The significance of this particular story is that a thin, attenuated light echo was used to locate a supernova that is no longer visible. APOD has had far more spectacular light echoes but usually you can plainly see the primary source of the echo at the center since they are only a few years old. In this case the echoes they found were hundreds of years old- thin expanding rings of reflected light hundreds of light years in diameter- with centers that were completely dark. The echoes were only found serendipitously using digital image processing during a search for something else (dark matter).
While it wasn't a supernova, the January 2002 flash from star V838 Monocerotis in the Milky Way made a nice, photogenic light-echo quite recently. The star, its flash, and the subsequent light echo are interesting for several reasons:
1. The reason for the flash remains unexplained by theory, and the star has been posing problems for theorists ever since. Stars that make problems for theorists are always interesting. 2. Although the flash was not a supernova, it made V838 Mon the brightest star in the entire Milky Way for a few days. The star's normal intensity was about 1 Sun, but at its peak the brightness was equivalent to 600,000 Suns. (For comparison, Rigel shines with the light of 40,000 Suns, and Deneb, one of the most powerful Milky Way stars known, shines with the light of up to 250,000.) But the flash was not a supernova (not bright enough) nor a nova since the star did not lose its outer envelope. The star swelled to a huge size (it would have reached the radius of Jupiter's orbit) and remained cooler at its surface than it had been before the flash. 3. The star has a lot of interstellar dust surrounding it for light-years in every direction, which makes for good pictures as the light-echo from the flash widens and illuminates successive rings of dust around the star. (In any light-echo the rings are circular paraboloids, really, centered around the star-earth line, with the star at the focus of the paraboloid. The light echo you see is effectively reflecting off a huge "parabolic mirror" made of dust and pointing at you.) 4. V838 Mon is in the Milky Way (only 20000 light years distant) so we can get better pictures of its light echo than the light echos associated with any recent supernovas. (The closest recent supernova was SN1987A and that was in the LMC, not the Milky Way.) People discovered this thing only a few days after it happened and we now have a sequence of very nice shots covering it at all times starting at the very beginning of the echo.
V838 Mon has been featured on APOD eight times since 2002. Its light echo is now 8 years in diameter and is still vividly lighting up successive rings of crap in the vicinity of the star. There are many animations of the echo on the web but look for the more newer ones since they have more frames that include observations from 2004-2005.
No widely accepted theory has succeeded in explaining the exact mechanism that caused the flash but astronomers generally agree that V838 Mon is a member of a new class of variable star that has been seen only twice before: M31-RV, a red variable in Andromeda that had a flash in 1989, and V4332 Sagittari, a red giant in Sagittarius that flashed in 1994. Current ideas include both cannibalism of a binary companion and planet swallowing.
I've always wondered what huge companies get by turning over data to the Feds. Companies never do anything to "make the world a better place" unless they are getting something in return... reduced regulation? maybe tax reductions?
Maybe the Patriot Act, the very same law that makes it a crime for the phone company to tell anyone about it when it happens.
There used to be one on our street like that (in NJ). Its opening was announced every year in the newspapers and in the churches, and people would come from miles away to parallel park in front of our driveways. We called it "The Monstrosity". This guy had an entire "winter wonderland" in his backyard with a lighted path that you would walk around in. Everything was there- primitive animatronics, blinking colored lights of all sorts, and hundreds of hand-painted plywood cutouts of elves and Snow White and the seven dwarves and Bambi and various other Disney characters (recycled from school plays at the local Catholic schoool I think). There was a life size talking Santa at the beginning of the lighted path telling people to enjoy themselves and stay on the path as they went through, and at the end of the path there was a GIFT SHOP in his basement to defray his electric bill I guess since they weren't charging admission.
I don't live in that neighborhood anymore but my parents say it stopped in recent years since the guy was starting to get too old for it. (Either that, or Disney's lawyers got wind of his plywood cutouts.) You could walk by and see them starting to erect all this crap in September, and after Christmas they were in their back yard taking it all down until well into March! It was a half-year operation every year. Something about Christmas makes people lose their minds.
Actually they don't. One says the Christian god found in the bible, and the other said that some intelligent being. There is a VERY BIG distinction in that.
But it isn't a relevant distinction. I couldn't care less if this "intelligent being" is your Christian God or an Anonymous Coward God. It is obvious to anyone familiar with this debate on either side that this "intelligent being" crap is a sly reference to the Christian God anyway, since that is the deity to whom the role of "intelligent designer" is always attributed outside the bounds of the theory. At least creationism was an honest hypothesis.
If you aren't smart enough to see that distinction then he really shouldn't reply to your post.
I'm not so foolish as to see any distinction that is relevant here. Neither theory is falsifiable, and neither one has any predictive power. The differences between them are only religious in nature, as you're angrily pointing out yourself! They are not scientific theories.
actually they aren't. One said we were created in 6 days by the Christian god. The other says that at some point in the time line an intelligent being had to be involved. Whether it was during a six day period or simply craeteing the gasses that started it all.
Why is the number of days a relevant distinction? Both theories say that "God did it" with no supporting evidence.
I guess when your theories aren't even remotely provable (since we can't exactly fly around the universe and run tests on the present, much less on the past)
WTF? We aren't physically flying around the universe like Buck Rogers when we do it, but we do "run tests on the past" just by performing spectroscopic analysis on light from distant sources.
As has been pointed out before... who needs an extension to the PATRIOT act, when the President can just issue an executive order?
This is the rhetorical question that was posed by judges on the FISA court in recent days. They don't seem to realize the importance of PR. If your actions are made legal, there are positive PR consequences to be had!
"A new robot can recognize the difference between a mirror image of itself and another robot that looks just like it.... The ground-breaking technology could eventually lead to robots able to express emotions."
My dog sees herself in the mirror and thinks it's another dog. Then she expresses emotions to the other dog. Dogs are clearly way ahead of robots. You can buy a robot that vacuums the floor, but you won't find one that poops on the floor.
The whole issue here is that these are taps that do involve foreign communications.
Your claim has been thoroughly debunked. The law doesn't stipulate that only one end of the conversation has to be foreign and the other can be a domestic tap on a US citizen. Both ends must be foreign for this to be legal. FISA specifically states that the president can authorize a warrantless order only if there is "there is no substantial likelihood that the surveillance will acquire the contents of any communication to which a United States person is a party". US Code Title 50, 1802.
The whole issue here is that these are taps that do involve foreign communications. The other end of those foreign communications is here in the US. Communications with foreigners, overseas, is a foreign wiretap. The fact that a specific person/group that is already a known affiliate of, for example, Al Queda, is the local end of that phone call, is what brings the intel people to ask for authorization to find out whether those two parties are having another round of calls like the ones that organized the 9/11 attacks.
Bullshit. (I put bold tags around the part of your argument that is presupposing a conviction or an omniscient chief executive.) If this were the case then they could just use a FISA or Title III warrant.
This is not an investigation into "known terrorist-affiliated US citizens" who are dialing Bin Laden's cellphone. At least several hundred US citizens are on this list at any one time and all international calls they make are tapped without a warrant. How do you think you get on this list? By being a "known terrorist"?
My guess is that your calls get tapped if you have purchased hummus in the past two months using a supermarket discount card!
And we're starting to see FISA judges resigning in protest as the NSA program has tainted the warrants granted by the FISA court.
Revelation of the program last week by the New York Times also spurred considerable debate among federal judges, including some who serve on the secret FISA court. For more than a quarter-century, that court had been seen as the only body that could legally authorize secret surveillance of espionage and terrorism suspects, and only when the Justice Department could show probable cause that its targets were foreign governments or their agents.
Robertson indicated privately to colleagues in recent conversations that he was concerned that information gained from warrantless NSA surveillance could have then been used to obtain FISA warrants. FISA court Presiding Judge Colleen Kollar-Kotelly, who had been briefed on the spying program by the administration, raised the same concern in 2004 and insisted that the Justice Department certify in writing that it was not occurring.
"They just don't know if the product of wiretaps were used for FISA warrants -- to kind of cleanse the information," said one source, who spoke on the condition of anonymity because of the classified nature of the FISA warrants. "What I've heard some of the judges say is they feel they've participated in a Potemkin court."
I would love to explain to you the problems with obtaining FISA warrants illegally using information on US citizens obtained via warrantless wiretap. But there is yet another Republican scandal I must be off to.
In its per curiam opinion, the court noted that in a previous FISA case (U.S. v. Truong), a federal "court, as did all the other courts to have decided the issue [our emphasis], held that the President did have inherent authority to conduct warrantless searches to obtain foreign intelligence information."
We're talking about the president's illegal domestic wiretaps here, not his legal foreign wiretaps.
I haven't read the '9/11 bills' in question, but I believe the parent poster is saying that one interpertation of them is that the president has this power.
Yeah, I know that's his point. If that's a correct interpretation, that they should be interpreted as giving the president dictatorial powers, then these statutes are illegal.
Gregory:...Why isn't this eavesdropping program consistent with that resolution?
Russ: "This is just an outrageous power grab.Nobody, nobody, thought when we passed a resolution to invade Afghanistan and to fight the war on terror, including myself who voted for it, thought that this was an authorization to allow a wiretapping against the law of the United States.
There's two ways you can do this kind of wiretapping under our law. One is through the criminal code, Title III; the other is through the Foreign Intelligence Surveillance Act. That's it. That's the only way you can do it. You can't make up a law and deriving it from the Afghanistan resolution. The president has, I think, made up a law that we never passed."
Did you RTFA or are you just here to dog Bush? The article mentions a variety of situation where taps might be needed and useful, but could not be used by FISA under the pre-emptetory clauses because it is not narrow enough.
(Needed + Useful) != Legal
On top of that, it clearly falls into line with the supreme court's standards for intellgence (must be linked to a foreign power) as well as historical executive orders issued by Clinton, Regean and Carter and even then can easily be read into the 9/11 bills.
You cannot make up new laws and "read them into" real laws that have actually been passed. Democracy doesn't work that way.
I learned assembler when I was 12 because the BASIC in the ZX81 was so horrible. (The processor was a Z-80, so ironically I was unwittingly being spoiled by Z-80 assembler- the 6502 instruction set was a rude surprise when I upgraded to the Commodore.)
All the games in the articles had a short description and then pages of numbers between 0 and 255 that you had to carefully type in (the Commodore articles later at least included CRCs). Most of the excitement came from just getting the numbers into the machine so you could save to tape before the machine crashed, since the connection to the 16k memory pack was so flakey- the contacts weren't gold plated and the heatsink inside the zx81 itself was just a little thin prong that rose up from the motherboard to the aluminum case lining. I found that leaving a ziploc full of ice cubes on top of a zx81 was a good way to increase the likelihood of success.
Serously though, Whatever happened to consumer responsibility? I personally never buy anything unless the price is pretty low and the seller has lots of feedback. Our society has become so dependent on the government and law enforcement to take care of our problems that we have been totally ignorant of how to protect ourselves. If eBay gains enough of a reputation for fraud, people will stop shopping there and they will loose enough business that they will have to do something.
Hello darjen
This is Bob Malda.
We are need to reverifying all our Slashdot accounts after server crash.
Please reply this post with password to verify identity or your accounts with us will be closed!
I bought a used 2001 Prius in great shape earlier this year for $13k (60k miles). It was being sold on Craigslist by a couple who were trading up to a newer model.
I seriously doubt the tribrid idea would fly... electric-drive hybrids run off batteries most of the time with the combustion engine kicking off only during strong-ish accelerations or when the batteries go below a certain point. Most of the time, the gas engine would not run long enough to release enough heat and generate usable amounts of steam.
This sounds completely backwards, at least for Priuses. The engine is on virtually all the time. It decides to turn itself off at red lights and in parking garages when I'm going 10 mph, but most of the time it's running at a stable rpm that doesn't change too much. During the first 5 minutes the car is in its warmup phase and I get 30 mpg, but after that I get 50. On the highway, the car is basically just powered by the engine alone. When I accelerate to pass somebody it uses the battery to assist.
The whole point is to buffer power output from the primary power source (the engine) so you can get the same performance from a smaller one. Energy is stored in the battery during times it's not needed and drawn from it during hard accelerations. The engine is decoupled from the constantly changing power demand- it runs at a relatively stable and efficient rpm and produces a relatively stable torque no matter what you're doing unless the computer decides to turn it off. A steam engine run on exhaust heat would be a great addition to a Prius.
Huh? The ad says "Anti-Bush Gifts and Gear". That doesn't strike me as a very credible news site.
Yes, because if someone doesn't like Bush (like 2/3 of us now), then up is down, black is white, and the sky is every color except the one they say it is.
Raw Story is well known to be a source of very early, unripe, possibly wrong information. It's raw, like the Drudge Report. But I check it all the time (rather than give hits to Drudge) because whenever a big story erupts I see it there first. It's a good site for the latest scuttlebutt. In this particular case there have been plenty of confirming sources during the past few days.
You saw "anti-Bush gifts and gear" and assumed the site is not credible because of a bias. Credible opinions are not necessarily "balanced". It's gotten to the point where editors at major newspapers are deliberately skewing stories to make them more "balanced" to please people like you. If I see "balance" in a story anymore I have to assume I'm being lied to.
A guy at work was always talking about using gummy bears to commit the perfect crime. You somehow make a mold of someone's fingerprint using that gummy bear material. Then you use it on a fingerprint scanner, which gets fooled by it, and it lets you in. Then, get this- you eat the gummy bear fingerprint mold, and permanently destroy the evidence of your intrusion.
I always thought that was a little disgusting. You mean you're just going to eat that thing right after you pressed it against a disgusting fingerprint scanner?
According to build 35.1 of GenBank and version 124 of dbSNP, the following 66 genetic polymorphisms have been found to occur within the 48 exons of IGF2R in humans:
(Sorry about the formatting; the lameness filter forced me to make it look like that.)
Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.) You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.
The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:
Interestingly, M6P/IGF2R in mice is imprinted in all tissues except for the brain where both alleles are expressed. It is highly expressed in neurons of the forebrain, with the highest expression in the pyramidal cells, the polymorphic layers of the hippocampus, and the granule cell layer of the dentate gyrus; regions involved in emotional behavior, information processing, and memory formation. These findings indicate that M6P/IGF2R may assist in the development of these brain functions. This postulate is reinforced by the identification of M6P/IGF2R as the first putative "IQ gene." By comparing children with an IQ of 160 or higher to those with an average IQ, M6P/IGF2R was shown to be linked with general cognitive ability ("g"). The role of this receptor in the development of cognitive function can now be systematically assessed with M6P/IGF2R conditional knockout mice.
As a black programmer with a Ferrari, I would dispute that. I would never build a supercomputer that could be taken out by a splash of acid.
I bet as a black programmer with a Ferrari, you must have to put up with a lot of attitude from racist white people and cops who assume you got it by embezzling half cents from your employer's payroll system. Otherwise they figure no black man would ever be driving around in such a nice car.
(BTW could you please post the code you used for the half-cent thing because I need to do some Christmas shopping.)
The significance of this particular story is that a thin, attenuated light echo was used to locate a supernova that is no longer visible. APOD has had far more spectacular light echoes but usually you can plainly see the primary source of the echo at the center since they are only a few years old. In this case the echoes they found were hundreds of years old- thin expanding rings of reflected light hundreds of light years in diameter- with centers that were completely dark. The echoes were only found serendipitously using digital image processing during a search for something else (dark matter).
While it wasn't a supernova, the January 2002 flash from star V838 Monocerotis in the Milky Way made a nice, photogenic light-echo quite recently. The star, its flash, and the subsequent light echo are interesting for several reasons:
1. The reason for the flash remains unexplained by theory, and the star has been posing problems for theorists ever since. Stars that make problems for theorists are always interesting.
2. Although the flash was not a supernova, it made V838 Mon the brightest star in the entire Milky Way for a few days. The star's normal intensity was about 1 Sun, but at its peak the brightness was equivalent to 600,000 Suns. (For comparison, Rigel shines with the light of 40,000 Suns, and Deneb, one of the most powerful Milky Way stars known, shines with the light of up to 250,000.) But the flash was not a supernova (not bright enough) nor a nova since the star did not lose its outer envelope. The star swelled to a huge size (it would have reached the radius of Jupiter's orbit) and remained cooler at its surface than it had been before the flash.
3. The star has a lot of interstellar dust surrounding it for light-years in every direction, which makes for good pictures as the light-echo from the flash widens and illuminates successive rings of dust around the star. (In any light-echo the rings are circular paraboloids, really, centered around the star-earth line, with the star at the focus of the paraboloid. The light echo you see is effectively reflecting off a huge "parabolic mirror" made of dust and pointing at you.)
4. V838 Mon is in the Milky Way (only 20000 light years distant) so we can get better pictures of its light echo than the light echos associated with any recent supernovas. (The closest recent supernova was SN1987A and that was in the LMC, not the Milky Way.) People discovered this thing only a few days after it happened and we now have a sequence of very nice shots covering it at all times starting at the very beginning of the echo.
V838 Mon has been featured on APOD eight times since 2002. Its light echo is now 8 years in diameter and is still vividly lighting up successive rings of crap in the vicinity of the star. There are many animations of the echo on the web but look for the more newer ones since they have more frames that include observations from 2004-2005.
No widely accepted theory has succeeded in explaining the exact mechanism that caused the flash but astronomers generally agree that V838 Mon is a member of a new class of variable star that has been seen only twice before: M31-RV, a red variable in Andromeda that had a flash in 1989, and V4332 Sagittari, a red giant in Sagittarius that flashed in 1994. Current ideas include both cannibalism of a binary companion and planet swallowing.
I've always wondered what huge companies get by turning over data to the Feds. Companies never do anything to "make the world a better place" unless they are getting something in return... reduced regulation? maybe tax reductions?
Maybe the Patriot Act, the very same law that makes it a crime for the phone company to tell anyone about it when it happens.
There used to be one on our street like that (in NJ). Its opening was announced every year in the newspapers and in the churches, and people would come from miles away to parallel park in front of our driveways. We called it "The Monstrosity". This guy had an entire "winter wonderland" in his backyard with a lighted path that you would walk around in. Everything was there- primitive animatronics, blinking colored lights of all sorts, and hundreds of hand-painted plywood cutouts of elves and Snow White and the seven dwarves and Bambi and various other Disney characters (recycled from school plays at the local Catholic schoool I think). There was a life size talking Santa at the beginning of the lighted path telling people to enjoy themselves and stay on the path as they went through, and at the end of the path there was a GIFT SHOP in his basement to defray his electric bill I guess since they weren't charging admission.
I don't live in that neighborhood anymore but my parents say it stopped in recent years since the guy was starting to get too old for it. (Either that, or Disney's lawyers got wind of his plywood cutouts.) You could walk by and see them starting to erect all this crap in September, and after Christmas they were in their back yard taking it all down until well into March! It was a half-year operation every year. Something about Christmas makes people lose their minds.
It's ok, Alberta still has 4.7 billion barrells of oil left to power our retarded Christmas lights.
The U.S. uses 21.93 million barrels of oil per day, of which 13.21 million barrels is imported.
4.7 billion barrels / (13.21 million barrels / day) = 355 days
If we imported all our oil from Alberta we would run out 10 days before Christmas.
Actually they don't. One says the Christian god found in the bible, and the other said that some intelligent being. There is a VERY BIG distinction in that.
But it isn't a relevant distinction. I couldn't care less if this "intelligent being" is your Christian God or an Anonymous Coward God. It is obvious to anyone familiar with this debate on either side that this "intelligent being" crap is a sly reference to the Christian God anyway, since that is the deity to whom the role of "intelligent designer" is always attributed outside the bounds of the theory. At least creationism was an honest hypothesis.
If you aren't smart enough to see that distinction then he really shouldn't reply to your post.
I'm not so foolish as to see any distinction that is relevant here. Neither theory is falsifiable, and neither one has any predictive power. The differences between them are only religious in nature, as you're angrily pointing out yourself! They are not scientific theories.
actually they aren't. One said we were created in 6 days by the Christian god. The other says that at some point in the time line an intelligent being had to be involved. Whether it was during a six day period or simply craeteing the gasses that started it all.
Why is the number of days a relevant distinction? Both theories say that "God did it" with no supporting evidence.
I guess when your theories aren't even remotely provable (since we can't exactly fly around the universe and run tests on the present, much less on the past)
WTF? We aren't physically flying around the universe like Buck Rogers when we do it, but we do "run tests on the past" just by performing spectroscopic analysis on light from distant sources.
The environment gets C14 when cosmic rays interact with C12 in the upper atmosphere.
It's N14 the cosmic rays interact with, not C12.
As has been pointed out before... who needs an extension to the PATRIOT act, when the President can just issue an executive order?
This is the rhetorical question that was posed by judges on the FISA court in recent days. They don't seem to realize the importance of PR.
If your actions are made legal, there are positive PR consequences to be had!
"A new robot can recognize the difference between a mirror image of itself and another robot that looks just like it. ... The ground-breaking technology could eventually lead to robots able to express emotions."
My dog sees herself in the mirror and thinks it's another dog. Then she expresses emotions to the other dog. Dogs are clearly way ahead of robots. You can buy a robot that vacuums the floor, but you won't find one that poops on the floor.
The whole issue here is that these are taps that do involve foreign communications.
Your claim has been thoroughly debunked. The law doesn't stipulate that only one end of the conversation has to be foreign and the other can be a domestic tap on a US citizen. Both ends must be foreign for this to be legal. FISA specifically states that the president can authorize a warrantless order only if there is "there is no substantial likelihood that the surveillance will acquire the contents of any communication to which a United States person is a party". US Code Title 50, 1802.
Bullshit. (I put bold tags around the part of your argument that is presupposing a conviction or an omniscient chief executive.) If this were the case then they could just use a FISA or Title III warrant.
This is not an investigation into "known terrorist-affiliated US citizens" who are dialing Bin Laden's cellphone. At least several hundred US citizens are on this list at any one time and all international calls they make are tapped without a warrant. How do you think you get on this list? By being a "known terrorist"?
My guess is that your calls get tapped if you have purchased hummus in the past two months using a supermarket discount card!
And we're starting to see FISA judges resigning in protest as the NSA program has tainted the warrants granted by the FISA court.
I would love to explain to you the problems with obtaining FISA warrants illegally using information on US citizens obtained via warrantless wiretap. But there is yet another Republican scandal I must be off to.
In its per curiam opinion, the court noted that in a previous FISA case (U.S. v. Truong), a federal "court, as did all the other courts to have decided the issue [our emphasis], held that the President did have inherent authority to conduct warrantless searches to obtain foreign intelligence information."
We're talking about the president's illegal domestic wiretaps here, not his legal foreign wiretaps.
Yeah, I know that's his point. If that's a correct interpretation, that they should be interpreted as giving the president dictatorial powers, then these statutes are illegal.
Footage here.
"Wisconsin Democrat Russ Feingold wants to be President, and that's fair enough."
This is where I stopped reading.
Did you RTFA or are you just here to dog Bush? The article mentions a variety of situation where taps might be needed and useful, but could not be used by FISA under the pre-emptetory clauses because it is not narrow enough.
(Needed + Useful) != Legal
On top of that, it clearly falls into line with the supreme court's standards for intellgence (must be linked to a foreign power) as well as historical executive orders issued by Clinton, Regean and Carter and even then can easily be read into the 9/11 bills.
You cannot make up new laws and "read them into" real laws that have actually been passed. Democracy doesn't work that way.
Kids today have it easy.
I learned assembler when I was 12 because the BASIC in the ZX81 was so horrible. (The processor was a Z-80, so ironically I was unwittingly being spoiled by Z-80 assembler- the 6502 instruction set was a rude surprise when I upgraded to the Commodore.)
All the games in the articles had a short description and then pages of numbers between 0 and 255 that you had to carefully type in (the Commodore articles later at least included CRCs). Most of the excitement came from just getting the numbers into the machine so you could save to tape before the machine crashed, since the connection to the 16k memory pack was so flakey- the contacts weren't gold plated and the heatsink inside the zx81 itself was just a little thin prong that rose up from the motherboard to the aluminum case lining. I found that leaving a ziploc full of ice cubes on top of a zx81 was a good way to increase the likelihood of success.
Serously though,
Whatever happened to consumer responsibility? I personally never buy anything unless the price is pretty low and the seller has lots of feedback. Our society has become so dependent on the government and law enforcement to take care of our problems that we have been totally ignorant of how to protect ourselves. If eBay gains enough of a reputation for fraud, people will stop shopping there and they will loose enough business that they will have to do something.
Hello darjen
This is Bob Malda.
We are need to reverifying all our Slashdot accounts after server crash.
Please reply this post with password to verify identity or your accounts with us will be closed!
P.S. Word "lose" has one o
I bought a used 2001 Prius in great shape earlier this year for $13k (60k miles). It was being sold on Craigslist by a couple who were trading up to a newer model.
I seriously doubt the tribrid idea would fly... electric-drive hybrids run off batteries most of the time with the combustion engine kicking off only during strong-ish accelerations or when the batteries go below a certain point. Most of the time, the gas engine would not run long enough to release enough heat and generate usable amounts of steam.
This sounds completely backwards, at least for Priuses. The engine is on virtually all the time. It decides to turn itself off at red lights and in parking garages when I'm going 10 mph, but most of the time it's running at a stable rpm that doesn't change too much. During the first 5 minutes the car is in its warmup phase and I get 30 mpg, but after that I get 50. On the highway, the car is basically just powered by the engine alone. When I accelerate to pass somebody it uses the battery to assist.
The whole point is to buffer power output from the primary power source (the engine) so you can get the same performance from a smaller one. Energy is stored in the battery during times it's not needed and drawn from it during hard accelerations. The engine is decoupled from the constantly changing power demand- it runs at a relatively stable and efficient rpm and produces a relatively stable torque no matter what you're doing unless the computer decides to turn it off. A steam engine run on exhaust heat would be a great addition to a Prius.
That, and an odometer that uses Nixie tubes.
Huh? The ad says "Anti-Bush Gifts and Gear". That doesn't strike me as a very credible news site.
Yes, because if someone doesn't like Bush (like 2/3 of us now), then up is down, black is white, and the sky is every color except the one they say it is.
Raw Story is well known to be a source of very early, unripe, possibly wrong information. It's raw, like the Drudge Report. But I check it all the time (rather than give hits to Drudge) because whenever a big story erupts I see it there first. It's a good site for the latest scuttlebutt. In this particular case there have been plenty of confirming sources during the past few days.
You saw "anti-Bush gifts and gear" and assumed the site is not credible because of a bias. Credible opinions are not necessarily "balanced". It's gotten to the point where editors at major newspapers are deliberately skewing stories to make them more "balanced" to please people like you. If I see "balance" in a story anymore I have to assume I'm being lied to.
How many Oracle licenses did you sell them this time?
A guy at work was always talking about using gummy bears to commit the perfect crime. You somehow make a mold of someone's fingerprint using that gummy bear material. Then you use it on a fingerprint scanner, which gets fooled by it, and it lets you in. Then, get this- you eat the gummy bear fingerprint mold, and permanently destroy the evidence of your intrusion.
I always thought that was a little disgusting. You mean you're just going to eat that thing right after you pressed it against a disgusting fingerprint scanner?
<meta http-equiv="Keywords" name="Keywords" content="lol this is not a search engine optimization">
rs_number|alleles|position (on chromosome 6)
rs8191692 C/T 160360652
rs2975115 C/G 160360684
rs2975116 C/G 160360687
rs8191704 A/G 160382749
rs11759563 C/T 160416104
rs8191746 C/T 160416109
rs8191753 A/G 160418673
rs8191754 C/G 160418735
rs8191758 A/G 160421034
rs8191763 C/T 160424152
rs1570070 A/G 160424389
rs13198308 C/T 160432052
rs8191776 A/C 160434644
rs6413489 A/G 160434696
rs894817 A/G 160434700
rs8191797 A/G 160437232
rs1050004 A/G 160437257
rs8191798 A/G 160437267
rs998075 C/T -160438689
rs6413491 A/G 160438720
rs8191808 C/G 160439921
rs8191809 A/G 160439953
rs8191810 A/G 160439956
rs8191819 A/G 160441967
rs8191820 C/T 160441987
rs8191840 C/T 160452138
rs8191842 C/T 160453003
rs8191843 A/G 160453053
rs8191844 C/G 160453340
rs2274850 C/G 160450541
rs2230043 A/C 160454948
rs8191859 A/G 160455901
rs8191860 A/G 160455961
rs2230048 A/T 160459759
rs8191869 A/G 160459815
rs8191881 C/T 160463358
rs8191886 A/G 160464245
rs2230044 A/G 160464245
rs629849 A/G 160464820
rs11552587 C/T -160465339
rs1050005 C/G 160465360
rs8191904 A/G 160471039
rs8191905 A/G 160471123
rs8191906 C/T 160471223
rs8191908 A/G 160471609
rs2230049 C/T 160471684
rs614754 C/G -160475610
rs1805075 A/G 160475618
rs8191933 C/T 160487883
rs3190229 C/T 160487892
rs1803989 C/T 160487892
rs8191955 C/T 160496427
rs8191956 C/T 160496750
rs8191957 C/T 160496859
rs8191958 A/G 160496868
rs8191959 A/G 160497049
rs8191960 -/ACAC 160497143
rs8191961 A/G 160497202
rs3832385 -/TTTG -160497316
rs8191962 -/ACAA 160497322
rs8191963 C/T 160497586
rs1050015 A/C 160497591
rs8191964 C/T 160497662
rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
rs8191966 A/G 160497672
rs14531 G/T 160497919
(Sorry about the formatting; the lameness filter forced me to make it look like that.)
Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.
The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:
Tissue-Specific Inactivation of Muri
As a black programmer with a Ferrari, I would dispute that. I would never build a supercomputer that could be taken out by a splash of acid.
I bet as a black programmer with a Ferrari, you must have to put up with a lot of attitude from racist white people and cops who assume you got it by embezzling half cents from your employer's payroll system. Otherwise they figure no black man would ever be driving around in such a nice car.
(BTW could you please post the code you used for the half-cent thing because I need to do some Christmas shopping.)