn't make it wrong!

      --
      There are two types of people in the world: Those who crave closure
    5. Re:Why stop there? by TheLink · · Score: 1

      Nah, why not fog the warehouse with "fog":
      https://www.youtube.com/watch?v=2tobb0igeGQ
      https://www.youtube.com/watch?v=cAPw_xbTJzk
      https://www.youtube.com/watch?v=Q4fd88DhN5I

      Seems more likely to reduce your losses than some DNA fog which the cops will never bother with (unless perhaps someone is killed).

      --
    6. Re:Why stop there? by K.+S.+Kyosuke · · Score: 1

      That's probably a result of living in an idiotic country rather than of using something I can buy in local e-shops.

      --
      Ezekiel 23:20
    7. Re:Why stop there? by djl4570 · · Score: 2

      Rat poison would be reckless endangerment. Like gun trapping an empty house. There are non lethal approaches.
      A friend told me of a time at TPC where a plate of brownies laced with Ex-Lax was left in the fridge for the resident fridge thief. It worked well. Five brownies were missing. The suspected thief clocked out sick less than an hour into his shift and there was evidence that he didn't make it out of the building without shitting himself.

    8. Re:Why stop there? by plover · · Score: 4, Funny

      A "Man Trap" is considered legal to have?

      I hope so. I married one.

      --
      John
    9. Re:Why stop there? by Sabriel · · Score: 1

      I just looked up "ghost pepper". I'd heard of the Scoville scale years ago. This one can hit a million. +1 Internets to you, AC.

      https://en.wikipedia.org/wiki/Scoville_scale

    10. Re:Why stop there? by metaforest · · Score: 1

      Beware the Venusian Mantrap.

  2. Why not just use Skunk odors.... by realsilly · · Score: 1

    ...that's a spray, and the smell is fairly easy to follow.

    Seriously, this sounds pretty interesting, and scary all at the same time. It has the potential to last years, but it appears that a Police swab would be necessary. Why not make it so it's luminescent thus allowing a special light to be used to detect the DNA? This would prevent the need of the swab and the refusal of a perpetrator from providing the sample.

    Just a thought.

    --
    Life takes interesting turns, but the most interest is when you're off the beaten path.
    1. Re:Why not just use Skunk odors.... by pr0fessor · · Score: 1

      It wouldn't help you track the brigand to tag them with just DNA, you would have to pick them up for something else or have enough evidence for probable cause before you could even swab them or their belongings. I am however sure a police dog could be trained to track a some kind of oil based scent that would be really hard to remove like a skunk scent. Then everything in of your store/warehouse/factory/home would be tagged with it as well so I don't think that would work either.

    2. Re:Why not just use Skunk odors.... by icebike · · Score: 4, Interesting

      Ah, at last someone gets to the crux of the matter.

      You still have to find the perp via some other means.

      Then take DNA samples and process those. But wait, you also have to sequester every cop who visited the crime scene and not let them touch any evidence for weeks on end. And not just the evidence from one crime scene, but all the crime scenes using this technology. Once the cops set foot on the premises they too will be tagged. As well as their wives and co-workers that come in contact with their uniforms, objects they handled, and any perps they happen to apprehend.

      Your average burglary detective would spread the DNA from several recent robberies to every suspect they hauled in. Would do wonders for their arrest rates. *cough*.

      So the DNA taging system builds a web of uselessness around itself, which spreads wider daily, while at the same time provides not a single additional clue to help you catch the thief.

      And I don't believe that bit about being hard to wash off either. After all, if you can sample it by simply using a swab, how tightly can it be bound?

      --
      Sig Battery depleted. Reverting to safe mode.
    3. Re:Why not just use Skunk odors.... by pepty · · Score: 1
      fluorescent dyes are great, but they would also alert the criminals that they need to wash up. (blacklight flashlights cost less than $10 these days). DNA is great, but easily destroyed by 5% bleach. So long as the criminals throw away or bleach everything they brought with them (including themselves and the loot) this system is beatable.

      I think the police would ban the use of thiols at crime scenes after their first investigation. "You want me to go IN THERE and bag evidence? Fuck that, I'm on sick leave as of 10 minutes ago". "You want me to put THAT GUY in our cruiser? We'll be smelling that for weeks! We'll smell like that for weeks!"

      Those chemicals are really difficult to get rid of without peroxide or chlorine bleach. I used to work with them, a few microliters at a time in chemical hoods with great ventilation, and the odor would still get in your hair and clothes.

    4. Re:Why not just use Skunk odors.... by pr0fessor · · Score: 1

      Shortly after they had new security cameras professionally installed at work, I called the site director over and had him watch the dvr screen. I told him to watch me walk out of the building and back in... I walked out of the building normally and off camera then walked back in at angles I knew the cameras where missing when I got back to the office he says "I thought you were pulling a prank and just went to lunch cause I didn't see you coming back".

      He ended up calling them back to fix it. I think the building was more secure when they had a security guard.

  3. The end of crime by korbulon · · Score: 1

    Because this could NEVER-EVER be misused.

    1. Re:The end of crime by tloh · · Score: 1

      Maybe the article was badly written, but at face value, it seems like a dumb idea to begin with. DNA molecules of any practical size are much to large to be suspended in the air for long. Any surface that is non-sterile is filled with nucleases released by microorganisms and endogenous enzymes from the human body that will quickly degrade your DNA beyond recognition. It would be as if those dye packs being used by banks are water soluble. All a criminal needs to do is do laundry and take a shower to eliminate the evidence. If these so-called DNA tags are not protected in some way, all you'll end up with is the constituent of nasal mucus.

      --
      Stay sentient. Don't drink bad milk.
    2. Re:The end of crime by boristdog · · Score: 2

      Plus, the security guard who responds to the alarm will probably get the DNA all over themselves as well. And security people are always on the first list of suspects, so every job will appear to be an inside job, OR the security people will be free to steal whatever they want, since they have an alibi for having the DNA on them.

      Until the security guards learn to just not respond to alarms. Which means the cops are free to steal as much as they want, since THEY will be the ones to have the DNA all over them, and have a good alibi now.

    3. Re:The end of crime by icebike · · Score: 1

      Yup, it's not like the clothing could be washed & dried in a public laundromat and the next fifty people to use it become suspects.

      Well the detectives investigating the crime scene will pick up quite a load of this DNA too. So any random person they choose to get off the streets and puff up their arrest record will be tagged as the detectives grab them and cuff them. And sure enough, the tags will match.

      --
      Sig Battery depleted. Reverting to safe mode.
    4. Re:The end of crime by RockDoctor · · Score: 1

      Any surface that is non-sterile is filled with nucleases released by microorganisms and endogenous enzymes from the human body that will quickly degrade your DNA beyond recognition.

      "degrade" , yes ; "beyond recognition", no.

      Forensic scientists and archaeologists - in fact, almost anyone who works with DNA and isn't a medic - are well used to working with contaminated, multiple-source DNA samples. It does make the job harder (which is why in the real world you'll only hear DNA evidence presented as probabilities of supporting this hypothesis over that hypothesis), but not impossible.

      I gather that there are a suite of TV programmes with names like "CSI" which might give you a different impression. These are fictional constructs.

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
    5. Re:The end of crime by tloh · · Score: 1

      I would defer on matters pertaining to the specific robustness of forensic analysis to others with more experience in the particular field. However, as someone who has an annoying number of experiments fail due to contamination and other mysteries of the often fragile and fickle nature of DNA/RNA, I wonder why someone would bother *intentionally* use it to construct a tool in this manner. If you were to design a bio-metric ID tagging system from the ground up, you don't have to limit yourself to the means and methods of salvaging physical evidence that were left unintentionally under opportunistic, less-than-reliable circumstances. The basic idea they are proposing may not be so far fetched, but instead of naked DNA as the article suggest, maybe deploy the tags in some kind of nano-packaging that will resist degradation both on the shelf as well as after application?

      --
      Stay sentient. Don't drink bad milk.
    6. Re:The end of crime by RockDoctor · · Score: 1
      Original scheme :
      • Make DNA tags.
      • Apply DNA tags

      Your revised scheme :

      • Make DNA tags.
      • Provide protective coating to tags, as sets of tags.
      • Apply DNA tags

      Depending on how you do your accounting, and the relative costs of your materials (declining as production volumes increase) versus your labour (may decline if you can move it down from skilled lab workers to MacDonald's burger-flipping rejects), you've increased your costs by between 30% and 50%.

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
    7. Re:The end of crime by tloh · · Score: 1

      It doesn't necessarily have to be more costly. (Or perhaps trivially so) On the other hand the additional cost could be value added features that enhance the usefulness of the tags. The tags can be engineered and packaged to any degree that can be implemented with current technology. Having thought about this now for a few days, I think one very viable option is to maintain the tags *inside* a bacterial host as part of its chromosome or as discreet plasmids. With all the functions afforded by a living expression host, you now have a lot of options open up.

      *Perhaps you can add an additional payload in the form of some kind of "biological ticking clock" that starts counting upon exposure such that investigators can pinpoint "time from crime".

      *Ligate an inducible expression system to the plasmid such that living human tissue switches on one traceable gene while fomite and other inanimate objects trigger another. You now have both perpetrator as well as his tools/weapons. Couple it to the "ticking clock" and you have a physical sequential trail of where he/she has been.

      *Timed/directed self-destruction/self-inactivation so that beyond a limit of statute, you don't have stray tags persisting in the environment polluting the scene of future crimes.

      And this is just off the top of my head. There are LOTS of room for improvement/enhancement.

      --
      Stay sentient. Don't drink bad milk.
  4. Eww by Antipater · · Score: 5, Funny

    "Everything was going great, until the bank manager sprayed me in the face with his DNA!"

    --
    Everything is better with chainsaws.
    1. Re:Eww by RockDoctor · · Score: 1

      Could have been worse - the bank manager could have sprayed you in the face with packages containing half of his DNA (plus all of his mother's mitochondrial DNA) selected at more-or-less random form his own genome. Your "golden rain" scenario is barely kinkier than getting a "Robin Necklace".

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
  5. Re:"Brigands" by telchine · · Score: 2, Funny

    They're brigands and blaggards; those dirty vamints. These dastardly perpetrators must be stopped forthwith! What do you think, old bean?

  6. Re:"Brigands" by sideslash · · Score: 5, Funny

    Them brigands'll filch your victuals and abscond apace from your ken.

  7. Application with a gun by ISoldat53 · · Score: 1

    I've never heard of applying DNA to a fleeing criminal with a gun. Sampling, yes, but not applying. A 9MM provides sufficient DNA samples.

  8. Comment removed by account_deleted · · Score: 3, Insightful

    Comment removed based on user account deletion

  9. I thought bleach destroyed that stuff. by Karmashock · · Score: 2

    ... So... you couldn't just take a dip in a swimming pool?

    It goes without saying that once it becomes common knowledge that these things are being used thieves are going to burn their clothing after the heist. What then? Swab their bodies? Their lungs? The whole diver mask thing seemed to imply the air had to be filtered.

    --
    I've decided to stop wasting my time responding to AC trolls/sockpuppets... so if you want a response from me... login.
    1. Re:I thought bleach destroyed that stuff. by RockDoctor · · Score: 1
      You are ignorant of the fact that "forensically aware" criminals have been doing this for years already? All this will do is add a washdown with a detergent-oxidising agent mix to the normal procedures of using clothing from the second-hand shop (if you can't use a painter's white paper suit, or a burka as a recent armed robbery in London did), laundering it or burning it as soon as possible after the crime (if you're going to "torch" the "motor" ... do all your clothes too).

      The only reason for criminals to get caught through forensics these days is through either failure to do their research, inattention to detail, failure to follow through procedures, or failure to launder the proceeds after the crime. i.e., sheer bloody stupidity. Which is common enough in the criminal fraternity, because if they can do things like that, they're bright enough to make more money through regular work.

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
  10. Brilliant. by cfsops · · Score: 1

    From the cited article:

    DNA Fog is an airborne suspension of artificial DNA molecules with a known but biologically inert sequence

    [emphasis mine]

    Because DNA is such a simple and easy to understand structure, spoke the head growing from ADNAS's ass.

    1. Re:Brilliant. by wonkey_monkey · · Score: 1

      Isn't it? It's a string made up of only four characters. Very simple. I thought it was also quite well understood which codons encode to which amino acids.

      Given that there's always someone ready to dump on any announcement of scientific advancement, I'm going to take ADNAS's word for it until an actual scientist turns up.

      DNA is inert outside of a cell anyway, isn't it?

      --
      systemd is Roko's Basilisk.
    2. Re:Brilliant. by cfsops · · Score: 1

      Sorry, I don't see this as a "scientific announcement". The company, Applied DNA Sciences, is not a research company, it's a for-profit business. From their web site:

      "Applied DNA Sciences delivers counterfeit protection, brand authentication, combats product diversion, and offers its award-winning programs against cash-in-transit crimes, all using the proven forensic power of DNA. With impenetrable taggants, high-resolution DNA authentication, and comprehensive reporting, our botanical DNA-based technologies deliver the greatest levels of security, deterrence and legal recourse strength."

      I'm not shitting on science, I'm questioning how a for-profit business is using science. I don't consider this an "advancement" any more than I consider Big Boy and Fat Man, or the myriad other weapons that came after, to be "advancements" of our understanding atomic science.

    3. Re:Brilliant. by wonkey_monkey · · Score: 1

      I'm not shitting on science, I'm questioning how a for-profit business is using science.

      You're not questioning. You're sarcastically implying (with no evidence given) that they don't know what they're talking about.

      --
      systemd is Roko's Basilisk.
  11. amazing by slashmydots · · Score: 2

    Wow, I can see thieves and trespassers but for brigands you typically need to make a perception or arcane check roll to identify them.

  12. Scenario by goodmanj · · Score: 3, Insightful

    Here's a scenario for ya. You're on the scene on day ten of the latest round of anti-capitalist protests in Zucotti Park, New York city. The crowd gets a little unruly and a full-scale riot breaks out. A cop gets his head caved in with a brick, a couple people get trampled, and the tear gas and truncheon work gets underway. The crowd scatters and disperses, and you go home and wash the tear gas out of your eyes.

    Two days later, the cops show up at your apartment. It turns out they mixed a little DNA taggant into the tear gas grenades. They're going door to door throughout antiestablishment hot-spots in the city, asking for people to let them take a swab off their skin, so they can find the bastards who started the deadly riot. If you refuse, they apologize politely, and then swab your door handle on their way out.

    1. Re:Scenario by LordLimecat · · Score: 1

      ... And then you get a pro-bono lawyer to win the biggest 4th amendment case of the decade.

      Im pretty sure you cant get a warrant to go door-to-door swabbing random people-- at least not yet.

    2. Re:Scenario by MasseKid · · Score: 2

      Actually, they effectively can. They simply arrest you, book you (where DNA taking is legal), and then fail to press charges, and release you. Knowing this is all legal, they can go door to door telling you that you can either give it, or they'll just arrest you and take it anyways.

    3. Re:Scenario by goodmanj · · Score: 1

      The biggest difference between facial recognition and DNA fingerprinting is that DNA fingerprinting actually works.

    4. Re:Scenario by LordLimecat · · Score: 1

      An arrest requires probable cause. What you describe would be the basis of a huge lawsuit.

    5. Re:Scenario by goodmanj · · Score: 1

      It ain't perfect, but it's without a doubt the most reliable criminal identification tool we've got. If we go back to rigged line-ups and botched fingerprint analysis, the world will be a less just place.

      And a good defense counsel will make sure the jury knows about the potential problems of DNA matching. I served on a jury in which we rejected badly-collected DNA evidence and (for that reason and many others) acquitted the defendant.

    6. Re:Scenario by stephanruby · · Score: 1

      Actually, DNA looks great under ultraviolet light. They can just shine a light on you at night, then they can swab you to make sure it's not yourself, or someone else, who sprayed their DNA all over you.

    7. Re:Scenario by RockDoctor · · Score: 1
      • (1) you're already guilty for being at the crowd which became a riot ; your intentions are irrelevant, the crime is one of strict commission. The Riot Act was read ; the crowd was ordered to disperse ; you were there, as witnessed by the presence of the tags ; you're guilty. End of facts (unless you're going to dispute those facts, see below) ; start of sentencing phase.
      • (2) "and then swab your door handle on their way out." Why did you let them in. You're not obliged to let them in without a warrant. So don't (w.a.w). Ever (w.a.w). Not for any reason, including a search for a missing cat (w.a.w).
      • (3) see standard forensic awareness techniques posted above. Plan for them before the event and carry them through after the event.
      • (4) when the water cannon and/ or tear gas (tagged, whatever) starts flowing, catch as much as you can and then go and drip it over public transport, sit on park benches, go to the library ; spread the taggant as widely as possible so that everybody in the city is tagged regardless of their actual activities that day.

        Item (4) allows you to dispute item (1) ; you've broken (or introduced "reasonable doubt" to) the assertion that "this tag means presence at the riot".

        Didn't they teach you anything in school in the 1980s?

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
    8. Re:Scenario by RockDoctor · · Score: 1

      They simply arrest you, book you (where DNA taking is legal)

      Co-operate by letting them take a blood sample. You do have your lawyer lined up already, and they'll be present when the sample is taken, and will retain one of the duplicates.

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
  13. Re:"Brigands" by bluefoxlucid · · Score: 1

    I was thinking more "Why DNA instead of fluorescent dye?"

  14. Re:Must...Not...Make...DNA...Tagged..Underwear...J by Eightbitgnosis · · Score: 1

    Better than a DNA tagged sock joke

  15. Re:"Brigands" by Marillion · · Score: 1

    It's common in microbiology to insert Green Fluorescent Protein into lab strains microbes to make them more visible under microscopy.

    --
    This is a boring sig
  16. Re:I "tag" all my property with my DNA.... by GLMDesigns · · Score: 1

    penismanship?

    --
    If you're scared of your govt then you need to further restrict its powers
    Vote 3rd Party in 2016 and beyond
  17. Re:"Brigands" by fuzzyfuzzyfungus · · Score: 5, Funny

    I was thinking more "Why DNA instead of fluorescent dye?"

    For truly efficient brigand-tracking, you want a globally-unique taggant, rather than being limited to the few dozen-ish colors of fluorescent dye...

    Just imagine! Incentivize your riot cops during the next protest by mixing a unique DNA tag into each one's pepper spray and then analyzing the detainees. The more dirty hippies with your spray on 'em, the better your chance to win the department raffle!

  18. Re:What could possible by Anonymous Coward · · Score: 1

    Grammar could possible go wrong.

  19. Mad Scientist by b4upoo · · Score: 2

    In order to fight back for crime we will be offering a spray that contains cloned DNA from millions upon millions of people. That way DNA evidence will become worthless as it will appear that the population of large nations was in the room not to mention the expense of sorting all the DNA samples. Due to the tiny nature of DNA a handy one ounce spray bottle could fit in pocket. Keep in mind that if your thing is rape you will need to spray this stuff where the sun doesn't shine in order to confuse the issue. The woman would appear to have slept with 23 million people the day of the attack.

    1. Re:Mad Scientist by ImprovOmega · · Score: 1

      It wouldn't take much to cross-contaminate it and make it utterly worthless though. It's hard enough to filter out one reference sample (victim) from the perp's DNA to get a clean read. And labs have to take some pretty extraordinary measures to make sure none of the suspect's reference sample mixes with the crime scene sample to avoid a false positive. Throw a random mix of a bunch of other people's DNA in there and you would probably mess it up enough to make the sample worthless. Granted, I wouldn't want to bet 20-30 years of my life on it, but I guess if you were going to commit a crime anyway it wouldn't hurt in trying to cover up your tracks.

      Harsh penalties for possessing DNA avoidance systems in 3...2...

    2. Re:Mad Scientist by jabuzz · · Score: 1

      The suspects reference sample should be tested at an entirely different facility from the crime scene samples.

    3. Re:Mad Scientist by RockDoctor · · Score: 1

      That way DNA evidence will become worthless as it will appear that the population of large nations was in the room not to mention the expense of sorting all the DNA samples.

      Which is why the DNA tags that they use contain biologically impossible DNA sequences. Or at least ones of implausibly low probability, such as (I construct a mapping of ASCII letter codes onto A="00", C="01", G="10", T="11" ; build a look-up table, make a translator ... for upper case only) "CCATCATACAACCCATCAGACACACATTCCCAAGAACCATCCCCCAATCAGTCCATAGAC" , which should encode "SLASHDOT SUCKS!" and is fairly unlikely to occur in any existing organism on the planet. (Google can't find it. Not surprised. Anyone know how to use sequence databases?)

      Whether that would make a protein, I don't know. It may have several STOP codons in it (I don't have my lookup table of DNA tuples to amino acid and STOP codons to hand).

      What you'd need to do would be to get a number of their DNA samples and try to work out their encoding scheme (it's likely to be based on ASCII, and therefore need 4 bases per character, while natural DNA is based on 3-base sets ; that alone will mark it as "unnatural" ; perhaps they start every strand with "copyright WHOEVER 2013" ; you'll need a fairly large sample - a few microgrammes perhaps). Then create a lot more "spam DNA" using the same encoding scheme. Then contaminate everywhere.

      Oh, sorry, I wandered off into an attack on this scheme in particular, not your scheme of attacking DNA evidence in general. Hmmm. you'd need a fair source of random human DNA. A minor bit of lab work (to snip the DNA into the sort of strands used in "fingerprinting"), and then some genetic engineering to reproduce the mix of strands you've got - say by brewing yeast. Getting X million sets of fingerprint strands into a single brew-able organism would be a hard job. But if you sampled (say) the towels of the Barcelona FC changing room, you could have your victim having shagged the whole squad on the night that you did him. Which could be ... embarrassing, considering the number of footballers in the DNA databases. Should be do-able. Highly illegal (the charge here would be "conspiring to defeat the ends of justice"), hard to argue that it happened by accident, but it should be doable on a "football squad basis.

      And the forensic teams would respond by searching the swabs for a single intact sperm, PCR-ing that up to fingerprintability, and fucking you that way. If they don't do that already.

      Incidentally, I've expanded my "translator" to handle phrases now, and to "handle" lower case characters the easy way. So the copyright statement might look like this: CAATCATTCCAACCGC CCAGCAGCCACTCAGA CCCAAGAACCCTCAGA CATTCACCCCCGCACC CCAGAGAAATAGATAA ATACATAT

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
  20. Burn Notice by Amezick · · Score: 1

    Didn't I see something like this on an episode of Burn Notice a couple of years back?

    1. Re:Burn Notice by RockDoctor · · Score: 1
      I don't know what "Burn Notice" is, but this does sound very similar to the idea of "SmartWater" (leaving stains of lots of fluorescent dyes in unique combinations, 20 distinct dyes enabling a million distinct tags) from 20 years ago. And explosive tracing from the decade before (shreds of plastics in the explosive ; enough survive to provide a fingerprint. And enough to contaminate the whole environment.)

      Remember when having traces of cocaine on a five-pound note was sufficient to get you jailed?

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
  21. Zardoz teaches : "The PENIS is EVIL"! by Thud457 · · Score: 2

    well, they are talking about indiscriminately spraying DNA around all over the place...

    --

    the preceding comment is my own and in no way reflects the opinion of the Joint Chiefs of Staff

    1. Re:Zardoz teaches : "The PENIS is EVIL"! by GLMDesigns · · Score: 1

      yah. Didn't read the post closely enough. "Black light" was the key phrase.

      --
      If you're scared of your govt then you need to further restrict its powers
      Vote 3rd Party in 2016 and beyond
  22. B&E style change.... by Lumpy · · Score: 1

    Now B&E experts will start wearing latex gimp suits...

    --
    Do not look at laser with remaining good eye.
  23. Mixed feelings, dye packs are fine. But this? by kannibal_klown · · Score: 1

    I'm cool with dye packs. They're immediate, short-range, they make it very visible that you're the bad-guy or were at least near the money at some point. In the days / hours following the heist there's a chance someone saw a fluorescent blue guy running around. Maybe you were part of the crime or maybe you were near a discarded pack when it went off. In either case, it's a visibly obvious way to at least track where the money was going.

    So: short range, easy to notice (and complain about) accidental exposure, etc.

    This... I don't know. What happens if you were exposed by accident; via a leak or rub-off from someone else. You won't know, in which case if it gets "found" then you have a big hassle of explaining your alibi. IE: they find out you were there around that day, check you out, and zap you have the DNA residue.

    And of course, some a$$hats will just assume it's fool-proof and that you're involved. Some people really gobble this stuff up; every new thing is infallible and the best thing since sliced bread.

    So they take it a step farther and instead of passively spraying someone when an exhibit case opens, they spray it on unsuspecting crowds during a riot / protest while you're buying some street hotdog. And going along with the a$$hat argument, they try to say "Well you were there so you must have been a trouble maker"

  24. Swab the door handle by aclarke · · Score: 1

    It seems like you and your poster children have missed the "swab the door handle" comment. The police are allowed to knock on your door and politely ask you for something. IANAL, but I'm sure they're also allowed to swab your door handle as it's on the OUTSIDE of your house. If they find the DNA on the door handle, it would be easy to get a warrant based on that evidence.

    1. Re:Swab the door handle by goodmanj · · Score: 1

      I'm the original poster: glad you see what I did there. IANAL either, but I bet taking material from the outside of someone's house won't pass constitutional muster either, though it's much murkier than demanding a cheek swab.

      I'll be honest here and say that I didn't intend for this to be a totally realistic scenario... just one with enough truth to scare y'all. Think of it as the Slashdot equivalent of a spooky campfire story.

    2. Re:Swab the door handle by squiggleslash · · Score: 2

      An outside door handle that anyone could have touched you mean? I think I spot the problem with using the presense of DNA on the door handle as evidence of, well, anything...

      --
      You are not alone. This is not normal. None of this is normal.
    3. Re:Swab the door handle by LordLimecat · · Score: 2

      Slashdot doesnt need more wild hysteria.

    4. Re:Swab the door handle by RockDoctor · · Score: 1

      If they find the DNA on the door handle, it would be easy to get a warrant based on that evidence.

      Which is why you took your gloves off before touching the door. Or you put them on, depending on which way you want to do the containment. Either way would work, but one carries evidence of forethought and planning.

      --
      Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
  25. You forgot to mention the Agent Provocateurs by Marrow · · Score: 1

    You forgot to mention the undercover police or agents hidden among the people who were intentionally arousing tensions to provide the excuse for a crack-down.

  26. I hate you. by WOOFYGOOFY · · Score: 1

    I spray you with guilty DNA. Stage a robbery. Call the cops.

    just replace "I" with whoever it is you least trust.. the government, the government when dealing with Julian Assange or like case, businesses dealing with employees they think might become whistleblowers ... just use you imagination. We all know what people are capable of...

    It's time for us all to become a lot more skeptical of the seemingly "definitive" information made available to us via technology. Basically, be highly skeptical of any technology used to convict that seems iron clad IF ONLY everyone is being truthful. You don't need proof to suspect manipulation, it should be the default assumption which needs to be overcome.

    Only in this way will society develop systems that don't rely for their veracity on the presence of zero people of ill will somewhere in the chain of events.

  27. Re:Mixed feelings, dye packs are fine. But this? by kannibal_klown · · Score: 1

    To play devil's advocate I can see one logical reason

    By using the x-million (or whatever) combinations of the DNA sequence it acts like a barcode. So just because you have some random DNA sludge on you from one place doesn't mean you have it from the place they're looking at.

    With chemicals you're limited in the combinations. Sure you can have chemical markers like most of the chemical products out there have (this % of inert compound is batch A, % of that inert compound is batch B%). But if you're talking about a thin film of chemicals surviving on a person for a few days... who's to say the Mass Spec readings won't be tainted by exposure to every day stuff (soaps, detergents, cooking ingredients, fertilizer, etc).

    So with the chemicals, a few days later you find a guy and can say in the report: he has enough of the "base" on him to say he was exposed to BrandX chemical marker, unfortunately we can't say with enough certainty that it was from BuildingY because the mass spec is getting lots of different readings

    With DNA, you can say "OK, we found a fair amount of this DNA marker from sweat-swabs, and said marker does not appear to exist in nature. So he was at least in BuildingY and got hit with the BrandX chemical marker at some point.

    I'm not saying I agree with DNA-laced film vs compound, or even this whole "fog" concept in general. Just saying, there's at least one valid reason.

  28. Re:Good movie title by linear+a · · Score: 1

    The fog rolls in a changes your DNA and you go from being a person to a thing while you try devour the L.A pretty people. FTFY

  29. Splendid by BenBoy · · Score: 1

    Just splendid -- giant mutant criminals. What say we just pelt them with radioactive spiders and have done with it?

  30. Re:Why use DNA? by slew · · Score: 1

    Because there happens to already be a cheap way of amplifying a small sample of DNA for identification (PCR).
    Most other easy to manufacture serializable microscopic substances mostly suffer from dillution/detection problems.

    The technique is to use junk DNA encoded with a serial number. DNA are the is the microscopic grains and PCR is the way to quickly do the detection if a specific serial number is present (although PCR isn't yet as simple as a swab).

    Presumably you could spend years doing revolutionary nobel prize winning research and replace DNA with another chemical that had an even cheaper way of detection for this niche application, but someone who worked for Applied DNA Sciences might instead think about just using DNA and an existing nobel prize winning PCR test and get something to market faster.... Just say'n... ;^)

  31. Prior art by PPH · · Score: 1

    Rottweiler DNA in the bite marks in burglars' asses.

    --
    Have gnu, will travel.
  32. Re:I "tag" all my property with my DNA.... by fazey · · Score: 1

    do your sperm travel in single file?

  33. Re:I "tag" all my property with my DNA.... by kelemvor4 · · Score: 1

    do your sperm travel in single file?

    Only when sufficiently beaten into submission.

  34. Why start there? by plover · · Score: 1

    Seriously, UV dye taggants have been around for decades. You sprinkle fairy dust on the stuff you don't want touched, then UV shine the people who might have touched it. If their fingers glow, they're a suspect; you have probable cause to check them for stolen property. But if they go home and wash their hands, that means you failed to catch them in the act and you suck at your job as a security person.

    Being near the ventilation system outlets, or washing the clothes of a warehouse employee, or of sitting next to him on the bus, or standing in line at McDonalds when he sneezes, all those sound like ways to spread the DNA tags. It'll be meaningless fast, if it can prove nothing conclusively.

    --
    John
  35. False positive by manu0601 · · Score: 1

    What about people that have been in contact with the tagged person? I guess they will carry some tagged DNA as well. How false postiive are avoided?

  36. Re:"Brigands" by radarskiy · · Score: 1

    My god... you've invented competitive hippy punching!

    Science. It works, bitches.

  37. Re:DNA Fog Helps Identify Trespassers, Thieves, an by RockDoctor · · Score: 1

    "SmartWater" I thought, but with a considerably larger potential range of "bits" to set and so a larger address-space.

    --
    Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"