That "carbon dating" thingie is not, contrary to the flawed slashdot headline, what is usually meant by "carbon dating." Specifically it doesn't involve radioactive decay, unlike C14 dating. Funny thing, that radioactive decay. It's completeley random, yet incredibly accurate.
If more scientists where researching ALL possible leads to how the earth was created instead of spending all their time proving evolution correct,
The origin of the earth is studied by geologists, physicists and astronomers. Evolution is the subject of biologists. I'm not sure how much that would help anything if biologists dropped their microscopes all of a sudden and took up astronomy.
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
Oh yeah? Not even the theory of gravity? Or the theory of heliocentrism? What about atomic theory? And quantum theory? Way wacky, as theories goes. Yet black body radiation wouldn't be possible if it weren't true. Don't know what that means? Okay, look at that box under your desk; that computer you used to post your nonsense, how well do you think it would work if quantum theory weren't fact?
WTF are you talking about? Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism? For heliocentrism, we have probes and satellites taking nice pictures. For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory? Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect? What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection? And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
I think it was coined by Alfred Sauvy in the '50s. The third estate was, in the Ancien Régime, whoever was not part of the Nobility or Clergy; a mere 99% of the population. The Third World was whoever wasn't in NATO or Warsow Pact (nothing to do with New World / Old World).
There is no upgrade path to IPv6. As you just implied, it "just" takes everybody switching... and it doesn't make sense for anyone to switch until then. So nobody does.
Seriously, that's not the point. Everybody does that, because that's what you have to do; but trust me, for having dealt with the low level stuff of VoIP, this is a major pain in the ass. And that DHCP server is a major spof. Pof pof.
Have your fridge respond to SNMP queries and return temperature, power consumption, and so on. A monitoring system could record and make sense of this data to optimise power consumption and so on.
Palin is the candidate of the Republican party. The party that has been in power for the last 8 years and is responsible for MASSIVE, illegal surveillance. So we might be reading her mail now, but they've been reading all of ours.
There's really only one way. Before your trip to the Land of the Free®, backup your data, wipe your laptop's HD clean, install a decoy OS. When you are inside the US, connect to your VPN and download what you need. When you're about to leave, backup through VPN, reformat your HD, reinstall decoy OS. That's the only way. Wait, there's another one: stop doing business with the US.
You can do port forwarding without NAT. And he's wrong, nothing's preventing you from doing NAT on IPv6, except that it's probably never been implemented since it's kinda pointless.
And nobody's preventing you to use NAT, except that you might have to code it yourself. Me I'm on IPv6 thanks to my ISP (Free.fr) having implemented it; but there isn't much to do there.
Chief comes from latin for head; the chief proponent is the top proponent, the head of the beast. Even hydras don't have 155 heads. And being a promotional tool is more bottom than top. But that's just me.
Can a black hole have a charge?
on
LHC Success!
·
· Score: 1
Again, supposing it's not radiated away in a flash, could a charge black hole interact in some way? Or does having photon being stuck inside keep them for interacting through anything but gravity?
Not sure if it's actually true, but here's what the author is saying. Say you have GCC5.2 installed, and you're compiling GCC5.3 from source. It will compile gcc53a from the 5.3 sources with the GCC 5.2. It will then use gcc53a to compile gcc53b, and gcc53b to compile a gcc53c. 53b and 53c should be equal (but not 53a with either).
Also he said support was crucial for his company. If something went down, he wanted to be able to call someone immediately. He couldn't afford to just post a question on a message board and hope someone replies. He wanted contracts with 3rd party support that had experience with similar huge enterprise systems that he had.
RedHat is more than happy to take your cash, and offer 24/7 support.
What's with this "message board" bullshit? This guy is just a moron, or trying to rationalize the perks he gets from having his company buy MS. Yes, newsflash: those big companies pay bribes. I've seen it happen, not with MS but with a company closely related to it.
The right way to go about this is to use TAI for internal computations, and merely *display* UTC, so that when you want to measure the duration of an event, you just compute time_end-time_start. This does not work with UTC. Yet many brain dead systems do that, and apparently, if I'm not mistaken, every Linux distro.
Slashdot Mirror
That "carbon dating" thingie is not, contrary to the flawed slashdot headline, what is usually meant by "carbon dating." Specifically it doesn't involve radioactive decay, unlike C14 dating.
Funny thing, that radioactive decay. It's completeley random, yet incredibly accurate.
If more scientists where researching ALL possible leads to how the earth was created instead of spending all their time proving evolution correct,
The origin of the earth is studied by geologists, physicists and astronomers. Evolution is the subject of biologists. I'm not sure how much that would help anything if biologists dropped their microscopes all of a sudden and took up astronomy.
Very distantly related AFAIK.
And it's not secret.
Your nitpicking is as useless as it's wrong.
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
Oh yeah? Not even the theory of gravity? Or the theory of heliocentrism? What about atomic theory? And quantum theory? Way wacky, as theories goes. Yet black body radiation wouldn't be possible if it weren't true. Don't know what that means? Okay, look at that box under your desk; that computer you used to post your nonsense, how well do you think it would work if quantum theory weren't fact?
It's obviously the work of the devil.
WTF are you talking about? ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
For heliocentrism, we have probes and satellites taking nice pictures.
For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA
Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
And members are bound by treaty to abide by its rules.
Also, water wet. Fire hot. Pain hurts.
I think it was coined by Alfred Sauvy in the '50s. The third estate was, in the Ancien Régime, whoever was not part of the Nobility or Clergy; a mere 99% of the population. The Third World was whoever wasn't in NATO or Warsow Pact (nothing to do with New World / Old World).
There is no upgrade path to IPv6. As you just implied, it "just" takes everybody switching ... and it doesn't make sense for anyone to switch until then. So nobody does.
Seriously, that's not the point. Everybody does that, because that's what you have to do; but trust me, for having dealt with the low level stuff of VoIP, this is a major pain in the ass. And that DHCP server is a major spof. Pof pof.
Have your fridge respond to SNMP queries and return temperature, power consumption, and so on.
A monitoring system could record and make sense of this data to optimise power consumption and so on.
Spying is done by the executive, not the legislative.
Palin is the candidate of the Republican party. The party that has been in power for the last 8 years and is responsible for MASSIVE, illegal surveillance. So we might be reading her mail now, but they've been reading all of ours.
Anonymous is dead. I saw his tomb. He was a soldier.
There's really only one way. Before your trip to the Land of the Free®, backup your data, wipe your laptop's HD clean, install a decoy OS.
When you are inside the US, connect to your VPN and download what you need.
When you're about to leave, backup through VPN, reformat your HD, reinstall decoy OS.
That's the only way.
Wait, there's another one: stop doing business with the US.
You can do port forwarding without NAT.
And he's wrong, nothing's preventing you from doing NAT on IPv6, except that it's probably never been implemented since it's kinda pointless.
And nobody's preventing you to use NAT, except that you might have to code it yourself.
Me I'm on IPv6 thanks to my ISP (Free.fr) having implemented it; but there isn't much to do there.
War criminals.
The rules are pretty clear.
Chief comes from latin for head; the chief proponent is the top proponent, the head of the beast. Even hydras don't have 155 heads. And being a promotional tool is more bottom than top. But that's just me.
Again, supposing it's not radiated away in a flash, could a charge black hole interact in some way? Or does having photon being stuck inside keep them for interacting through anything but gravity?
Not sure if it's actually true, but here's what the author is saying.
Say you have GCC5.2 installed, and you're compiling GCC5.3 from source.
It will compile gcc53a from the 5.3 sources with the GCC 5.2. It will then use gcc53a to compile gcc53b, and gcc53b to compile a gcc53c. 53b and 53c should be equal (but not 53a with either).
Also he said support was crucial for his company. If something went down, he wanted to be able to call someone immediately. He couldn't afford to just post a question on a message board and hope someone replies. He wanted contracts with 3rd party support that had experience with similar huge enterprise systems that he had.
RedHat is more than happy to take your cash, and offer 24/7 support.
What's with this "message board" bullshit? This guy is just a moron, or trying to rationalize the perks he gets from having his company buy MS. Yes, newsflash: those big companies pay bribes. I've seen it happen, not with MS but with a company closely related to it.
Why, do you like wasting money or are you simply a masochist?
The right way to go about this is to use TAI for internal computations, and merely *display* UTC, so that when you want to measure the duration of an event, you just compute time_end-time_start. This does not work with UTC. Yet many brain dead systems do that, and apparently, if I'm not mistaken, every Linux distro.
At least that's what this guy does. I know, he's a pain the ass. You know, he's been right every time so far.