Slashdot Mirror


User: bgarcia

bgarcia's activity in the archive.

Stories
0
Comments
690
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 690

  1. VPND on Open VPNs On Unix That Support Windows Clients? · · Score: 5
    I've been using vpnd for over a year now, and it has been extremely reliable and should be very secure (can you say "576-bit blowfish encryption?).

    It is meant more to connect two subnets, rather than a single device to a network. Also, it does not run on windows. However, you can do what I do, and resurrect an old 486 to act as a gateway/firewall/vpnd server at home, and hook your windows box to it.

    It is setup to re-establish broken connections. Even though I often lose connectivity between work and home, as long as the downtime is less than a tcp timeout, all of my tcp connections over the encrypted channel will actually remain up! Very nice.

  2. Re:This Is Ridiculous on FSF Proposes .gnu TLD To ICANN · · Score: 1
    Can you imagine the outrage if someone proposed .msft? .att? .sun?
    Outrage?!? Hell, I'm all for it! What the hell purpose does .com serve nowadays? Absolutely nothing. The same company ends up buying foo.com, foo.net and foo.org anyways. When I type a URL in my web browser, I never bother typing the .com anymore.

    I think allowing arbitrary top-level domains would be the best thing.

  3. Re:One or two (or three) non-buttons ? on Possible Pics Of The New Apple Mouse · · Score: 3
    Apple did a bag o' research that showed that mis-hits were common amongst users learning new tasks. The solution? The double click. Imagine life without the double-click...
    Imagine it? I live it! My linux box requires absolutely no double-clicking whatsoever.

    Double-clicking has to be the dumbest thing ever invented. Every time I try to teach someone who is new to computers (as in, has never used one before), the one thing that they find impossible to do is double-click.

    "Now click twice on the picture there. Yes, move the mouse over top of it, then click the mouse button twice. No, your clicks have to be a little faster than that. Ok, that was better, but you have to try really hard not to move the mouse at all while you're double-clicking or it won't register. I know you tried to hold it still, but it moved a little."
    Once people have acquired the ability to double-click, the next big problem is that they have no idea when to double-click and when to single-click! I can't tell you the number of times they've opened two windows, or started two copies of some application, because they double-clicked when they only had to click once. This is a problem that would not happen if two mouse buttons were used instead.

    I didn't realize that double-click was invented for Macs. I guess if you only have one button, its a way to keep the user from having to use the keyboard, but it's not as easy as simply having a second button on the mouse.

  4. Re:remeber a day on Pete Townshend On Lifehouse, The Net, And Pirating · · Score: 2
    As I'm sure you know, the concept you are suggesting is commonly known as "communism", whereas I am avocating "capitolism".
    Wrong, wrong, wrong.

    This is not a disagreement over fundamental social policies. What the above poster is saying is that ideas, software and the like have no scarcity problems like most other goods and services. That is, in order for me to get it, nobody else has to loose it.

    If I want a CD, WalMart has to part with it.

    But if I want a song, nobody else has to lose their song. A copy can be made for extremely low or no cost.

    Now, you can argue that you have the right to attempt to make money off of your Intellectual Property. But people who don't believe this are not communists. Indeed, they are actually much closer in their beliefs to the founders of the United States of America than you are.

    Remember, human beings hate to be forced to do things, and any system which tries to control them or limit their rights will inevidably (sp) fail.
    If there's one thing that capitalists hate to do, it is to part with their own money when they believe they shouldn't have to.

    Intellectual Property is an attempt to limit the rights of people in order to create profits for the Corporation^H^H^H^H^H^H^H^H^H^H^HArtist. Yes, the inventors/creators usually like to have some control over their invention so they can profit from it, but the copyright laws in this country are way, way out of control and not at all what was originally envisioned or intended.

  5. The answer: 18! on How Many Frequency Bands Are There? · · Score: 1
    How Many Frequency Bands Are There?
    According to my research, there are 18.
  6. Re:I'll try to answer. on Nike Gets Sued Over Nike.com Hijack · · Score: 1
    I would say the differences is that a gun is a weapon and a car is a tool made for transportation.
    So where do you draw the line? What if it was a nail gun instead of a pistol? A nail gun is actually a tool that's meant to be used in construction, but if you put it up to someone's head and pull the trigger, it would easily kill them.

    Just something else to think about...

  7. ISP's supporting this? on 16 Cell Phones In Parallel Net Access · · Score: 4
    Even if you can afford this car, don't you also need an ISP who has the hardware/software to multiplex the 16 separate phone connections back into a single connection?

    I didn't see this part of the project discussed at Tom's Hardware. I would think that this would be the major stumbling block.

  8. Alternate root DNS servers? on Afternic Sues ICANN, Claims Unfair Treatment · · Score: 2
    So, what's to stop me from running my own root DNS server, that would handle my own made-up TLD's (.biz, .xxx, .scl), and send any request for a real TLD to a real root DNS server?

    Anybody who runs a DNS server, and wishes to, could configure their name server to view my server as the root.

    Then, I could implement whatever policy *I* feel is appropriate for handing out domain names (People Eating Tasty Animals gets priority, BTW).

    I know that most people wouldn't use these servers (businesses, for example), but I bet someone could get a good underground following going (imagine a .sucks TLD - http://peta.sucks/).

    So, why hasn't anybody else done this? Why couldn't I do this?

  9. Re:What exactly this Human Genome is at this point on Human Genome Project Believed Complete · · Score: 2
    TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT
    I read this and all I saw was:
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA

  10. Re:Poppycock on Is The x86 Obsolete? · · Score: 2
    1> Write an emulator in C (since there are more machines that you can target with C than there are x86-es).
    This is exactly the approach that Java is supposed to provide.

    And it is proving to be popular. However, it's going to be quite a while before someone writes a Java/C interpreter/compiler/emulator/translator that can provide a good enough environment in which to produce something like Quake VIII.

    Even the guys at Transmeta don't get it.
    No, they do get it. They know that the market is ready right now for the technology that they're providing. Java, on the other hand, is relegated to the non-gaming segment until more advances can be made to the technology. But you're right - this is the approach of the future. It will become more and more mainstream.
  11. Re:Sorry, but I don't see that this is very useful on Berlin 0.2.0 Released · · Score: 1
    Please don't put MS Windows in there. Windows has been pixel-independant from way back as far as I've known (back to the 3.0 days) and maybe even further. Yes, you can still use pixel alignment...
    And apparently many application developers do.

    Or is there another mechanism that causes text to get cut off and missplaced in some applications when you switch to large fonts? I've had little pop-up windows with a "continue" button, where that button was pushed off the bottom of the (non-resizable) window due to my choice of larger font size, and therefore I couldn't even click it!

    Whether or not MS Windows is pixel-independant or not, there are a lot of applications that can't seem to handle a fontsize different from the default.

    I am making the assumption that this would not be a problem under Berlin, but I could be mistaken.

  12. Re:Sorry, but I don't see that this is very useful on Berlin 0.2.0 Released · · Score: 4
    Their Berlin vs X document makes a big thing of pixel independence, but I see this as a disadvantage. Present displays, and future ones for that matter, still have pixels that are big enough to see...

    I also worry a bit about the CPU/GPU overhead of all this stuff...

    Actually, your comments have made me realize why Berlin is a good thing!

    Think of Berlin as something that is rather useless right now, given current hardware constraints, but will become a very nice graphical interface once we have monitors with pixel spacing more comparable to paper.

    Given a future world where such hardware exists, it's easy to see where current windowing systems (X and MS Windows in particular) are woefully inadequate. Anyone who has a high-end monitor and has set the resolution to something like 1600x1200 knows what I'm talking about. All the fonts are way too small. So then you go and change the default font size. *Then* you find out that there are a lot of application developers who never tested their applications with a larger font size.

    Berlin will be a good basis for a future windowing system. It's time will come.

  13. Re:Think Conservation and Energy Efficiency on Will The Power Grid Fail? · · Score: 3
    Were everyone to put a panel or two on their rooftop, you'd knock off your own reliance on the grid and reduce demand.... you don't even have to do all that much or give up anything you're used to.
    I have family who live out in the country in Colorado. There are absolutely no utilities to their house, so they have solar panels for electricity, and solar water heaters, etc. I was able to see what's actually involved with owning such a setup.

    First of all, there is a huge up-front expense for installing solar panels. Several thousand dollars. So I wouldn't say that you aren't giving up anything.

    Secondly, there are the maintenance costs. These things can and do break (if not the panels themselves, then the supporting electronics), and you as the owner would have to have them fixed. And given the extremely low demand for people who fix solar electrical systems, you can bet that it costs an aweful lot to have someone fix it for you.

    Lastly, electricity from even a government-imposed monopoly is just so damn cheap, relative to all the alternatives. Solar power is just not a really good alternative yet. Hopefully the technology will continue to be developed, and those with lots of disposable income and an environmental bent will continue to test and improve it.

  14. Proving you're Canadian on iCraveTV To Relaunch · · Score: 2
    I'm interested to see how they'll make sure I'm Canadian through software.
    Before entering this site, please answer the following question.

    Are you or have you ever been a citizen of Canada, and are you accessing this web site from within the borders of Canada, member of the British Commonwealth?

    1. Yes.
    2. No.
    3. That's a confusing question, eh?

  15. Did you ever think... on English Researchers Find Extra-Terrestrial Water · · Score: 2
    ...that maybe there was water on the meteorite because after it landed on earth, it probably

    GOT RAINED ON A FEW MILLION TIMES?!?!?!?!

  16. Re:getting rid of telemarketers on On DDoS, SPAM, Telemarketing And Harrasment? · · Score: 1
    actually, it's pretty easy. do not hang up, do not yell, do not curse... very nicely say "please put this number on your company wide 'do not call' list".
    I had a company calling me about once a week to take some survey about what radio stations I listen to. I participated the first time, I think I even participated a second time, but when they called the third time, I was getting annoyed with them. I asked them (nicely) to remove me from their list.

    I was called again anyhow, and repeated my request to be removed from their list. They called yet again, at which point I let the guy have an earful.

    I haven't had another call since, and it was a strangely therapeutic way of handling the situation. :^)

  17. Re:Funny... on Proposal For Open-Source Benchmarks · · Score: 4

    He has a point about... wait a sec... Jon, is that you?

  18. Carrying a weapon????? on Showdown With The Pinkertons · · Score: 2
    "If you see these immediate warning signs," WAVE America will announce, "violence is a serious possibility":
    • carrying a weapon
    You've got to be kidding me! So, the fact that I was on my High School's rifle team means that I would have been reported as a person where violence was a "serious possibility"?!?!

    • enjoying hurting animals
    And where does this end? When I was a kid, I was constantly running around the yard with a magnifying glass looking for insects. I "hunted" field mice and rabbits in my mom's garden with a BB gun. And, though I'm not proud of it, I remember conducting "experiments" to see if cats really did always land on their feet (no permanent damage to any cats - it must have become dizzy from all the spinning and finally landed on its back on the last attempt).

    But I have never even been in a fight, let alone blown up a school or execute classmates. This is just incredible. I would hate for my son to be classified like this. Home schooling is looking better and better...

  19. What price for hardware? on Meeting With Netpliance · · Score: 1
    Everyone seems to be throwing around guesses for how much the hardware should sell for. I think this is the question that needs to be asked of them!

    At what price can you sell just the hardware and remain profitable?

    Then we could give them a better idea of how many people would still be interested in buying these things without ISP service.

  20. Re:Let it die!!! on New AmigaOS On Top Of Linux · · Score: 1
    And the OS had nothing to do with it?
    Again, I said mostly about the hardware. What was so cutting-edge about AmigaOS? And I don't mean compared to DOS, compare it to all OS's available at the time.
    You are presupposing that they will fail. Why?
    A number of reasons:
    • The current track record of companies attempting to resurrect the Amiga name.
    • The failure for the current Amiga-name owner to announce anything earth shattering technically speaking.
    • The fact that the company is relying on the Amiga name to sell something that, in all likelyhood, will NOT be backwards-compatible. And if this is the case, and you DO have something technically earth-shattering, then why not give it its own name and let it stand on its own merits?

  21. Re:Let it die!!! on New AmigaOS On Top Of Linux · · Score: 1
    Once again another lamer who thinks there is no Amiga community left...
    Ooo, no. I have no problem with the community, or with Amiga machines. I have problems with companies buying the rights to the Amiga name and slapping it onto some software/hardware that doesn't stand a snowball's chance in hell of being as original and technically cutting edge as the original Amigas.

    Sorry if I didn't make that clear.

    Didn't mean to call ya a lamer, but you really are up for a good flamin',
    Of course you meant it! You dweeb! Don't flame someone, then back off! Continue onward firing all barrels until the target is annihilated!!

    I'll let it go this time, but you better brush up on your flaming techniques before posting again on slashdot. :^)

  22. Let it die!!! on New AmigaOS On Top Of Linux · · Score: 3
    The Amiga was (and in some ways, continues to be) a great machine. And although it had some great cutting-edge software, it was mostly about the hardware.

    Running something built on Red Hat Linux running on commodity PC hardware might make for a real nifty Linux machine, but it still won't be an Amiga. Although the article makes it sound like this is just a development platform, I can't imagine that any new platform could actually regain the glory that the original had.

    Let the Amiga die with some dignity!

  23. Re:AOL? AOL? on Corel To Launch Linux PCs With Intel · · Score: 4
    AOL is WinWare, and the last time I checked, with no intention to ever support Linux.
    Don't bet on it. AOL hates the fact that their prime competitor MSN (Microsoft Network) is owned by the same company that makes the Operating System their software requires. MSN gets bundled with every copy of Windows, and AOL has to kiss Microsoft butt to make sure their software is bundled with every copy of Windows too. And still, when you start up Internet Explorer for the first time, it asks if you want to join the Microsoft Network.

    If AOL can sell their software on a Microsoft-free computer, then that's one less competitor they need to worry about

    In fact, most Linux users wouldn't touch AOL with a ten-foot pole.
    True, but Linux users aren't the intended consumers of AOL PC's. These things will be aimed at the people who currently use AOL, WebTV, etc. I just hope Corel and KDE are up to the task of making Linux easy enough for these people to use.
  24. Re:How Silly on Web Censors Prompt College To Consider Name Change · · Score: 2
    I currently live in Beaver County (which is outside of Pittsburgh), which has it's own Community College of Beaver County. There is also a Big Beaver Falls School District.

    I grew up attending Hempfield Area Senior High School, although interestingly, kids never seemed to make fun of that name.

    Sorry, but it seems silly to rename a school simply because people might make fun of it. Can you imagine everyone named Dick or Randy deciding to have their names changed? If all the Dicks in the world can live with it, then I think a college can certainly live with it.

  25. Re:Better Way Still on DoubleClick Taken to Court · · Score: 3
    We should setup a network of DNS resolvers (DNS nameservers that just resolve addresses) that have alternate entries for the hosts of ad servers.
    If you don't want to figure out how to setup BIND to do this, you can do this very easily using DNRD.

    Just setup a machine to act as the DNS server for your little network (or for your friends, or the whole internet - I wonder if it scales well?) and put those ad site (127.0.0.1) entries into the server's /etc/hosts file. Also, make a directory called /etc/dnrd (owned by root). Then run dnrd like so:

    dnrd -s
    Any entries in the server's /etc/hosts file will be answered by dnrd. Anything not found there will be forwarded to the real dns server.