Slashdot Mirror
Review of Discovery Institute's Evolution Textbook
Darwinned writes "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school. Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning. 'The book doesn't only promote stupidity, it demands it. In every way except its use of the actual term, this is a creationist book, but its authors are expecting that legislators and the courts will be too stupid to notice that, or to remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.'"
Evolution is a subject now? :P
"
remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion
"
Can someone post a reference. I suspect any actual rulings will be somewhat more nuanced than that broad statement.
1 - In The Beginning...
2 - The Great Flood (Where are all the Unicorns?)
3 - Jesus, Dinosaur Wrangler
4 - Darwin, What a Jerk.
5 - The Scientific Method - Hooey or Baloney?
"The book doesn't only promote stupidity, it demands it."
What were people expecting? A book made by stupid people to promote intelligence?
In the US, its not fashionable to know math or science. It's not fashionable to work hard. 'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).
Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else. God forbid we ask these delicate flowers to do more than the minimum.
Prosperity is being taken as a birthright. I half wonder if the outcry against illegal aliens is due to the fact that these people work hard. The complainers may one day be expected to. Can't have that!
Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want. We've been fighting this battle since the first caveman got brained by his devout brethren for dissing the volcano god. We'll never win. Might as well leverage the ignorance of the masses somehow, like Elmer Gantry.
What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.
As I understand science, it's a cycle: observe, explain, hypothesize, test; and repeat. Evolution as a theory, holds to this cycle. But Intelligent Design is just: observe and explain- the explanation being essentially "God did it." There's not much reason to keep examining things when you feel you've reached that stage, is it? It's an intellectual dead end.
If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like. When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).
are you suggestion that there is any occasion where it is proper to diss the volcano god?
What the hell is wrong with you- do you want to be responsible for the entire town burning down?
don't you care about your neighbors or family at all?
dang- move far away from everyone before you say anything like that again please.
every day http://en.wikipedia.org/wiki/Special:Random
Let the wingnuts in Kansas and other red states teach creationism or any other loony idea they want and let those of us who are in the blue states teach real science and math and critical thinking skills and let's see which population is more successful in our knowledge based economy 10 - 20 years down the road. Let the free market decide, as they say, with one condition. Let's do away with welfare and let the religious nut jobs who aren't interested in teaching science, math and critical thinking reap what they sew.
Intelligent Design... "Science you must believe in"
(and if you disbelieve, they will burn you at the stake.)
Simple fact is, an extensive elaboration on, say, the Copenhagen Interpretation versus the Everett Interpretation, -even were one demonstrated false-, would not "promote stupidity", much less "demand" it. Simply having to follow the arguments to critically evaluate the question at hand, -even if 100% of the students thus rejected ID-, would do nothing but increase the students familiarity with the biological questions at hand, and challenge them to be able to analytically utilize them.
However, this last statement does strike me as fully representative of the overall politicalization of the question the reviewer engages in throughout (at least he explicitly states he's doing so, justifying it by saying it's "where ID started", even though that's false in ID's case, it started with Behe publishing a book on biochem and its implications on evolutionary theory), and the overall tinge of a kind of deep defensive bias the piece reeks of.
Particularly funny was the part where he chides the book for not anticipating evidence that he presumes of-course will be found, which is basically tantamount to concluding a particular sub-issue on the basis on -no present evidence-, something he'd never let ID get away with.
Standard straw-man of representing ID as simply the most easily-dismissed notion of "Creationism" of anyone on the planet, standard ignoring of the fact that "evolution happens" is not actually debated by anyone advocating ID, and his particular meaning equivocating it to "only evolution happens" is fully scientifically untestable, and will never change from being untestable, and that desire to conclude such causal exclusivity for the -actual- motivation at hand is simply a non-sequitur, even were it testable.
The main thing that bothers me is the cultural framework this creates of closing science into dogma. Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.
Anyway, I'm heading out for the weekend, so I doubt I'll be able to follow up to any replies right away. Since Natural Selection will inevitably take care of my response for me, though, I won't worry about it too much. Later.
~ Whence do you come, slayer of men, or where are you going, conqueror of space?
Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
(YEC for short)
There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.
Sadly in places people defend your ignorant view. As if there's a middle road here. "Teach both", or "there's room for more then one theory".
Evolution is one of the cornerstones for modern biology. You don't want it taught even though it has withstood over 100 years of scrutiny and is incredibly accepted by the scientific community? Why? Because you don't understand it most likely.
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
(YEC for short)
Perhaps. At least the YECers have the balls to believe in something which is not only demonstrably inane, but has been disproven many times. Those OECers simply relegate their creator to misty Planck times. I call that moving the goalposts to a spot where they do no one any good whatsoever.
I saw a t-shirt the other day that said:
SCIENCE
It Works, Bitches!
I thought it was funny...
"I might have made a tactical error in not going to a physician for 20 years." -- Warren Zevon
WTF are you talking about? ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
For heliocentrism, we have probes and satellites taking nice pictures.
For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA
Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?
The Slashdot blurb implies that the review shows the book to be "chock full of bad science", yet I didn't get that impression from the review.
The first section of the review dealt with politics, not science.
The second section claimed that the "scientific community" overwhelmingly accepts evolution.
Finally on the second page of the review, the implication is made that it's unscientific to be precise about definitions ("neodarwinianism") since the rest of the community prefers the term "evolution" (which is a VERY plastic term that can mean almost anything depending on who you talk to and what part of the sentence just came out of their mouth).
The next "unscientific" claim the review "refutes" is the idea of common descent. Well, duh! That IS the issue, isn't it? "You don't accept my science therefore your claim is unscientific." Pfft.
Then the review objects to the book's criticizing the views of scientists with whom the reviewer doesn't agree anyway. The reviewer claims that the book is using these examples of molehills to build mountains. Maybe, but is it a "chock-full" of "bad science" to criticize faulty viewpoints?
Then the review seems to find fault with the book for calling attention to real controversies in biology, as if that's playing unfairly.
The review even seems to claim that although we still, after 150 years, have limitations in our fossil record, it's a "bait and switch" to mention therefore that some scientists doubt that the fossil record supports common descent.
The review seems to take offense for the book's claim that Darwin's "Tree of Life" has in recent years come to look more like an orchard of bushes. As I understand the state of the fossil record, the book is more correct on this point than is the reviewer. The review also seems to claim that cladistic trees match molecular trees, which I am quite confident is not the case (read an article on that just the other day - sorry, don't recall the citation).
The review downplays the significance of the Cambrian Explosion, claiming that to look at it the way the book does is faulty. And one of the reviewer's arguments is that the sudden appearance of the bat is offset by the sudden appearance of an earlier bat. What?!
The review takes offense at Behe's "irreducible complexity", claiming that at least three scientific papers have refuted Behe. I'm a little familiar with those claims; those claims don't convince me (particularly since they've not been demonstrated, but merely are "just so" stories that "might" be how it happened).
Don't get me wrong; I'm not saying the book is good, or bad; I don't know; I haven't seen it myself. But I definitely get the impression that this review is more an emotionally-charged response to a challenge to a religiously-held belief system. The battle-cry of "bad science" is just a banner under which the faithful will be expected to gather.
You should desire to really inform those who are getting taught his crap. Realize that the ID/Creationism movement is from the adults - they just force the (idiotic) ideas on the children who have no say in the matter, and are confused enough as is. Hey, if an adult tells them that's how the world works, the'll believe it. Better that the kids are taught the real-deal so that this stuff isn't propagated to their children's children's children.
If "red state" values dominate, who gets elected? who runs this place? who tells YOU how to live your own life?
Think of the children?
I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum. There are lame attempts and arguments that go along the line of we want to be "balanced", but, frankly, creationism is not accepted science (it doesn't even come close to science). It's great to debate these things (it broadens our minds), but schools should teach fact; not conjecture.
Evolution is not "fact" either (although the accumulated data supports the theory). If another theory comes along that explains the data better, then Darwin's theory will be superseded. This is how science works. Teaching crackpot "theories" in schools doesn't end up making people more objective. I would suggest that it teaches them to be more stupid. Teach critical thinking. Don't teach things that are not falsifiable. It's easy.
It's not a debate it's arguing absurdity.
The Riddle of Epicurus
~~~~~~~~~~~~~
If God is willing to prevent evil, but is not able to
Then He is not omnipotent.
If He is able, but not willing
Then He is malevolent.
If He is both able and willing
Then whence cometh evil?
If He is neither able nor willing
Then why call Him God?
~~~~~~~~~~~~~~
Back on topic, the Discovery institute is dedicated solely to enriching its members, any other claim is nonsense.
A learning experience is one of those things that say, 'You know that thing you just did? Don't do that.' - D. Adams
Because you don't understand it most likely.
... he understands only what those "religious leaders" with an agenda want him to understand (nothing, in other words) and he doesn't want to question their authority and learn more on his own. I mean, how many people of faith do you know that are convinced that the Theory of Evolution teaches how life was created and thus detracts from the glory of God? Darwin's Theory says nothing about the origins of life, it only predicts how life changes over time. Yet that single misunderstanding is at the center of much of the hate and discontent.
That's most likely true
Then, of course, there are the even more ignorant types that just can't stand the thought that humans are nothing but slightly-more-evolved monkeys.
The higher the technology, the sharper that two-edged sword.
Financial crisis? Blame the Negro! The colored people did not pay back their mortgages (mortages mandated by Bill "Blow Job" Clinton). Because the banks were forced to loan money to Negroes, when the Negroes failed to make their mortgage payments, the banks began to suffer.
The Negro and the pro-Negro agitators are the heart of the banking crisis.
Do NOT vote for Negroes!
(pun intended)
i don't think you are going to find much support for this textbook on slashdot
however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism
there's a lot of issues in this world where all you can do is whine and bitch and moan, and are otherwise helpless to effect change. this is not one of those issues
ALL of these creationist initiatives are happening on state and local levels. you CAN do something about it if you live in one of these areas
if you do live in an area creationists are making headway, do something about it, please. if for nothing than else than simple civic pride, that the residents of your {state/ town} are not all ignorant buffoons, that some of you actually understand the value of a critical mind, and even more importantly, understand the value of an involved electorate and citizens active for causes they believe in
how is it possible that such idiots can get creationism in our schools? because THEY GET INVOLVED
there are too many voices here on slashdot that will speak loudly about right and wrong, and never actually get involved to make sure their government stands up for that
please, do not feed me the standard psychological lines of learned helplessness that convinces you you can effect no change on this issue or that issue. on creationism, on a state and local level, you CAN do something about this. you SHOULD do something about this. DO IT
if not you, who?
intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
Except evolution can be proven: scientists regularly evolve new lines of insects, bacteria, and other rapidly reproducing forms of life. Applying the same concepts to life all over the world is just taking a sufficiently large step back so that you can see the bigger picture. Examining the world and coming up with natural explanations that can be experimentally tested is the very essence of the scientific method, which makes it perfectly appropriate to teach in a science classroom. I would support discussing creationism in a science classroom too, but only to teach children why it's not a scientific theory.
Don't confuse evolution with abiogenesis, and take a read through Evolution as theory and fact.
This isn't like comparing the Copenhagen Interpretation and the Everett-Wheeler-Graham model, this is like comparing the Copenhagen Interpretation and Scientology. Not only does ID make claims about edge cases that, with further investigation, are found to support the standard model of natural selection, but ID doesn't even serve its original purpose. It isn't even Biblically supported: ID contradicts the fundamentalist reading of Genesis just as systematically as the standard models.
Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.
Not only can you propose that, but there is active research into the existence of complex extraterrestrial life on Earth (by looking for evidence of life in the interior of meteorite fragments), in the solar system (pretty much every probe sent to Mars and quite a few other places has included experiments looking for evidence of life), and beyond (not just project SETI, but things like research into the possibility of the intelligent origin of pulsars... before we figured out what they were).
Good idea. Some other theories we might as well throw out while we are at it: gravity, circuit theory, plate tectonics, control theory, general relativity ect...
The lesson for this semester, will be an extraordianary example of how people can be full of shit. Notice how there arguments don't fit together and that when you boil it all down and examine it, basically they are saying " Poof and it was there". Basically they are saying David Blaine is god and created the Universe.
Let's compare this with a book by Charles Darwin called "Origin of Species"....................
He who said 1,000,000 monkeys on 1,000,000 typewriters would eventually type the great novel, never saw an AOL chat room
No one can prove Evolution nor can anyone prove Creation.
Er, considering evolution has been observed (yes, including new species creation), I don't know how much more proof you need. Of course, creation as described in the Bible has zero observable evidence.
Unless you mean human evolution, and yes, barring a time machine, we can't directly observe pre-humans changing into humans. We can only look at the mountain of fossil evidence showing clear pre-human bones that bear no resemblance to anything else except humans. But I suspect that no amount of evidence is good enough for you.
Sometimes it's best to just let stupid people be stupid.
This story from the Seattle-area satire paper The Naked Loon seems relevant: Discovery Institute Takes on Gravity Myth
Do not read this sig.
Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.
This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.
If you mod me Overrated, you are admitting that you have no penis.
I subscribe to the Creation theory.
No, you do not. You subscribe to an unsupported and unsupportable myth, and see nothing wrong with your personal mythology being taught to children as established fact. That makes you not only ignorant, but dangerous. Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.
We'll see how your faith holds up when the lights go out for good. Civilization is fragile. Believe it.
The higher the technology, the sharper that two-edged sword.
Before the mindless pro science zelots go off on their little snits.
I will state the simple truth. There is no creditable evidence for creationism and it can not be taught in school as a theory of equal standing with Evolution.
But this little bit from the story makes my blood run cold as well.
"The scientific community has very valid reasons for accepting evolution as an accurate description of the history and current development of life on earth,"
Yes this is right.
" reasons that are so so compelling that aspects of the theory can be safely treated as fact."
NO! NO! NO! NO!
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
In science every theory is disposable. Newtons theory of gravity worked for a long time but we had to toss it when it started to fail. It wasn't the truth. It was the nearest that we could get to the truth at that time.
Evolution right now is the closest we can get to the truth at this time. We are refining it all the time and hopefully getting closer and closer to the truth.
And please quite calling the people that believe in it stupid. Frankly most of the people that will post how stupid they are have just about the same depth of knowledge as the people that believe in creationism. They just have happened to have guess right in this subject.
See my blog http://ilovecookes.blogspot.com/ for light hearted technical information.
Years ago when Georgia was going through the ID vs Evolution in school issue I saw the national media on site at a high school ask a local student his thoughts. He responded that he wanted ID taught because he knew evolution was full of holes and he could disprove it himself.
Well step up young man and claim your Nobel prize that's waiting you.
Where did he get his (mis)information from? It's not the local drug dealers. It's not the science classes. It's not video games.
It's the churches.
There are many churches that deal in lies to peddle their agenda of pushing evolution out of the classroom. It's not a conspiracy theory it's a fact of life in this country.
If man came from monkeys why are there still monkeys? People ask that because they've been told that. They've been told that is a hole in evolutionary theory so they parrot it. They aren't told that at the drive through line at McDonalds. They are only told that type of information in religious circles.
I used to argue with Answers in Genesis for years. It was like pulling teeth trying to get them to remove content that was completely non-factual or completely taken out of context. Letter after letter would be sent with references to the correct information, but it would take months or years (or sometimes never) to get them to correct their website. Even though they updated their site regularly. There was no incentive for them to provide correct information because incorrect information is the only way they could build their case against evolution.
The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.
Mod parent up!!!
Its hard to be believe how ignorant people's arguments can be like the GP's. Or should I say, contradictory?
If evolution isn't provable, thats like saying any science shouldn't be taught because it's not provable.
"Creation theory subscribers" should just stop getting vaccines, using modern technology, etc etc :)
That would be very convenient for the creationists, because YEC is disappearing these days. The creationists have learned that if they make definite scientific statements (e.g, that the Earth is 6000 years old), they risk being proved wrong by scientific evidence. Instead, they've learned to say vague, fuzzy things about intelligent design, while avoiding making testable statements about facts.
Right, and those people aren't creationists. The wikipedia article gives a good definition of creationism: "Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities, whose existence is presupposed.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution.[2]" In other words, the commonly accepted definition of creationism is that it's in contradistinction to evolution, so the people you're describing, who accept evolution, aren't creationists. "Creationism" is just one of those words that doesn't mean exactly what you'd think it meant based on its etymology. For comparison, "communism" doesn't mean belief that people should live in communes, and a "Republican" in the US isn't defined as someone who's happy that our form of government is a republic.
Find free books.
Your ideas are intriguing to me and I wish to subscribe to your newsletter.
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)
Slashdotters, everyone else on the planet, and dictionary writers you mean...
Creationism Defined:
Some excerpts:
the doctrine that matter and all things were created, substantially as they now exist, by an omnipotent Creator, and not gradually evolved or developed.
Belief in the literal interpretation of the account of the creation of the universe and of all living things related in the Bible.
the literal belief in the account of Creation given in the Book of Genesis; "creationism denies the theory of evolution of species"
Huh? Name a time in history where this wasn't true? The best and brightest have been getting dumped on since time immemoriam (sp?).
I don't think this was true for most of history. I don't even think it was true for the early part of the 20th century. Doctors and scientists and engineers were admired or at least respected. In the 19th century, 'The Origin of Species' was a popular read. Don't forget the enlightenment, Confucius, the renaissance, the philosophers of Greece and Germany. In India and China, people work extremely hard to get into universities. It's the utmost honour to be the one from your villiage to get to go.
Since you seem like a friendly fellow I'll save you a little money. Every issue of the newsletter just contains the same two words, in large type on the front page, and nothing else.
If you mod me Overrated, you are admitting that you have no penis.
In my opinion, schools need to have a separate course on Culture. It should teach about different races and religious beliefs. Intelligent design should certainly be taught there, so that people understand and respect one another's beliefs. Currently, for every idiot who opposes evolution, there's another idiot who is unaccepting of religious beliefs. There are a lot of people who believe in a combination of evolution and intelligent design (myself included), and while the intelligent design aspect is in no way science, it is education.
"chock full of bad science and questionable reasoning"
Just the book I'd enjoy adding to a class so we could learn something about science and reasoning by tearing it apart together.
The Irish Rovers song doesn't count
That was a Shel Silverstein song, BTW.
-jcr
The only title of honor that a tyrant can grant is "Enemy of the State."
"... as evidenced by recent legislation mandating that it be taught in school. ..."
And I said "WHAT?"
So I clicked on the link... and it says "The US state of Louisiana has passed the 'Science Education Act,' a piece of legislation that could allow Intelligent design to be taught in schools."
And this is why we will never get anywhere trying to intelligently discuss anything; either about education, politics, any contentious issue... because I honestly believe that this is how "ScuttleMonkey" sees it; when people disagree with something, they paint it as the most extreme, worst exaggeration... it's not that I agree with it, this book, or ID, it's that people become blinded when they get "religious" about a topic (no pun intended).
Stupid sexy Flanders.
Ad- and marketing-driven economy is a big part of the problem, I think. It makes us lie to ourselves things are "free". Ain't nothing free, like all the wisemen and assholes alike say. one of the prices we pay is slow erosion in the culture.
Fuck systemd. Fuck Redhat. Fuck Soylent, too. Wait, scratch the last one.
Evolution in the broadest sense means change, it doesn't imply directionality in biology and it doesn't in a more general use of the word. Saying something is evolving backwards is like saying something is "changing backwards."
If a parent species of birds were to give rise to a new species of birds that were dumber, smaller, uglier, and/or shorter-lived, that wouldn't be de-evolution or evolving backwards, that would still be evolution.
Use your terms properly! What you mean is that you don't think you like what america is "evolving" into.
I think a different approach is required.
"Natural Formation", which is the best current understanding in the many fields of science that we use to understand our existence.
"Creationism", for those who think magic is involved.
It's irrelevant which creation myth you believe, as they all involve magic.
This is NOT a signature.
The problems in Georgia with South Ossetia and Abkhazia have their origin before 4004 BC. And the Georgians are (Orthodox) Christians for the most part.
From the summary:
It's only a hot topic here in the United States. In the rest of the civilized world, ID is dismissed as the nonsense it is.
This ain't rocket surgery.
Horse shit. Evolution is a provable scientific theory. Show me one other religion that meets that standard, please.
This ain't rocket surgery.
Aside from the amusing (and, I suspect, unintentional) contradiction between "observable evolution" and "species creation", this is incredible news of which I was unaware. What new species was observed emerging? When did it happen? This event really should resolve the question for creationists entirely.
We evolved in a world where it took about 20 hours/week to get everything we needed. People that bent their head down over a big leaf scratching symbols for very long got eaten by lions.
Pretty much, we're evolved to be beach bums, and all this 60 hour weeks doing the same thing in the same place all day long is a mental illness we only lapsed into in the last 10,000 years, a bare millesecond in evolutionary time.
I blame it on the women, myself - she kept complaining about the skin hut falling down until finally he got p'o'd and went figured out how to build with wood and stone just to get some peace.
But then he couldn't move the hut anymore, and he had to start planting grasses and tubers around the hut for food. Then his buddy's wife made him build a stone hut next door, then her friends got on their men, and pretty soon you had a town, and that was the end of the good old days...its been little pink houses ever since.
When the country falls into chaos, politicians talk about 'patriotism'. Lao-Tzu
Nonsense. Religion has, at its roots, beliefs that are accepted by faith--that God exists, that salvation is possible, etc. You can reason about derived doctrines, but in the end you are religious because you accept the basic premises on faith. That's the whole point of faith.
What the article says is that there are demonstrable reasons that are compelling, so compelling that they may be treated as fact. As compelling as the sky being blue. I don't believe that the sky is blue on faith; I believe it because the demonstration of looking up and seeing blue is so compelling that I call "the sky is blue" a fact, despite sometimes difficult philosophical arguments about skepticism and solipsism.
Evolution as a topic on /. depresses me so much because I see so many geeks, so many people who are theoretically well grounded in engineering and empiricism, make moronic equivalencies between religion and well established scientific theories.
Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
Add to that philosophy
the point of education is to inform and to teach reasoning skill. many many people believe in creationism in some form. evolution even fits into some peoples view that do fundamentally believe that something started all of this. what I find astounding is that we can't even broach the concept of god in our schools but, we must teach faggotry to the 5 year old children of christians. So beat your chests about how inappropriate it is to teach the philosophy of god in public schools. After all anyone that has read any of the history of this country knows we were founded by a bunch of hedonistic pagans that sat around performing acts of debauchery. I for one have never said evolution should not be taught but don't you even for a second demand i accept it as the universal truth. you want to cram your truth down my throat while decrying mine. your rationalization for shouting me out of the room is that I want to shove my beliefs down your throat? isn't the next logical step violence? it just kills me how humanist bullshit clings to "its" facts making it "correct" therefore anything that doesn't conform to it bullshit and can't be tolerated. bullshit is bullshit you want me to respect yours then you respect mine. the hysterical part of this whole discussion is if I don't buy your bullshit hook line and sinker you accuse me of be "intolerant".
Nonsense. Evolution has been "proven" to the satisfaction of the science community, just as much as heliocentrism or the theory of gravity--which is to say that falsifiable theories have been constructed that explain more data than previous theories, and will likely be refined or replaced with better theories in the future. In purely scientific terms, evolution is one of the safest bets around.
When (virtually) all the scientists studying evolution consider its basic premises to be proven, on what grounds can you possibly say they're wrong?
Anyone who loves or hates any language, platform, or manufacturer, doesn't know what they're talking about.
Serbs with their hateful xtian idealogy
You're wrong here, it was Catholic Croats collaborating with NAZIs who persecuted Orthodox Serbians. More recently the Albanians, especially the KLA, Kosovo Liberation Army, were persecuting Serbians and others. And the KLA deals in opium with an idea of a Greater Albania.
It's not just Serbians who are instigating violence.
Falcon
Should there be a Law?
From the New Scientist article linked from the Slashdot article:
WHAT THE LAW SAYS:
The state... shall allow and assist teachers, principals, and other school administrators to create and foster an environment... that promotes critical thinking skills, logical analysis, and open and objective discussion of scientific theories being studied, including, but not limited to, evolution, the origins of life, global warming, and human cloning. (Section 1B)
Gee, I see:
o promotes critical thinking skills
o promotes logical analysis
o promotes open and objective discussion of scientific theories
Wow, that is an intelligently designed policy.
Where's the part about mandating the teaching of Intelligent Design? Oh, I forgot, this is Slashdot. No need to RTFLaw.
Umm, the linked article says nothing about ID being mandated, it talks about legislation that would allow schools to teach it, not require them to do so. It's dumb legislation, but attacking intellectual dishonesty with more intellectual dishonesty doesn't really help your case.
Don't blame me; I'm never given mod points.
All the YEC apologists I've encountered believe in a deity who is incapable of deception. Their deity didn't make the world appear old even though it was young, they believe the earth IS young and all the science we rely upon is flawed.
The Pastafarians are the ones who claim the earth is young, but the FSM made it appear old.
Learn something new.
So the YECs are guilty of blasphemy then?
Believing that evidence is put in place by their God with the intent to deceive others is pretty much a slight against their God.
Nice! Now, what do they think should be done to blasphemers?
yes it is. geology 101 blows them out of the water. "looking old" has nothing to do with it.
If you mod me down, I will become more powerful than you can imagine....
The Bible uses the Hebrew word re'em for the Arabian Oryx, although this word may also refer to the Aurochs. The legend of the Unicorn probably originated in part from the Arabian Oryx, which when seen in profile frequently appears to have only a single horn. In the King James Version of the Bible the word "re'em" is translated as "unicorn"
http://en.wikipedia.org/wiki/Arabian_Oryx
I've met many creationists who, for example, thought that fossils were put there because of the flood and they just happen to line up in what appears to be a historical record because God is testing their faith.
If you mod me Overrated, you are admitting that you have no penis.
Um, yes it does. There is no detectible difference between the Earth being created billions of years ago out of the coalescing gas cloud surrounding the young Sun, and the Earth being created six thousand years ago in the exact state it would have been if it had been created billions of years ago out of the coalescing gas cloud surrounding the young Sun.
If you mod me Overrated, you are admitting that you have no penis.
Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.
This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.
If god created it to look older, then god is a liar.
I want someone to hit the nail on the head with creationisms, but no one seems to ever do that online so I'll give it my best shot.
/. of armchair intellectuals decrying the ignorance of the bible belt hicks, while smugly reassuring each other that they have the "best" ideology. It is through an understanding of their actions and why they do them and coming to terms with them. Calling their text book stupid isn't going to get them to stop. I don't know what the solution is, but I know what it isn't.
Evolution in no way denounces god. Even the Catholic church says the view science has on the universe and evolution are compatible with their faith: http://rellavent.blogspot.com/2008/09/catholic-church-acknowledges-evolution.html And it's pretty easy to reconcile the two: universe created in a big explosion that created light, land and heaven coalescing into stellar bodies, water and land separating as it cools, life slowly taking to the land, and man ultimately being removed from the bliss of the primordial garden by eating the fruit of knowledge. It's god, if evolution happened without his help at all, he set up the universe knowing full well what it would do. ID in the 6k year old vein makes no sense and actually is insulting to the power of god.
This brings up the problem of the creationists. Science as it is written, is not in that strong of a conflict with the bible as it is written, so why do they continue to push it?
we know the symptoms: text books, politicians, online spaming, but what causes the disease? Or to frame it in a more humanistic perspective: what do they gain by perusing their agenda? This should be the prime argument in creationism, not the symptomatic treatment that has been prevalent.
My theory is that creationism is viewed as being linked to a value system that creationists view as being under attack from secular radicals, and evolution is taken as a battle field to fight against this because Evolution is pretty removed from their day to day lives, if they chose to believe fantasy on it they wont hurt them selves like they would if they choose to believe fantasy about refrigeration. Basically they are picking ID as the place to make their stand to defend their way of life.
That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.
I know this from having been to several meetings. The atheist community is one of the most bitter and spiteful I have ever seen and actively wish to see all "non-rational" belief systems torn down and replaced with their "belief" system on a level that matches any religion. Pure tribalism at its best, two sets of group-think throwing stones at each other. the Atheists attack christen beliefs and they attack the atheists through ID.
The solution to the problem is not the one shown on
Your personal ignorance is your own right. But I will fight against your desire to spread your ignorance to the masses.
And I really don't care for nor want your respect.
Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)
Eventually your belief (the one about your invisible friend creating everything) will be challenged. Then you must move your goal posts or do what the "YEC" sheep are doing, cling to fiction and trying to force everybody else to accept their fiction.
But, until then, enjoy the comfort your beliefs bring to you.
When they used the term "sheep" in the bible, do you think the people penning it chuckled as they wrote it...
M0571y H@rml355.
Use. Fucking. Google.
Learn something new.
Could you please define "religion". I've got two definitions from Princeton:
"faith, religious belief (a strong belief in a supernatural power or powers that control human destiny) 'he lost his faith but not his morality'"
and
"organized religion (an institution to express belief in a divine power) 'he was raised in the Baptist religion'; 'a member of his own faith contradicted him'"
I'm afraid the Theory of Evolution by Natural Selection doesn't fall into either of those definitions. Evolution is used to describe the natural world, so the first definition is out, because that deals with the "supernatural". And the second definition is out, because evolution is not a divine power. It's not a non-divine power, either. It's simply a mechanism that explains the natural world as we can observe it.
Learn something new.
It's obviously the work of the devil.
that intelligent design and intelligent thoughts are parallel and not perpendicular thoughts.
WÌÌfÍ--ÍSÌÒÍ...Í...ÌHÌÍfÍÍÍ--ÍÍÍ
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.
Oh yeah? Not even the theory of gravity? Or the theory of heliocentrism? What about atomic theory? And quantum theory? Way wacky, as theories goes. Yet black body radiation wouldn't be possible if it weren't true. Don't know what that means? Okay, look at that box under your desk; that computer you used to post your nonsense, how well do you think it would work if quantum theory weren't fact?
what brought up respect have nothing but contempt for stupidity and you have demonstrated yours rather effectively
Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.
Whoa there !
We don't "know" anything of the sort. That is why we call it "The Dark Ages". It may disappoint you to learn that if it wasn't for the church, there would be no written records of most of our history before that. And by "our" I mean, in the west. I don't think they had a "Dark Ages" in India or China, so there goes your "human race" argument too. Where do you think all that knowledge of the past came from ?
And religion wasn't responsible for the breakdown of society either. It just so happened that the Romans went home. No-one else invaded for a while, so we all just did our thing. The Romans were the ones with all the inventions and organisation. No one else really saw the need. If you really look with open eyes, you'll find that religion has been the number 1 educator for almost all human history. They were the geeks of their time. If you needed an answer you went to the monastery and they gave you what knowledge they had. Of course it was religious, they're monks ! But they kept written accounts, learned mathematics, studied the skies. It's only in the last maybe 200 years that the masses were deemed worthy of reading and writing, and it's only really the last 100 years that anybody actually had the right to go to school.
No, I'm not religious. But science is about facts, not FUD.
There are now textbooks which solely and specifically go through all the errors and flaws in other textbooks. It makes for a superb recursive market, but not for a very coherent picture.
Personally, I would like to see a law in the US requiring that textbooks permissable as school texts (including private schools, but excluding specifically and explicitly religious texts) be peer-reviewed to the same standard as scientific papers, and that such reviews shall expire either after a fixed period of time (with the option of being re-validated) OR expired when there is general consensus within the field that a major theory has failed a critical test and been falsified within the range of conditions that would be addressed by the target school audience.
(I would not consider falsifying Hooke's Law outside the limits of elasticity or at levels of precision beyond the means of Junior High to measure to be significant. We know it's an approximation, we know why, and we know the scope over which the approximation is good enough to be useful. Put the caveats in as a footnote if you like, but you don't need to reject a useful approximation to such students simply because it isn't a useful approximation to others.)
Either that, OR require that all examinations in all schools (public and private) be peer-reviewed at that level of accuracy with zero allowance made for what the school chooses to teach. It comes to the same thing - the only way to pass is to exclude all teaching material that isn't as valid or better than the examination material.
(If examinations were changed, I'd also add in that the syllabus be made intentionally less specific. Tests should not be about how well children do at tests. They should be measures of how well the children understand the subject. Teaching to the test is the worst possible form of education. Well, second-worst. Teaching to the religion is the worst.)
It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
Although, as you say, such beliefs are not "disprovable", they do open up the realm for an infinite possibility of counter-beliefs, none of which are disprovable, and certainly unchallengeable should the ID/YEC believer insist his initial assumption be considered or believed.
For instance, I could say back to him, "Erm, no, actually *my* god created the Earth just last week. All your memories are false, and I have here a book which declares, above all, that you're a fucking idiot, and you can't disprove me because any evidence you might think you have found to the contrary has been put there in order to make this existence seem real."
Et cetera.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
Don't you mean it's not *TESTABLE* and therefore not science? There are some things that you can't disprove because they are true. YEC is indeed entirely unprovable, testable, disprovable, since it is just conjecture and fantasy.
You'd get a response like this:
"The rocks aren't really that old. They are made to look old by all humanly methods, including carbon dating. God is perfect and infallible, and has foreseen not only carbon dating, but any other future inventions that can check ages. By all human measurements, the rocks will appear to be hundreds of thousands of years old, although they are obviously not more than 4000 years old. You cannot disprove The Holy Bible by a mere technological invention."
The quotes are to clarify any problems with Poe's Law.
---
ECHELON is a government program to find words like bomb, jihad, plutonium, assassinate, and anarchy.
Evolution is happening, and if a person doesn't believe that,
Oh but at least some IDers admit evolution does happen, microevolution. But mcaroevolution doesn't. Still other IDers say evolution is directed by a superior intelligence. Or something like that.
Falcon
Should there be a Law?
Sorry, the correct term is "falsifiable". It means that an assertion has the logical possibility of being show false. In other words, if the assertion is wrong, can you show it to be wrong?
Creationism isn't falsifiable, because any piece of evidence can be explained with "God did it". Evolution is, for example if the Intelligent Designer suddenly showed up and announced himself.
"Testable" isn't really it, because that implies that it can not only be disproven but also proven. Generally scientific theories can't be proven, only fail to be disproven after many different rigorous tests.
If you mod me Overrated, you are admitting that you have no penis.
While unicorns aren't mentioned in any modern English-language translation of the bible, they are mentioned in the King James Version (a widely-read translation from around 1610). According to Wikipedia, unicorns are mentioned in the following places: Job 39:9-12, Ps 22:21, 29:6, Num 23:22, 24:8, and Deut 33:17. Noah and the flood are in Genesis, so all of these would be post-flood references. The translation of re'em as unicorn, however, would seem to be specific to the KJV.
-JS
Vanity of vanities, all is vanity...
I hate to break it to all the creationists and evolutionists, but *I* created the universe. If you have some way of proving me wrong, by all means go ahead. Otherwise, all you nonbelievers need to get with the reality that you are brainwashing your children into believing in a false version of life.
BTW, I also created life on Venus but it wouldn't stop nagging me about the bills, so I decided to go with Earth instead.
So by extension of your logic, any knowledgable person who contributes accurate information to wikipedia immediately becomes wrong retrospectively until the point at which that knowledge was first gained. Right?
Evolution has been singled out for special ire by Discovery, as it provides an explanation for the origin of humanity based solely on natural processes.
There's two claims here-- 1. Evolution is singled out. 2. It is singled out because it offers an explanation for the origin of humanity based solely on natural processes.
On the first:
William Paley predated Darwin. And, certainly Creationists have not in the interim ceased 'preaching' the same message which has gone forth since before either of them.
And, the second:
Does evolution really offer an explanation for the origin of humanity based solely on natural processes? If you really believe that, then ask yourself two questions. 1 - Where did the original matter making up the primordial soup (or the infinitesimally small mass before the big bang) come from? and 2 - What about these natural laws that seem to govern the universe which make natural processes possible?
And, even if evolution did offer this explanation, it is solely a conjecture that rebuffing evolution is ID theorists' sole motive in advancing their theory.
Why should I continue any further? I typically stop reading articles after the first few errant statements, but in this case, two are enough. Why should I waste any more time on this?
And what's wrong with saying something is changing backwards? People used to believe in teaching creation in schools. Then for awhile we didn't. Now there are some that want to go back to teaching it. If we are reverting back to a previous state, isn't that changing backwards? It's a useful phrase that concisely expresses the idea that change is not always progress.
We hope your rules and wisdom choke you / Now we are one in everlasting peace
There are many creationists that profess to believe that the earth was created to look old to test our faith. Hell, in my immediate family alone I can name a few.
We hope your rules and wisdom choke you / Now we are one in everlasting peace
That would be very convenient for the creationists, because YEC is disappearing these days.
You should probably clarify that by saying that these days YEC is disappearing from public. I'd be willing to bet that most people who claim to support ID deep inside are young earthers. They just see ID as a tool to get public opinion moving in the "right" direction.
We hope your rules and wisdom choke you / Now we are one in everlasting peace
The correct way to phrase it is as follows:
Science consists of two halves which combine in the "scientific method":
(i) A mathematical modelling half in which proofs are in the domain of logic and mathematics. The (entirely theoretical) models can be proven mathematically to be self-consistent or not, subject only to the constraints of Godel and the state of the art in mathematics; and
(ii) An empirical half in which predictive hypotheses generated from the above mathematical models are tested against physical reality through observation and measurement. Under specific conditions related to error bounds and other statistical properties, these measurement can unambiguously declare a hypothesis to be unsupported by observation, and therefore its associated model to be declared invalid.
When a model of Science has yielded a very large number of tested hypotheses but no observation has yet managed to invalidate it, it is then tentatively elevated to the exhalted heights of a Theory of science. But it can still fall at any time.
So, speaking with more precision than we tend to get in these ID threads (:-) :
1) YEC is not a model of mathematics nor logic and therefore cannot be demonstrated to be logically self-consistent;
2) YEC is not a model of mathematics nor logic and therefore cannot yield a logically linked hypothesis for testing;
3) Since YEC doesn't even have a hypothesis to test, it doesn't even reach the rank of a failed model, let alone a tentative one.
I think the whole thing can be summarized as just "funny". Why is the human race even discussing this still in 2008?
"The question of whether machines can think is no more interesting than [] whether submarines can swim" - Dijkstra
Science as it is written, is not in that strong of a conflict with the bible as it is written
Perhaps not if you don't take the bible literally. But many do. And science is, and let's not mince words here, absolutely and completely at odds with the bible as it is written, should it be interpreted as literal text.
Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.
OK, how about: "I believe in The Complete Works Of Shakespeare, but I don't take it as a literal historical document." Say what now? What does "believe in" *mean* then?!
Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.
And just to be clear, attributing unknown or unexplained things to god is *never* a reasonable theory because that logic requires the concept of god in the first place, which (if you spend any amount of time thinking about it) you should know is circular reasoning and therefore crap. One of the fundamentals of the scientific method is never to search only for facts to fit a theory, but rather to constantly revise the theory to fit the facts. This precludes the possibility of the concept of "god" to ever factor in to any scientific theory because there was never any direct evidence to cause the scientist to develop the concept and theory of a god.
Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.
Now, I know exactly the tribal mentality you mention, but that is human nature and humanity will always have a Complete Dick contingent. However, I certianly do not need smug reassurance from anybody else whose beliefs line up with mine. My smug reassurance comes from ascribing to verifiable truth, which stands on a mountain of evidence, and holds its own.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
Like a virtual machine save state. Either you install the OS from scratch, or you load the VM save state. Either looks identical to the running apps.
My computer never "goes wrong" and then starts talking to me, so how can dirt and muck on the ground do this? - this is so unlikely.
Teaching "intelligent design" as part of a curriculum is at least more sensible and honest - you don't even have to make anyone to decide on what the source of any such design was!
Do you realise that the same people who shout and scream about evolution being right, and that any form of design is wrong, would be the first to also instantly desert "evolution" in favour of any other future theory which seemed more paletable? - as quick as you could blink!! The effort they seem to put into promoting and defending evolution seems to have just as much "religious fervour" as any other religion does... So just present a level playing field to the learners, and let them decide. It's their choice, and it's their right to have balanced information to use to make that choice, not some one-sided hundreds-of-years-old-evolution-theory pushed onto them.
To any persons who wish to be truthful, accurate, accountable and responsible, I would say that there is no choice but to teach children about the possibility of living matter having being designed, because self-initiating evolution is just not possible, -and when was the last time you saw base-3 digital mathematical data-storage just "happen" (fact - this is what DNA is!). All the best.
"Don't Panic" ?
If man came from monkeys why are there still monkeys?
Just curious. But what is the explanation for this?
is that they readily embrace other conclusions of science. Fundamentalist Christian's happily drive SUV's, talk on cell phones and take prescription medicine. They have no problem with the technologies and science that provide refined oil, vulcanized rubber, plastics, satellite communications, data encoding in radio waves, etc. They also implicitly agree with theories on blood-born pathogens, vaccines and antibiotics. But, when science turns its gaze to the age of the earth, the fossil record or the origins of the human genome, they suddenly have problems with the method or its conclusions. Except for possible exceptions like the Amish, it smacks of hypocrisy. Physics and chemistry are OK while genetics, astronomy and geology (oil good, dinosaurs bad) are suspect? If you want to live by revealed as opposed to discovered truth (remember Galileo?), perhaps rejecting more of the fruits of science is your spiritual path, are they not, after all, tools of the devil? I have no problem with spiritual beliefs, but 4000 year-old myths on the origin of the world really needn't be taken literally.
The law in question merely "allowed" it to occur.
This merely stated explicitly what was implicit all the time:
the schools dictate the curriculum.
As disgusting as I find this campaign to destroy the foundations of science for the sake of irrational religious beliefs, This law did not "mandate" anything.
VLC FOR MAC IS DYING! IF YOU DEVELOP, PLEASE SAVE IT!!
The reason creationists feel their way of life is under attack is that in a very real *psychological* aspect it is. A basic human need, is to feel significant, and beyond that to feel validated in the decisions you've made in life.
As any child with siblings knows, one way to feel good about yourself is to try hard and achieve, the other is to find a way to feel better than your brother or sister by comparison ... possibly be insulting, hitting or tattling on them.
Fundamentalism (actually all Zealotry) is in my opinion, simply an extension of this short-cut method of feeling better than everyone else by comparison.
Linux-heads feel "under attack" by windows and os X.
Creationists feel that they are "under attack" by science.
Homophobes feel that they are "under attack" from gay people.
Demoblicans feel that they are "under attack" by Republicrats.
It's a moral short-circuit.
I believe that light travels (roughly) 186000 miles per second.
Can you disprove this?
Since "it is not disprovable" is it "thus not science"?
Think about it.
What? ®
Let me break it down to you this way: years and years along you were a monkey eating your own poop.
If you mod me down, I will become more powerful than you can imagine....
slashdot now has over one and a quarter million subscribers, probably 5-10 times that many readers.
Do you honestly think only geeks frequent this site anymore?
Do you honestly think this site is not a major target for astroturfers?
Over the past half decade, I've noticed a MUCH heavier proportion of blatant MAFIAA propaganda and utterly fallacious reaganomic sophistry modded to +5. I don't believe those posts, or the modding, traces back to legitimately individual users, and certainly not geeks.
VLC FOR MAC IS DYING! IF YOU DEVELOP, PLEASE SAVE IT!!
I have no problem teacher religion in school, in a philosophy, humanities, or religion class but the only tyme in belongs in a science class is when explaining how religion repressed science. And if you're going to teach "God" in philosophy class be sure to also teach Buddhism, the Flying Spaghetti Monster, Hinduism, Jainism, and all the other religions. Fair play is fair play. If you're going to teach Genesis, also teach The Navajo Creation Story, Apache Creation Story, and other creation stories.
Should there be a Law?
It is falsifiable, which is to say that if it were false then it could be shown to be false. Since it's not false then it can't be shown false, but that doesn't change the fact that it's falsifiable. If light moved at a different speed then a simple experiment to show that different speed would falsify it.
Contrast this to creationism. No matter what test you conduct and what results you receive, "God did it" is always a working refutation. Thus it's not falsifiable.
If you mod me Overrated, you are admitting that you have no penis.
Evolution does imply a direction though. "Survival of the fittest" has a specific meaning. Fit does not mean more intelligent, quicker, happier, or better. It is just the ability to successfully procreate. By that definition fruit files are fitter than humans.
Time flies like an arrow. Fruit flies like a banana.
That was a very insightful post. As a Christian myself, my experience is that American Christians feel attacked by atheists. The atheists use evolution in that attack, so Christians fight back by denying evolution. Thank you for a thoughtful and observant comment.
I concede 100%. "God did it" is not falsifiable. However, just because something can't be "disproved" doesn't mean it isn't science, maybe it's just true. Be careful to say what you really mean. Words mean things.
What? ®
Evolution vs Intelligent Design
Darwin vs Darfail, basically, yeah?
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
rubbish. i suppose you think coal can be made in 4000 years as well?
If you mod me down, I will become more powerful than you can imagine....
Yes, I should have said falsifiable rather than "can't be disproven".
If you mod me Overrated, you are admitting that you have no penis.
if people really want to be so dense that they make up bullshit like that i say we just have fun with them....
If you mod me down, I will become more powerful than you can imagine....
Not only that, but time - St Augustine in particular. http://plato.stanford.edu/entries/evolution/#1 Evolution is more orthodox and traditional, and a better fit with Christian beliefs than "creationism". Have you noticed that the same people who advocate creationism have also abandoned a lot of other Christian ideas - such as the attitudes to power and wealth expressed by Jesus?
No, but I think an omnipotent God (if one were available) could make it be already there when he created everything else.
If you mod me Overrated, you are admitting that you have no penis.
Just curious. But what is the explanation for this?
If you came from your parents, why do you have siblings?
Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)
No.
I wasn't aware that the Bible mentioned unicorns at all, but it turns out that the King James Version does mention unicorns in several places. The Hebrew word that the KJV renders as "unicorn" is translated as "wild ox" in the NIV; there's no way to know for sure exactly what was being referred to.
The unicorn (or wild ox) is mentioned in Numbers 23:22 and 24:8, Job 39, Psalm 29:6, and Psalm 92:10.
The book of Job also describes the "behemoth" (chapter 40) and the "leviathan" (chapter 41), the latter of which is also mentioned in Psalm 74:14 and 104:26 and Isaiah 27:1. I believe these to be dinosaurs of some sort, but it's impossible to say what they really were. Footnotes in the NIV suggest they could be a hippopotamus or elephant and crocodile respectively, but the (rather poetic) descriptions clearly don't fit anything like those animals.
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
Under attack?
Pro-choice people don't force abortions on other people who are against abortions.
Pro-alcohol people don't force muslims and mormons to drink the stuff.
Pro-stem cell research people don't require you to have your DNA fixed.
Would-be parents with a serious inheritable disease don't force other people to have their embryo/egg tested.
Pro sex toy people don't want to force the use of the toys on other people who think sex is sin.
Gay people don't want to force you to have sex with a same sex person.
Nobody is trying to force christians to have premarital sex.
Nobody is trying to force catholics to use birth control.
Atheists are not trying to bully other peoples' children into saying out loud brainwashing slogans such as "one nation, god is imaginary" five times a week. (You are free to do your brainwashing at home.)
Atheists are not trying to get their "ten reasons" plaques displayed in courtrooms.
Now, who is under attack and what bad things were atheists doing? Calling theists who wreck other peoples lives something you don't want to hear? How does that compare to the above list?
Xtians are skilled at turning the oppressing majority into the underdog. If theists only had confidence in their deity that it is indeed almighty, then people could be free. The theists would be confident that their deity would get back at the "sinners" later.
Bert
Freedom means free to do something without harming someone else. Now, in view of the above, try to explain "home of the free" to me.
You just quoted Wikipedia to make your point.
GP did qualify his citation with the phrase "The wikipedia article gives a good definition of creationism," not "The wikipedia article backs me up, therefore I'm right." No implication was made that the source was otherwise reliable. (Heck, you could quote Conservapedia if it gave a good definition ... though it doesn't.)
and why do you think only monks and religious figures could read and write?? because anyone else was deemed a heretic and burned at the stake.
If you mod me down, I will become more powerful than you can imagine....
Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.
If Christianity promotes a belief that is at odds with provable fact, then you're right, but the argument of young-earth Creationists is that macro-evolution and a billions-of-years-old universe is NOT provable fact. This is where you have a conflict, not in the logical conclusions that follow.
I believe your view of the scientific method to be flawed. The existence of God clearly falls completely outside the realm of empirical science. This doesn't make God false, it makes God untestable. Science only deals with the natural, which doesn't mean that the supernatural cannot exist. The scientific method does not require that you begin with a disbelief in God; indeed, many well-known scientists including Kepler, Galileo, Pasteur and Newton put God at the center of their scientific work. These men endeavored to better know the Creator through the better understanding of His Creation. Would you call their work unscientific?
Personally, I find religion deeply offensive, in the same way I find littering, racism, homeopathy, and liars offensive. If anybody is going to be doing any of that on my lawn, I'm going to yell at them.
I find that most people who are offended by religion in general (as opposed to being offended by some specific aspect of a particular religion) completely misunderstand what religion is.
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.
It will be your problem eventually.
It's called Projection
As an ex-christian I'll help interpret for you. Since I understand both sides of the fence.
1) Your belief system is comforting. The more conservative I was the more certain I was and the more certain I was the happier and more comforted I felt.
2) Denying God is real means it's all in your head and you shouldn't actually be confident in what you 'know'.
3) If you can't be confident in what you know then you can't be certain and if you can't be certain then you aren't comforted. Your amazingly incredibly blissfully wonderfully happy land grows dark and is replaced with the cold uncaring uncertainty of doubt.
4) So when you attack a christian's faith what you're actually doing is robbing them of that beautiful all enveloping right-hemisphere of the brain oneness with God. Which is incredibly painful.
It's like stealing a junkie's needle. It's going to be very traumatic. Much more traumatic than if you for instance told them that ketchup sucks and it's silly that they like it. Unless they get some sort of bizzare high from ketchup.
Yeah but do you really think ALL teachers would do that?
I don't believe in any god. But its the opposite to the "not believing is a sin" the "believing is ignorant" that I was trying to get at as causing the uping of the ID stuff. I went to some atheist meetings and all they talked about was how ignorant christens were. which is different then what I thought they would talk about, maybe humanism and how you don't need divinity to have a moral society, you know MTOB, not worrying what the christens were doing.
I do not really see where the problem lies, just teaching certain principles in school will not automatically convert the students to believe in them, assuming that they have any level of critical thinking.
I used to go to a christian school for over 6 years (not because I believe, but because it was open to all & one of the best public schools in the area). We used to have christianity classes 3 times a week, and if anything, it only re-inforced my atheism, and I am not afraid to say that it was the same with the overhelming majority of students. If something does not make sense, people will not accept it unless it is forced unto them outside of the school.
Another example that comes into mind is communism in eastern european countries not that long ago - although propagated heavily in schools and public life in general, unless enforced by family members, people would only accept the ideology to stay safe and not truly believe in it.
It is a bad start tho :P
They don't line up in any sort of a record. The geologic column doesn't exist anywhere on earth. Not even half or a quarter of it. Fish fossils on top of mountains, trees deposited like pickup sticks with all their branches and roots gone, etc really does kinda fit with the whole water theory.
The government can't save you.
...went something like this:
[...]
- So you support ID, therefore you assume the existence of God. How do you support that?
- I see God in the perfect harmony of nature.
- Then how do you maintain that the same God is responsible for miracles like healings, walking on water, splitting seas, etcetera?
- There you have the the greatness of God! He can do what we, humans, with our restricted science cannot do or understand.
- Okay, so God reveals himself though the laws of nature, AND by miracles, by definition a violation of those laws. If you can only prove the existence of something by a contradiction, you have proven the non-existence of it. Therefore, God doesn't exist.
- [...]
Someone will raise the question of whether a job requiring a science degree then becomes a form of religious discrimination. Hilarity WILL ensue.
/. -- the Free Republic of technology.
Atheists have meetings? Great. I already have to go to meetings for all the drugs I don't do anymore, now I have to go to meetings for all the things I don't believe in anymore.
So Last Thursdayism it is, then?
Justice is the sheep getting arrested while an impartial judge declares the vote void.
Fish fossils on top of mountains, [..] really does kinda fit with the whole water theory.
Or, you know, tectonic plate movement.
Justice is the sheep getting arrested while an impartial judge declares the vote void.
Now, I'm an atheist - but I think you need to look up the word 'metaphor'.
Science only deals with the natural, which doesn't mean that the supernatural cannot exist.
If the supernatural exists, it is a part of nature, and, thus, natural. This means that it can be measured and described. So, if the god(s) of some religion exists, it should be possible to test their existence. Many religions (inlcuding Christianity), however, has the rule that their god frowns upon any attempt at proving their existence. Pretty convinient, huh?
I find that most people who are offended by religion in general (as opposed to being offended by some specific aspect of a particular religion) completely misunderstand what religion is.
Most notably that religion is very, *very* much about feelings. Which is why many atheists end up being percieved like elephants moving around in a house of glass.
The truth may be out there, but lies are inside your head
We got two (actually more but let's limit it to these two) accounts of how the world came to be. One is a written text, accessible to anyone, conveniently explains all you'd want to know and was the predominant belief for centuries if not millenia with loads of people still holding onto it. The other is fossil, requires advanced scientific techniques to even notice, never mind interpret, has long and complicated trails needed to explain itself, still isn't known completely, is hard to grasp for the human understanding without a lot of education and hasn't even been found for the longest time. Now let's assume one of the two is a fake intended to trick people into going to hell. Additionally we have an omnipotent, omniscient, omnibenevolent deity and its antagonist (assuming the person seeking guidance is a Christian). A benevolent deity would not try to trick people into eternal torment (that is possibly the most evil act possible so an entity doing that would probably qualify more as omnimalevolent). However an antagonist would. Which is more inside the scope of the antagonist's abilities, writing a book or changing the physical structure of the entire fucking planet/universe?
Then again the fundies seem to believe that God didn't give man reason so that man may use it but to trip man up...
Justice is the sheep getting arrested while an impartial judge declares the vote void.
[quote]Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence.[/quote]
Mod parent up please
The problem with claiming "macroevolution" isn't proven is that it's up to THEM to show what the hell "macroevolution" is supposed to be and why it cannot happen because the distinction does not exist per se. We know evolution can happen, unless they can show that "macroevolution" is somehow different it HAS been shown as possible. It's like asserting lightspeed differs at "macro distances" without showing that there is any difference between "micro" and "macro" distances and using that to claim that lightspeed is not absolute.
Justice is the sheep getting arrested while an impartial judge declares the vote void.
In its place they added the "rapture" to their doctrine. No idea why.
Justice is the sheep getting arrested while an impartial judge declares the vote void.
I prefer to think of it as a manic evil laugh.
Justice is the sheep getting arrested while an impartial judge declares the vote void.
The government is forcing Christian pharmacists to dispense drugs that are abortifacient, thus forcing them to be morally complicit in the termination of an unborn life. Christian doctors who wish to practice obstetrics are forced to learn how to perform abortions. Schools are teaching birth control in such a way as to all but force it upon teenagers -- at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.
For that matter, the Nazis (sorry for the Godwin's Law thing) didn't force non-military personnell to murder Jews, so I suppose that was alright. Remember that most Christians believe that abortion is the murder of an innocent human being, so of course they are going to fight it with all their strength. For that matter, a large number of so-called birth control methods are in fact abortifacient (read the package insert for most incarnations of "The Pill") so fall in the same category. Embryonic stem cell research also falls into this category. The cloned being, even if development is stopped at the blastula level, is still a human being (that is, it has 46 chromosomes, and if it were allowed to develop, could only result in a being that all persons, even atheists, would have to admit is a human being). Thus Christians consider it morally unacceptable, even for Atheists. If embryonic testing is used to promote abortion ("I'm sorry Ms. Smith, your child has Down Syndrome. When can we schedule the abortion?"), then this also comes here. In general though, I'd hold that such testing is neutral, morally speaking.
I'm not against alchohol, so I will leave that one alone. I'm living in Germany, so I'll leave the Pledge of Allegiance alone. I don't really care about the Ten Commandments debate, and would tend to side with leaving them out of the courtroom because of commandments 1-3 (1-4 for Protestants reading this), which are problematic, because they only apply to a portion of society. Sex toys... I'd certainly not make this a huge issue. One can avoid them quite well.
Premarital sex and gay sex... I don't think there is a lot of movement to actively ban this activity. (Against gay marriage, yes, there is a movement, but you didn't mention that one in your litany above.) There is a movement to actively promote this activity. So the activity seems to be more from the other direction...
That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.
I'll probably state a few obvious things here, but please bear with me
I believe that religion serves as a security blanket for one of the greatest fears of all: death. Most religions preach that life is not simply extinguished when the body fails but continues on in some form or another. Now, the concept of an afterlife is also coupled with a reward/punishment system that hinges on the faith that such-and-such dogma is true. Now, if something comes along and describes that does not fit into the faithful's existing framework it has the potential to alter their belief, which, as was just stated, is fundamental to their reward/continued existence. This is what prevents most believers from having a rational dialog, as even broaching the subject implies death (in the afterlife). In turn, this makes those who believe in different frameworks (other faiths, atheists, scientists, etc) frustrated, because there is no room for argument.
Now, in terms of a solution, having armchair intellectuals decry people as stupid is about as far as we are going to get because everyone has or should have the right to believe what they will. As for setting up an academic curricula, I think the governing scholastic bodies should go back to the basics and reexamine the definition and purpose of academia. Is it meant to expand our viewpoints or teach us how things function. I think it's both and if creationism is taught from the perspective of the former and not the latter, I really don't have any qualms about it. The reason I don't have any qualms, and can hear many of you calling me stupid already, is that we should guard against intolerance and censorship of thought, lest we too fall into the state where others cannot have a two-way dialog with us.
If you knew what a theory is, you'd know that the're no such thing as "Creation theory".
No, science is not at odds with religion, it is complementary.
Science states that given a set of conditions, experimentation gives certain answers.
What it does not do is say that given a set of conditions that we do not yet know about, certain things will occur.
Science, at that point simply says "There is not enough information to draw a conclusion". Anything in that area is conjecture and belief.
Humanity is still a scarily primitive race (barely off the planet, with so much barely understood, and so much yet to discover), that science cannot yet even begin to answer some questions.
In the meantime, if science can't give the answer, why not let people gain comfort from a belief? Now, if they try and foist that belief on you as fact, but all means shred it apart if it doesn't fit your view, or beliefs about the things that are unknown.
Me, I'm an agnostic. I know that I don't know, and can't either prove or disprove a deity, so I'll let the existence of it, or non-existence carry on happily as it has since the beginning of time. I'll just get on with having a life as happy as I can make it, and spread a little of the good cheer where I can. After all, if there is a god, isn't that what all the texts say to do anyway? If there isn't, at least I've had a good time while I've been breathing, and so have other people around me, if I can help it!
Obligatory KITH viddy:
http://www.youtube.com/watch?v=ogXJ7YBb3NE
Il n'y a pas de Planet B.
So? If you object to abortions - don't become a pharmacist!
What next? Nurses objecting to intravenous injections because it conflicts with their faith?
Ahem -- you're talking about the THEORY of plate tectonics, no?
Don't forget now, that's just a theory. Just like the "water theory" that the GP mentions. Right?
Heh heh heh....
'The government is forcing Christian pharmacists to dispense drugs that are abortifacient, thus forcing them to be morally complicit in the termination of an unborn life. Christian doctors who wish to practice obstetrics are forced to learn how to perform abortions.'
Perhaps your government is more to blame for providing insufficient information before these people started their studies. I'm very sorry to hear that they cannot find another job.
'Schools are teaching birth control in such a way as to all but force it upon teenagers -- at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.'
Generally society bears the brunt if horny teenagers, some of whom may not have learned that it is OK to say no, get pregnant. I believe there is no law in Germany that forbids parents to tell their kids a thing or two.
'For that matter, the Nazis (sorry for the Godwin's Law thing) didn't force non-military personnell to murder Jews, so I suppose that was alright.'
As an example of a non-sequitur perhaps? I don't get it. My basic point is that religions (or more generally anyone) should leave other people (including those of other religions) free to do what they want, as long as they don't harm someone. Killing Jews should not be a pass-time.
'Remember that most Christians believe that abortion is the murder of an innocent human being.'
Don't worry. Yagolah must positively hate those pre-born human beings. Next time you visit the ladies room and see the trash can for sanitary towels, put some flowers next to it and pray. If it is there for a while and the ladies room is visited fairly frequently, there is a large likelihood that at some point in time it contained your beloved 46 chromosome entity. A very large portion of fertilized eggs never make it to the full 9 month development period. Abortions barely increase the number. Of the 3 women I have data for: One with 3 kids and 1 miscarriage (I know of). One with 3 kids and 3 miscarriages (just a hormone thing. When the doctor gave her suppositories against the violent morning sickness causing the rejection the kids kept coming. Apparently yagolah liked the doctor's action. Or allowed the doctor to compensate for the birth control pills he had prescribed in his carrier. And the last woman I know of has 2 kids and one miscarriage. Oh the humanity! And I couldn't count the times they just missed a period, because I'm not privy to that.
'If embryonic testing is used to promote abortion ("I'm sorry Ms. Smith, your child has Down Syndrome. When can we schedule the abortion?"), then this also comes here.'
The doctor would be an asshole and probably face the medical profession's court. The nice thing about abortion is that every child being born is a wanted child, warts and all. Parents' decision. No interference from third parties, whether they are doctors or theists.
'Against gay marriage, yes, there is a movement, but you didn't mention that one in your litany above.'
Thanks for bringing it up. Another one for my "litany" then. Nobody is forcing churches that gay people can marry in front of their god, in their religious building or according to their religious rules. There is a difference between a marriage before the law and for the church. There is no reason why gay people cannot have the first one. It is an arrangement that gives security (and some obligations) to the marital partners, e.g. in case of pensions, in case of the custody in case there is off-spring involved, and if one of the partners dies. There is no reason why these regulations cannot be open for gay people. But in most countries theists have still hijacked the whole concept of marriage, conveniently ignoring the difference between a marriage before the law and before the church, even though that goes in their country as well.
Bert
Exactly, and that's why the Flying Spaghetti Monster religion exists; as a rational point of comparison.
If someone presents an "argument" for Creationism and so on that is no stronger than your Pastafarian argument, well, that says something.
If you can't be more convincing than the FSM folks, get the hell off my lawn.
I think that the man who sells fertiliser to the farmer who grows potatoes eaten by the gas station owner who sells gas to the janitor of the hospital the obstetrician works in should go straight to hell.
Bert
Now, I'm an atheist - but I think you need to look up the word 'metaphor'.
That's his point.
If it's metaphor, that means you have to interpret it and draw your own lessons & value from what you read. Shakespeare can be equally valuable -- he was a perceptive observer of humanity and our weaknesses.
Now apply the word "believe" to that.
How does one "believe" in a metaphor? You'd have to start drawing lines between parts of the bible that are "fact" and those which are just metaphor.
And then you have to acknowledge that these lines are human-drawn, and hence open to debate. And maybe none of it is fact, since we know much of it isn't... it gets messy, belief-wise.
If you just say "well, maybe it's all metaphor, but we believe there are truths to be found in the stories"... well, that's a view an atheist can share (yes, some of the fables in the bible highlight actual human problems...). If it's all metaphor, you don't even have to believe that God exists. It all falls apart.
Technically "Fuck y'all" would be 2.33333333 words....
Not forcing -- oh really?
You probably haven't seen this news article -- but we all knew it was coming!
The proponents of the progressive agenda are finally showing their hand... Be afraid! Be very afraid!
Now, if they try and foist that belief on you as fact, but all means shred it apart if it doesn't fit your view, or beliefs about the things that are unknown.
You mean, if they start printing textbooks and trying to get them into public schools?
Related: I disagree about the "complementary" thing -- faith in the absolute *truth* of belief is at the core of most religions, not "we don't know, but maybe it's something like this".
If you believe it's *true*, then it freaks you out when your kids are exposed to "wrong" alternative viewpoints (like science class, like classmates with other religions or none), and you also don't subject public debates (like re gay marriage, birth control, abortion, religion in schools, etc.) to reason if you think your religion has the "true", inarguable answer already.
That's the conflict.
Agnosticism doesn't conflict with science (though many people ignore scientific matters of probability and even logical consistency), but most practicing religious people would not classify themselves that way -- they have some believe in the absolute *truth* of what they profess.
BTW, I should also mention that unfortunately many religions (particularly the stricter versions) say you won't be rewarded for simply being nice. If you have no faith (if you haven't accepted Jesus as your personal savior, for one example), you aren't going to heaven.
Not that I'm arguing with your approach to life -- just saying that this version of Pascal's wager doesn't really "work" any more than the original does.
Liberals deny that racial differences exist, that class/caste differences in IQ exist, and that you cannot educate or rehabilitate people because behavior is genetic.
Conservatives frequently deny natural selection, or the necessity of abortion and drug legalization.
Politics -- the making of broad, inflexible, identity-based statements -- and science do not mix.
I've counted to 10 before; sometimes I've even counted to 100.
But there's no way you can convince me that anyone could count to 1000000. That's an enormous difference.
To assume that you could count to 1000000 the same way that you count to 100 is nothing more than an assertion of faith.
I'll accept your "microcounting" argument, but "macrocounting" is a tool of the devil.
In my grade school/junior high science and high school biology evolution was a tiny few pages in a much more general textbook. It certainly did not get more than a week or so of lectures. Basically compared to the entire science class evolution is a tiny footnote (in high school/grade school you don't get much done in a week).
So the question is why is there a textbook on evolution or creationism? It does not merit an entire science class. Evolution is just a single theory. It's not like you sit in class for a year learning just evolution. It's a few days at the most, maybe even one or two. A textbook for this is overkill. Maybe a creationist or evolution 2 or 3 page worksheet would be appropriate but a whole book is way out of hand.
My worry is that creationists will dedicate half a year to studying their creationist textbook and then ooops what about all that other stuff that actually matters that you learn if we assume biology then how the body/cells are structured, how heredity works with the various genes, etc....
And furthermore I don't see what the big deal is. We also learn that people thought the entire universe revolved around the earth. The theory is wrong but we learn it for historical reasons. If evolution is proven wrong, I would expect that we still learn it, why it is wrong, and why the new theory better explains life's origins. Maybe another hour or so of discussion on evolution. It's no big deal. Until creationism is proven it belongs in a religion class. And if it ever is scientifically proven then it has a place in science. Good luck with that though.
Every night, I give thanks to the Lord for all the YECs and other religious whackjobs, for it is a true test of my faith in His absence.
I think that an accurate term for this process is "growing up".
At least for me the age which I now identify that I transitioned to adulthood is the same age that I transitioned away from belief.
'The government is forcing Christian pharmacists to dispense drugs that are abortifacient, thus forcing them to be morally complicit in the termination of an unborn life. Christian doctors who wish to practice obstetrics are forced to learn how to perform abortions.'
Perhaps your government is more to blame for providing insufficient information before these people started their studies. I'm very sorry to hear that they cannot find another job.
Many of them became pharmacists (spending several years of their lives attaining that education) when this wasn't an issue. Some even became pharmacists while there were specific laws to protect their consciences. But the abortion-rights lobby decided that it would be far too traumatic for a woman to hear, "I'm sorry, I can't fill this prescription, but Joe's pharmacy down the street can.", and so pushed through legislation that says that pharmacists have no right to conscience. Obviously they can go get a job at the local McDonalds, but after years of student loans and the like, that's a pretty bitter pill to hand somebody.
'For that matter, the Nazis (sorry for the Godwin's Law thing) didn't force non-military personnell to murder Jews, so I suppose that was alright.'
As an example of a non-sequitur perhaps? I don't get it. My basic point is that religions (or more generally anyone) should leave other people (including those of other religions) free to do what they want, as long as they don't harm someone. Killing Jews should not be a pass-time.
If embryos and fetuses are human beings, then there is no non-sequitur, because you are harming someone with your actions. And that is the point of the statement. And actually, the idea that embryos and fetuses are human beings is pretty easy to support scientifically, even though there is a philosophical/theological issue about the value of such a life.
'Remember that most Christians believe that abortion is the murder of an innocent human being.'
Don't worry. Yagolah must positively hate those pre-born human beings. Next time you visit the ladies room and see the trash can for sanitary towels, put some flowers next to it and pray. If it is there for a while and the ladies room is visited fairly frequently, there is a large likelihood that at some point in time it contained your beloved 46 chromosome entity. A very large portion of fertilized eggs never make it to the full 9 month development period. Abortions barely increase the number. Of the 3 women I have data for: One with 3 kids and 1 miscarriage (I know of). One with 3 kids and 3 miscarriages (just a hormone thing. When the doctor gave her suppositories against the violent morning sickness causing the rejection the kids kept coming. Apparently yagolah liked the doctor's action. Or allowed the doctor to compensate for the birth control pills he had prescribed in his carrier. And the last woman I know of has 2 kids and one miscarriage. Oh the humanity! And I couldn't count the times they just missed a period, because I'm not privy to that.
And there is of course no moral difference whatsoever between the natural death of a person and actively killing them... My sister mourned the death of her miscarried child, and I don't think that there's any reason not to do so. But you seem to say, "Since a lot of children die before birth, it is O.K. to kill children before birth indiscriminately." Not a moral code I could accept. If we look at the rate of abortion compared to the birth rate, it is indeed significant, and to my eyes, positively frightening.
People mention unicorns all the time. This is news for nerds so why don't people mention time travel when discussing the Bible?
Revelations is one of the books of the bible. A frightening large percentage of Americans believe it will occur within their lifetime. However by definition it is in the future. Hence it is either
A) Time Travel, coming back from the future to tell everyone what occurred.
B) There is no free will. We are machines pre-programmed to do as we do, the end result is already known.
I'm all for the time travel aspect when talking about the Bible with anyone. Believers want to think they have free will - it's actually a tenant of the Catholic church. Therefor it must be time travel and that leads to much amusement on my part during the discussion.
I think you pretty much entirely missed how logic works. Fact disproves a lot of Christianity. It is therefore false, as a belief. Ok, glad we got that out of the way.
As for agnosticism, that's not good enough in my books. For instance, scientists can't prove that there aren't bright pink microscopic 16-legged elephants hiding on a planet 28,000 light years away. So, does that mean you have to say, "welll yeah I guess it could be possible but I can't disprove it".
Sane people would say, "that's preposterous, I'd have to see it to believe it". You don't need to prove something does NOT exist, you need to prove it DOES.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
I can't believe I'm going to bite on this... but that would be a water hypothesis... not a theory. It's not provable or disprovable (or even testable) and therefore is not a theory.
Plate tectonics is a theory... we test it often. For example, we're using sensors to "watch" California trying to escape to Alaska.
And when they do, im sure the courts will call BULLSHIT on ID.
Ask them how the flood just happened to order all the fossil pollens in the right order, and didn't mix them all together.
Oh, they didn't think about that, did they?
The more people I meet, the better I like my dog.
This is commonly called 'Last Tuesdayism'. Don't be fooled by the to-be-burned-in-hell-forever followers of Last Thursdayism, as their religion is an abomination.
The more people I meet, the better I like my dog.
So? If you object to abortions - don't become a pharmacist!
Sorry, that's not an acceptable solution. Abortifacient drugs have only been available from the pharmacy in the last few years. Most people who are now pharmacists became pharmacists with no inkling that they would ever have to dispense such things. Many people who are now in pharmacy school (myself included) have no idea what future drugs may come onto the market that conflict with their moral views. Should nobody practice pharmacy, just because at some point in the future, some drug might be developed that we all object to?
A larger problem is that in forcing pharmacists to dispense abortifacients, the government is interfering with the freedom of individuals. I accept that people are free to seek abortions (though I would disagree with that). But I insist on being accorded the same freedom -- the freedom to choose to contract with such people to deliver services, or the freedom to decline to contract with such people. Tolerance must be a two-way street, otherwise it's not tolerance. It's tyranny.
Oh, and your strawman fails too. There is no recognized belief system that objects to giving intravenous injections on moral grounds. Let's stick to the realm of what actually exists.
Abortifacient drugs have only been available from the pharmacy in the last few years - WRONG!
Birth control pills are available for about 40 years now.
"Oh, and your strawman fails too. There is no recognized belief system that objects to giving intravenous injections on moral grounds. Let's stick to the realm of what actually exists."
Oh, you're wrong. Some brands of Orthodox Christianity (now almost extinct) in Russia forbid injections.
And there's also Jehovah Witnesses. Do you want to die because ER-medic refuses to perform blood transfusion?
I still don't get the Jews connection with embryos.
I'm not promoting abortion. I'm promoting a choice and want every child born to be wanted by his parents. And I'm not promoting to be it an easy procedure to enter. Like euthanasia, there must be strict rules for a proper course of action (and they are there, in my country). It is just that the presumption that there is a god, or gods is not shared by everyone and could be wrong. No one has a red phone to contact him/her/them to find out how to deal with the issue. It takes quite a bit of guts to say that you're better at determining his/her/their will.
If everybody thinks abortion is a bad idea, there will be no abortions. If some people are willing to risk the wrath of supreme beings, it should be their choice, not yours.
But I'm wondering, is one of the women I mentioned now guilty of 3 murders because she didn't get the suppositories right away? Or is her doctor guilty of murder by neglect for not recognising the problem quickly enough? And x years ago, those pills weren't available, so no body could be blamed, but now we suddenly have more opportunities to go to hell. Great!
I hope you'll enjoy heaven and can strike up a good conversation there will all the foetuses and embryos, irrespective of how they got there. It must be a fun place.
In my country, there were 32.992 abortions in 2006, (I included the ones within 16 days after the period that should have occurred and 4.114 of women coming from abroad to have it done here. I admit the number is higher than I expected). For non-immigrants in my country, there are 7.8 terminated pregnancies per 100 pregnancies.
Finding data on miscarriages was a bit harder (lots of noise by stories on the events). For the age groups 25-34, 35-39 and 40-44 the percentages were 12% 25% 48% per pregnancy. So, older women are more likely to kill their baby than younger ones. They could have elected to get pregnant at an earlier age (plenty of slashdotters available). And the number of abortions is less than the naturally terminated pregnancies.
My parents were catholics and my mother used the pill for a while. They were great people and I just happen to believe that counts more than the way in which they prevented their family from becoming bigger than they wanted.
Bert
Supreme beings like people who wear their seat belts better than those that don't. And they like rich people better than poor people (who live shorter). Oh, if the pharmacists gives the money he earns with the sale to a charity, he may save the life of a kid in Africa with it. Well, I guess that most people aren't that concerned about saving lives given the state over there. They prefer to control other people to feel well themselves.
I want someone to hit the nail on the head with creationisms, but no one seems to ever do that online so I'll give it my best shot.
Yeah, well I want someone to hit creationists on the head with nails and it doesn't seem to happen much either :(
May contain traces of nut.
Made from the freshest electrons.
Its ironic but to believe in intelligent design requires the believer to believe in facts that are not true. To do believe in "facts" that are not true is to bear false witness.
Consequently, those who support ID and creationism in the science classroom are actually bound for eternal damnation because they violate the commandment "Thou shall not bear false witness".
Its ironic that darwinians are in a position to "pray for the souls" of those who believe in ID.
Abortifacient drugs have only been available from the pharmacy in the last few years - WRONG! Birth control pills are available for about 40 years now.
Nobody really knows how birth control pills work in humans. Based on animal models, we can say to the best of our knowledge that old-school birth control pills prevent ovulation, not implantation. New-school birth control pills prevent the changes in the cervical mucus that allow sperm to enter the uterus.
Oh, you're wrong. Some brands of Orthodox Christianity (now almost extinct) in Russia forbid injections.
I'll keep that in mind next time I need an intravenous injection in the backwoods of Russia, where my only source of medical care comes from a brand of almost-extinct Orthodox.
Do you want to die because ER-medic refuses to perform blood transfusion?
I take comfort in the fact that there are lots of medics in the ER. If one doesn't want to do a blood transfusion, I'm sure there will be others who do.
Plus, I thought JW's believed that their rules applied only to them, and not unbelievers.
And I think you forgot to address my argument about how being forced to dispense abortifacients infringes on my right to contract.
The problem that science poses to the religionists is that it destroys their business model.
Science presents the very real prospect that people can learn to think about the world and the universe themselves using logic and reason and come to the conclusion that the religions of the world really have nothing to offer in terms of understanding.
It is thus not surprising that the creationists, ID forces and other 21st century versions of witchdoctors and their ilk are keen to keep students uneducated about the power and potential of science.
"Nobody really knows how birth control pills work in humans."
Bullshit. We know _exactly_ how birth control pills work. Search pubmed.org if you don't believe me.
"I take comfort in the fact that there are lots of medics in the ER. If one doesn't want to do a blood transfusion, I'm sure there will be others who do."
How about emergency transfusion during airlift, for example?
Or how about antivax doctor denying your child a vaccination?
Or fire-fighters refusing to do their job on Sabbath?
Or this: http://www.telegraph.co.uk/news/uknews/1577426/Female-Muslim-medics-'disobey-hygiene-rules'.html ?
"Plus, I thought JW's believed that their rules applied only to them, and not unbelievers."
Birth control pills also do not affect pharmacist, so I fail to see a difference.
Probably JW are just not powerful enough (yet) to force their believes on others.
"And I think you forgot to address my argument about how being forced to dispense abortifacients infringes on my right to contract."
Simple - you have a JOB to do, and other people depend on you. If you can't do your job then don't do it. It's that simple.
Actually, all too many atheists want people to hear and believe their "god is imaginary" mantra, and many are prepared to go to extremes to get to that point. So, no, atheists are as guilty of pushing their agenda as anyone else is, and it's lame to assert otherwise.
I guess you don't know all that much about the dark ages then. You could equally apply what passes for your "stereotype" of the dark ages to the present.
I subscribe to the Creation theory.
And there are people who subscribe to Geocentric Theory.
However, I don't think either theory should be taught in science classes.
And they don't think the sun-centered solar system should be taught in science class either.
Science should be taught not unprovable theories. No one can prove Evolution nor can anyone prove Creation.
Sure.... lets not teach students ANY science at all.
Lets not teach the theory of gravity. Lets not teach atomic theory. Lets not teach electromagnetic theory. Lets not teach the theory of optics. Lets not teach any science at all.
Lets not even teach the heliocentric theory of the solar system.
All evidence indicates that heliocentrism is the best most accurate explanation for the solar system.
All evidence indicates that evolution is the best most accurate explanation for the diversity of life on earth.
All attempts to refute heliocentric theory have failed based on the evidence. All attempts to refute evolutionary theory have failed based on the evidence.
Heliocentrism makes predictions, and those predictions have been endlessly tested and confirmed.
Evolution makes predictions, and those predictions have been endlessly tested and confirmed.
It is impossible to "prove" that the sun goes around the sun, just as it is impossible to "prove" evolution or anything else in science. However no one has ever come up with any remotely sane alternative that is even remotely compatible with the evidence. Every alternative ever suggested by anyone has been refuted by the evidence.
If they're to be taught in school, put it under Literature like where I learned the Mayan's version of the creation of life.
The solar system and electromagnetic theory and atomic theory and everything else should be taught in literature class?
The only problem here is that you have the idea that evolution is wrong, that some people have told you that the evidence establishing evolution does not exist, that you have the idea that evolution is not as powerfully established by the evidence as every other field of science, that you have the idea that evolution is not actually a field of science just like every other field of science. Those things are all wrong.
If you want to study science, great! There are entire libraries filled with evidence "proving" evolution is true. If you have any interest in learning science, in learning what evolution actually says and how it works and learning what sort of evidence there really is to back it up, great! I'd be more than happy to help, if you have an honest interest in the science and evidence.
If you don't know any of the science, and you have no interest in learning the science, then I suggest you listen to actual mainstream professional scientists who are experts on the subject. And actual mainstream professional scientists who are experts on evolution unanimously say that evolution is fundamentally right and that it is overwhelmingly established based on all known evidence from every conceivable direction.
And I suggest you stop listening to non-scientific activist groups running public relations campaigns pushing misinformation that there's no evidence smoking causes cancer, or pushing misinformation that there's no evidence supporting evolution. The anti-evolution activists are nothing more than public relations campaigns spewing factually false information.
It is easy to convince someone that evolution is right - - - IF they are at all reasonable and rational and willing to honestly consider the evidence. If you want to take me up on that claim, please first indicate if you are a Young Earth Creationist. It is much faster and easier to address the age of the earth, much faster and easier to establish if you are willing to honestly consider the evidence in reasonable rational manner.
-
- - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
Exactly! I wish there was some sort of test before you could buy products that were developed using scientific research. Such as: What are the definitions of a theory and a hypothesis? People could still buy products that are natural or were accidentally discovered.
An excellent post. Hear hear.
Unless you can cite a person besides Dawkins, who is the only one I can think of who really does much in the way of pushing atheism, most atheists truly don't give a crap what people believe. They aren't out there trying to "save" people from god, there's no organizational structure trying to push atheist missionaries to convert people. Atheists don't care what you believe, most of us just want you to stop trying to "save" us or tell us what to believe.
If Protestantism evolved from Catholicism, why are there still Catholics?
Evolution doesn't require that new species completely replace old ones. It's pretty well everywhere in evolution. And if that was a problem for evolution we'd only be able to have one species on the entire planet of everything.
Pockets of isolation allow mutations to become dominant without completely removing prior genetic material. Think of Australia having many species that only exist there. That's because the evolution there didn't effect animals back in Africa. And isolation doesn't need to be that distinct.
Should nobody practice pharmacy, just because at some point in the future, some drug might be developed that we all object to?
Or better yet, do their job. Guns kill people, but gun store owners aren't pro-murder. They chose to sell guns, and they sell them for whatever they are used for. Pharmacists dispense drugs. It should either be legal for me to fill my own prescription, or a pharmicist should be required by law to fill it. To have pharmacists lobying to prevent me from filling my own prescription, then going on to refuse to fill whatever they don't like is a conflict that should be ended. The grocer that doesn't like broccoli still sells it even though he wouldn't use it.
There is no recognized belief system that objects to giving intravenous injections on moral grounds.
There are. That you are ignorant of them doesn't make them not exist. The body is a temple and all that. Some Christians are against most medical treatment. Some tribal belief systems object to breaking the skin. Don't push your ignorance off as truth. We get enough of that already from "your type."
Learn to love Alaska
Using stamps is a hobby like trading stocks.
The quicker you use them, the less they'll depreciate over time; They're ruling prior stamps not sufficient denomination to send a letter or enveloped parcel again: don't pull that "the older they are the more they're worth" shit on me because that's an old wive's tail perpetuated by the same people that sell the stamps: it's old stock and they want to generate interest on the currency they took from you to hold and as well invalidate your claim as insufficient because they are in-deed helping cause the imbalance of fund in their inflation and deflation just like this outrageous run-on sentence which is perfectly legit -- on Jekyll Island, where thereafter drafting said cause of inflation as fractionalizing lawful money with stock certificates to an elimysonary trust of limited liability edicted to US Code Title 12 section 144 that was created during the Month of December under heavy storm conditions when true Senators were at home away from the elements while "swine" congregated to create such filth without the majority and without notice and ... now you know the wrest of the story...
Let's stick to the realm of what actually exists.
We would ask the same of you before demanding special rights of your supernatural belief system. Try working on that first, then we'll talk.
kurzweil_freak
5th Kyu Genbukan Ninpo/KJJR student
Be the darkness that allows the light to shine.
The real problem isn't the rabid creationists. It's both them and the evolutionists who are even more unaccepting of questions to their faith.
Evolutionary/Big Bang beliefs are constantly shown to be improbable so their faithful re-write the rules to fit the new data. How many times a decade does the age of the universe change? How often are dating methods disproved, and then 'revised'?
No, Atheists are just as dogmatic and inflexible and have their own ongoing inquisitions of those who question.
The real problem is that man is an arrogant know-it-all that has always made himself into a God by believing in his own omniscience. This is true in either side of this argument.
The science as God side of the argument has always thought that man essentially knew all their was to know and that there were only details to be worked out. From flat Earth theory, to evolution, it's all the latest bible of the man/science as God crowd.
The fact is that no information system can contain enough data to understand itself. That includes the universe.
Oh well, at least both sides agree that Tom Cruise is nuts.
Anonymized for flame retardance.
Sure, I have the right to flip the channel and ignore it. And you have the right to not listen to the atheist saying that your imaginary friend is imaginary. You're just complaining because we have the right to complain, and you just can't stand hearing it.
kurzweil_freak
5th Kyu Genbukan Ninpo/KJJR student
Be the darkness that allows the light to shine.
As opposed to the New American Bible (Catholic), where re'em is translated as "wild bull".
Sure. But nobody's forcing the believers not to believe in what they believe.
Christians go around telling people their God exists, and atheists go around saying that no God exists. Fair game.
Laws are meant to restrict people in doing things that harm others, and "psychological harm due to religious differences" isn't really harm... I mean, the "right to religious-high" isn't a God Given Right (pun intended).
Don't quote me on this.
Yeah but that's ridiculous. You're obviously lying.
Don't quote me on this.
And so the government is (rightly) telling them not to mix religion and public service. You're not giving such medications to those who do not want them.
Prove it. And even if they are forced to learn how, they never have to actually perform an abortion in their entire career if they don't want to.
In nearly all cases, teenagers can be excused from sex ed programs by their parents. And even if they aren't, they have this thing called 'free will' that allows them to choose not to use birth control methods of which they don't approve. In addition, science has repeatedly shown that so-called 'natural family planning' is not nearly as effective as newer methods of birth control. Perhaps it should be shown in addition to other methods, but showing students actual numbers for how effective methods are is not doing them a disservice.
Bullshit. Since when do you speak for "most Christians"?
And so, one does not have to take it if one has the belief that it would be wrong to do so.
Laws exist to prevent people from harming other people and their property. If you can prove that a being is hurt or destroyed in the process of stem cell research and testing, then there is a good reason to have a law against it. Oh wait... That's a personal belief that you're trying to force on others.
Are you stating that the government actively promotes premarital sex? Like, they're advertising that it's a fun thing to do or something? I've certainly not seen such literature...
It's better to vote for what you want and not get it than to vote for what you don't want and get it.
- E. Debs
Yea, and who exactly defined Creationism the way you quote. I would think that the best definition of Creationism would come from Creationists, not the secular humanists holding positions of power on Wikipedia. If you haven't noticed yet, Wiki does not represent non-mainstream ideas very well--tyranny of the masses, you know?
Presumably you didn't quite understand the purpose of schools.
May contain traces of nut.
Made from the freshest electrons.
The Bible states that God created the Earth "In the beginning". Nowhere does it state that this was 4,000 years ago (or even 4,000 B.C.). It is perfectly reasonable, and some fundamentalists would say required, to accept the fossil record and to accept the age of the earth as dated by scientists as approximately correct. Our interpretations of the fossil record may not match yours 100%, but we accept it as evidence of all the critters that have existed in the past. For us, there is no place to put Satan's rule of the planet as noted in some non Genesis portions of the Bible except before Adam. There are more than the Amish who are disgusted with parts of the ID theory. It doesn't fit with a complete reading of the Bible.
There's a very vocal group of extremist and evangelical atheists (Hitchens, Dawkins, & Dennett et al) that have convinced the world that evolution proves materialism and thus atheism. This is total and clever reversal of the inference (and for those of you who like to talk about circular reasoning so much, there's a few loops you can go through there). The only way one can possibly arrive at pure coincidence as an explanation of the origin of life on this planet, is if you *start* from materialism. This debate is not about science at all. It is about philosophy masquerading as science. Evolution is not the problem (even if it were true). The problem is the phony implications pushed by extremist atheists. Evolution does nothing to support their philosophy and they should stop claiming that it does. I recommend one of two things (and preferably both) to bring a truce to this situation:
Either of those two things will bring a quite quick-like end to all of the opposition you guys are facing from Creationists and ID theorists (of course, there is a third option, but it is so outlandish that I almost didn't mention it--don't rule out 'design' a priori as a cause for high order--I know, it is hard to imagine order arising via intention).
No business is forced to become a pharmacists. No one is forced to work at a pharmacy. Or become a doctor. If you were in intensive care, you'd be fine if the doctor refused to give you a blood transfusion because he was a Jehovah's Witnesses?
As for your Nazi analogy, I'm not sure I would have much symapthy for someone who willingly took up a job as concentration camp guard, for example, anyway. So even if we agreed it was murder, it's not a problem, as no one is forced to take the job of a doctor or pharmacist.
Schools are teaching birth control in such a way as to all but force it upon teenagers
Wow, really, teenagers are forced to have sex? I wish I went to your school.
at least in my school, we were taught that everyone should use birth control and that natural methods were not methods at all.
You'd rather that teenagers had sex without contraception?
There is a movement to actively promote this activity.
In what sense? People are encouraged to take up gay sex? Of course not. All that is wanted is to keep people outside of people's private sex lives.
Whether a particular drug happens to exist or not is besides the point - the point is that if you are the sort of person who could only dispense a drug if you personally morally approved of it, then it ought to be bleeding obvious that getting into that profession is a rather risky business, whether or not you are okay with the drugs that are currently being dispensed. Even more so, given that it is well known that new drugs are always appearing.
Many people who are now in pharmacy school (myself included) have no idea what future drugs may come onto the market that conflict with their moral views.
If that's a problem with you, then you were foolish to start in the profession in the first place.
Should nobody practice pharmacy, just because at some point in the future, some drug might be developed that we all object to?
Of course not, and no one is claiming such a thing. Instead, leave it to the people who are willing to sell legally available drugs without worrying about whether it's a drug they personally morally approve of or not.
I write software for a living. If someone uses my software for evil, that's up to them - if I was the sort of person who had a problem with people using the software I write in a particular way, it would have been foolish to take up my particular job, and there'd be no use crying about it afterwards.
Moreover, if I don't like it, then I am free to leave. I don't get to both get paid, and not do the job - that's ridiculous.
A larger problem is that in forcing pharmacists to dispense abortifacients, the government is interfering with the freedom of individuals.
Like it or not, the pharmacy industry is regulated. AIUI, if you want to be licenced as a pharmacy, then expect to follow the Government's rules. If a business doesn't want to be a pharmacy, then no one is forcing them.
I take comfort in the fact that there are lots of medics in the ER. If one doesn't want to do a blood transfusion, I'm sure there will be others who do.
Well, if a pharmacy is able to get another member of staff to dispense, that's fine with me, and up to them. The problem is they don't always do it. Moreover, in some hospitals at some times, there may only be one doctor available in the ER.
Plus, I thought JW's believed that their rules applied only to them, and not unbelievers.
Yes, good point - JW's believe their rules are only for them, and don't try to force their morality onto others. That way, we don't get into stupid situations like a doctor refusing to give blood transfusions - because that's exactly the sort of mess we'd get to if JW's behaved like the anti-birth-control-pill pharmacists.
What a novel idea - perhaps there's a lesson to be learnt there?
At least the question would be a little closer to the truth if it had been apes instead of monkeys, although of course it would still be incorrect.
kurzweil_freak
5th Kyu Genbukan Ninpo/KJJR student
Be the darkness that allows the light to shine.
Besides the fact that none of your points you bring up ever make sense logically, it certainly doesn't help your case that you can't even put together a coherent sentence.
Or that you're just an ignorant, argumentative fuckwad. If you want to play pretend with everyone about your god, go to fucking church. No one is stopping you. Just stay the fuck away from our public, tax-payer funded schools. Why are you so unable to do that?
kurzweil_freak
5th Kyu Genbukan Ninpo/KJJR student
Be the darkness that allows the light to shine.
Well, you can probably name a number large enough that noone could count to it since doing so would exceed the human lifespan (and you can extend that to computers and the lifespan of the universe) but then again it's math and practicality is somebody else's problem there.
Justice is the sheep getting arrested while an impartial judge declares the vote void.
My theory is that creationism is viewed as being linked to a value system that creationists view as being under attack from secular radicals, and evolution is taken as a battle field to fight against this because Evolution is pretty removed from their day to day lives, if they chose to believe fantasy on it they wont hurt them selves like they would if they choose to believe fantasy about refrigeration. Basically they are picking ID as the place to make their stand to defend their way of life.
That brings up the other point, why do they feel their way of life is in danger? It could be politicians playing it up for votes, it could be changing social economics beyond anyones control, it could be pure paranoia, and it could be that people in the cities and scientific community actually attack them. I think its a combination of all those factors, but i also think one of the largest factors is the fact that Secular atheists do actively attack the religious beliefs of others.
Uh - other way around. It's the religious folks who have turned this whole thing into a "us vs them" mentality. You see, religions hide their gods in the mysteries. Back in ye old times, whenever a mystery was discovered (why didn't it rain today? why does the moon have phases?) the answer was always "God(s) did it that way!" Well, over the years, science has explained the world around us pretty well. Sure, there are still mysteries that one can hide their god in, but there are fewer mysteries. With this assumption (that god hides in the mysteries), one can see how religious folks can get defensive. Because if science ever does fully describe the real world around us (I doubt it ever can though) it doesn't give god many places to hide.
Evolution does imply a direction though. "Survival of the fittest" has a specific meaning. Fit does not mean more intelligent, quicker, happier, or better. It is just the ability to successfully procreate. By that definition fruit files are fitter than humans.
I may be overstepping my knowledge here, but I think that's not completely true. I think random drift, and/or change that doesn't affect fitness is still evolution, though I could be wrong.
If you had a population of birds that over several generations turned from black to brown, it could be that the black ones are less fit, like maybe a predator can see and eat the black ones easier, in which case it would be evolution in a direction, to get more fit and have better reproductive success.
It's entirely possible though that it has nothing to do with fitness and could just be luck of the draw. Black birds and brown birds could be equally fit, but the brown was just a dominant trait. I think that's still evolution, and is not in a fitter direction.
I think Gould would call that a structural constraint on evolution. Whether that is still evolution I don't know.
Either way, the AC was talking about evolution in terms of america getting dumber and less moral, or something like that. The equivalent there would be an animal getting dumber or slower, not loss of fitness. He seemed to be of the mindset that if an animal gets dumber, that's de-evolution, and that in this case, america is getting worse and is "evolving backwards," which we both agree is a misunderstanding of evolution.
I know this from having been to several meetings. The atheist community is one of the most bitter and spiteful I have ever seen and actively wish to see all "non-rational" belief systems torn down and replaced with their "belief" system on a level that matches any religion. Pure tribalism at its best, two sets of group-think throwing stones at each other. the Atheists attack christen beliefs and they attack the atheists through ID.
The solution to the problem is not the one shown on /. of armchair intellectuals decrying the ignorance of the bible belt hicks, while smugly reassuring each other that they have the "best" ideology. It is through an understanding of their actions and why they do them and coming to terms with them. Calling their text book stupid isn't going to get them to stop. I don't know what the solution is, but I know what it isn't.
I couldn't agree more. Also: if "freedom" is our goal as a society, they have the right to have their belief, and to belief that a symbolic religion is more important than science. That's "freedom."
This guy had a good take:
It seems to me that the neutral position is agnosticism.
Atheism, or asserting definitively that a God/gods do not exist, is making a similarly conjectural and unprovable/non-disprovable assertion to theism.
Anti-Globalism, Traditionalism, and FreeBSD.
The Bible itself was not dictated by God, nor is it a book of literal stories. They're mostly parables and mixed in with sometimes exaggerated historical stories. There's some good useful and insightful information in there, an amazing work for it's era. I see no reason why this conflicts with science. Except for the up to this point unprovable supernatural stuff. That is probably in there to describe an experience, state of mind, emphasis or merely as a learning tool.
Now, I've never understood anybody who said they believed in the bible but didn't take it literally.
Umm...
Aren't all religions symbolic? Why would you make a literal religion? Not abstract enough.
It's a type of communication, like a high-level language versus the language of details. Symbols mean things. Ever read C.G. Jung on this topic? The first chapter of "Man and His Symbols" should do nicely. Or Joseph Campbell.
I wouldn't take a work of literature literally, nor would I take a poem literally, nor would I take a politician literally except when they indicate they are speaking as such. It doesn't make sense to try to find a literal religion, unless you're a Scientologist.
Anti-Globalism, Traditionalism, and FreeBSD.
Pro-choice people don't force abortions on other people who are against abortions.
Pro-alcohol people don't force muslims and mormons to drink the stuff.
Pro-stem cell research people don't require you to have your DNA fixed.
Would-be parents with a serious inheritable disease don't force other people to have their embryo/egg tested.
Pro sex toy people don't want to force the use of the toys on other people who think sex is sin.
Gay people don't want to force you to have sex with a same sex person.
Nobody is trying to force christians to have premarital sex.
Nobody is trying to force catholics to use birth control.
Atheists are not trying to bully other peoples' children into saying out loud brainwashing slogans such as "one nation, god is imaginary" five times a week. (You are free to do your brainwashing at home.)
You are ignoring the fact that actions have consequences. While the Christian side tries to negate actions, allowing those actions to continue can have consequences too.
I'm not the one trying to stop other people from dumping toxic waste in their backyards, therefore I'm not the aggressor.
I am not attempting to defend Christians or attack them, but I detest bad argument.
Anti-Globalism, Traditionalism, and FreeBSD.
Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.
I'm not particularly religious (I'm agnostic), but to be fair, there is sanity in a non-literal interpretation of the bible, if you are going to choose to believe in it at all. Let's say you were God and now you wanted to talk to Moses about how you created the universe.
God:"I created the universe, but in the beginning all space and matter were condensed in an infinitely dense point."
Moses:"I'm not sure I understand, Lord...
God:"Well, all dimensions, length, width, height...as well as all the energy in the universe today, it was all condensed in a single point of zero size, making it infinitely dense. All the forces, electromagnetism, weak and strong force, gravity, they were unified into a single one...oh, fuck it. There was no form to the universe.
Moses:"No form. Gotcha."
God:"One planck-time after that, the forces began to separate, gravity became weaker...oh, nevermind, lemme skip ahead. Hydrogen and Helium was formed, gravity caused it to coalesce into giant spheres and eventually nuclear fusion was ignited as a result of the strong gravitational force creating heavier elements.
Moses:"'planck?' 'Hydrogen?' 'Helium?' 'Nuclear fusion?' 'Elements?'
God:"Sigh...stars were created"
Moses:"How long did it take for that to happen, Lord?
God:About 100 million years...fuck it, you can't really understand these sort of scales. Let's say a day. The universe had cooled down after the initial expansion period, and it had darkened before the first stars were formed. But then there was light...
Essentially, if you're a really advanced being explaining complicated things in layman terms so that they may be read by others and somewhat understood without years of training at their current level of understanding...you use metaphors. We do that today. Look at any science article in a newspaper and it's going to be vastly different and outright incorrect as compared to the actual journal article. The journalist doesn't understand the science, so the scientist uses all sorts of metaphors. The journalist understands the metaphors but not the science, so when he expands to write the article, it will have completely wrong conclusions (scientist performs experiment where group velocity of a laser exceeds speed of light, uninformed journalist writes article with, "Einstein proved Wrong!" headline)
Basically, if someone tells you that they believe in a non-literal interpretation of the bible, don't attack them. They're by definition much more open minded than the other variety, so just respect them for their choice. If they want to include God in a science classroom, by all means stop them, but any personal beliefs that don't directly contradict evidence is their own personal business.
Legs don't really work at the microscopic level. Which puts it in the "highly unlikely" level. Specific pigmentation.. Unlikely again, due to the size..
And as for proof, you only need to prove it does exist if you hypothesize that it does. You only need to disprove it if you hypothesize that it doesn't.
If you think that the question of it existing is entirely irrelevant (which is, as things stand at the moment for humanity), the only sane thing to do is entirely avoid trying to answer the question at all.
If it helps you sleep at night, you're quite at liberty to believe that it does. And I defy anyone to prove (with current technology) that it specifically does NOT exist. That's the point of science. You get a clear cut answer without bias.
As for agnosticism not being good enough in your books, then, I'm afraid that makes you a zealot in your beliefs. If you choose to believe that there is no god, then fine. That's your choice. But really, I want to see some hard evidence (not just saying 'the bible has inaccuracies, therefore there is no god', as that really is not a logical conclusion, for the same reason it can't be used for the proof of existence of a god). Go for it. Mathematical proof and/or full experimental workings.
I know that the best I can do will neither prove, nor disprove the matter. The best of the scientists we have on the planet can neither prove nor disprove. To me, that makes the matter unsolvable by science, therefore it remains an article of belief, which is not subject to science or logic, therefore, it's not something I want to spend forever getting hung up over, or have fights about.
Personally, I find agnosticism to be the most satisfying path. If the atheists are correct, then they never get to tell me "I told you so". If the religious are correct, then one small group of people get to thumb their noses at the rest of the world and go "nyah nyah" for eternity, as they were the only ones that got the right god. Which would be distinctly embarrassing for most. Especially if it was a fringe cult that had only a handful of members that got it right. As an agnostic, I just get to say "Phew, that's a relief. Oblivion for sentience is a kinda harsh thing to truly take on board without needing something to shore up a damaged psyche".
I participated in a seminar about ID in my college. The PBS site has a set of movies which offer an interesting insight into the debate.
PBS Nova
and why do you think only monks and religious figures could read and write?? because anyone else was deemed a heretic and burned at the stake.
He's also forgetting that all the major religions of the day ruthlessly suppressed any scientific or technological advance which didn't fit into existing religious dogma (most of it, in other words.) Unless, that is, they could personally profit by that knowledge. That really was my point, which Smoker2 completely misunderstood. They may very well have been the geeks of their time (although no true geek would have behaved that way), but they were also, by and large, selfish pricks who deliberately held humanity back for a very long time.
Fact is, with the head start the Greeks and the Romans gave us, we should have gone a lot farther in a lot less time than we did. There are many reasons for why we didn't, true, but the Church (pick one) did it's part to keep us in the Dark.
The higher the technology, the sharper that two-edged sword.
Now, I've never understood anybody who said they believed in the bible but didn't take it literally. What. The. Fuck.
OK, how about: "I believe in The Complete Works Of Shakespeare, but I don't take it as a literal historical document." Say what now? What does "believe in" *mean* then?!
If I were to tell you that it was raining cats and dogs outside, would you not believe me that it was raining? Just because you don't believe that there is actually dogs and cats falling from the sky doesn't mean you can't believe what I said was true.
I would agree that random mutations are part of the evolutionary process. Some confer no advantage or are detrimental but in the classical sense (the Darwin not the Wallace model) progress in terms of evolution must mean the ability to pass on genes. I do agree that in a general semantic sense you are probably right, if by evolution you mean any change in an organism over time. As for Americans getting dumber, well that seems to fit.
Time flies like an arrow. Fruit flies like a banana.
the argument of young-earth Creationists is that macro-evolution and a billions-of-years-old universe is NOT provable fact
Erm, yeah... http://slashdot.org/comments.pl?sid=977815&cid=25174421
The existence of God clearly falls completely outside the realm of empirical science
And therefore falls outside the realm of the observable universe which is tied to things like cause and effect. And therefore is not in the universe. And therefore does not exist. No flaw in the understanding of science here, mate.
If god exists, it is only as an outside observer, and undetectable. If he is not just an observer but is actively "involved", his actions will be scientifically measurable in SOME regard, most likely by some heinous breach of the laws of thermodynamics.
So, either he doesn't exist, or he does but exerts absolutely no control over anything in the universe, including doing things like talking to humans and writing on clay tablets -- and by definition therefore, all religion and understanding of him does not come from him.
Perhaps you need to think that one through a bit more and see how illogical your statement is.
Would you call their work unscientific?
In that paragraph you managed to commit several crimes against logic. I emplore you to actually think about the words you've written.
Why would you assume that anybody would be so stupid and bigoted as to disagree with everything an individual says, on the basis of a certain unrelated characteristic or opinion? Newton could have dedicated his life work to an anally prolapsed ferret for all I care -- his work stands for itself.
I find that most people who are offended by religion in general (as opposed to being offended by some specific aspect of a particular religion) completely misunderstand what religion is
How amazingly confused you are by reality. Seriously now, run that by me again? Seriously?
I know exactly what religion is. I come from a deeply religious background. The foundation of religion is clinging to superstitious and unreasonable beliefs and fairytales. Religious people can turn that into any number of good and bad things.
Religion is offensive because it promotes false belief and false motives. There are many things which people should just get over and tolerate, but I do not consider the active choice to hold false beliefs, as one of those things.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
If the supernatural exists, it is a part of nature, and, thus, natural.
The supernatural is, by definition, not a part of nature. The God that created the laws of physics cannot be measured by them.
Many religions (inlcuding Christianity), however, has the rule that their god frowns upon any attempt at proving their existence. Pretty convinient, huh?
The problem is not that God doesn't want to be proven to exist, but that He hasn't sent any physical proof into our world in the last 2,000 years, and that was long enough ago that nobody believes the people who actually did have proof at the time. One passage that comes to mind is the second chapter of the book of Acts, where Peter addresses a crowd and says essentially "you know this is true, because you have seen it." At the time, the miracles performed by Jesus Christ weren't myth or superstition, they were actual events that many people witnessed themselves. However, because there was not a culture of documenting such things in writing, most of them didn't write it down. No measurements were taken, no scientific study was done, because at the time that just wasn't thought of as being important. A lot of what we do have is letters that were written with the expectation that the recipients would have full understanding of the context in which they were written, which isn't true today.
God will reveal Himself again one day, in a way that can be directly observed and measured. Until that day, there can be no proof.
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
...Any time you have evidence that the Earth is older...
To ascertain age, that is to measure time, you have to have a clock. You also have to assume (believe guess) that this clock has ALWAYS ticked at the rate we observe it ticking today. That assumption may or may NOT be correct. It still is and will forever remain an assumption and NOT a measured observed FACT of science.
It just happens that the majority of assumers (believers) labeling themselves scientists BELIEVE that it has ALWAYS ticked at the same rate we observe today. That may be correct, but it still only belief.
If the time yardstick is made of metal or wood, constancy is a reasonable assumption. Since we don't really understand time, how do we know the time yardstick isn't like a rubber band that once was highly stretched and has relaxed a lot by now? IF that is the case, and it could be true, then all time guesses into the past based on the present could be WAY wrong.
All theory is gray
Pro-choice people don't force abortions on other people who are against abortions.
Sure they do, if you take the view that a fetus is a person.
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
Your logic is utterly and completely flawed. From reading your other posts, it's quite evident that you lack the ability to understand sound logic for what it is. Everything you read and write goes through several different mental filters which ruin the meaning. You adhere to many vastly incorrect assumptions. I'm sorry, but I just can't help you there.
But really, I want to see some hard evidence
You do NOT *prove* the nonexistence of something. That's not how logic and reason work. It's the other way around. You prove the existence of something, and you prove that an interpretation of something is correct.
The corollary is if a certain phenomenon is observed but not enough facts are known, a hypothesis is formed and tested, and supporting evidence is sought.
There is no such "phenomenon" in the universe that can lead any logical or sane person to hypothesize about the existence of a god. Nothing in the universe points to this. Everything has cause and effect. The effects whose causes are not yet understood still do not point directly to anything resembling a higher being, and therefore it is entirely erroneous for such thinking to enter the process.
The only truly BIG question we have, and will always have, is how the universe came about in the first place. We aren't guaranteed to ever work this one out because the concept of information itself is not valid past the big bang. This *still* does not point directly to the existence of any being. It is merely an unanswered question, and only the lazy mind will lean back to a vague and untestable concept in order to satisfy their curiousity.
I'm afraid that makes you a zealot in your beliefs
There's nothing wrong with being zealous. I'm a zealot in my belief against homophobia. I'm a zealot in my belief for integrity and truth. I'm a zealot in my belief for many, many things, and my belief against stupidity and lack of reason and proof is just one of those things.
Now, as for your last paragraph, in order to merely state those points of view, betrays a phenomenal amount of ridiculous assumptions and ignorance.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
Yeah, you probably missed the point of everything I said about "believing in" it. I read Arthur C. Clarke books. I learned a lot from them, but I can never say I "believe in" them. If I were to take any of his stories as fact, I would be a fucking idiot -- because they're fictional and they never happened.
Do you see the correlation?
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
Right, so if you don't take it literally, you can't believe in it. By definition. Make sense now?
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
In your example, there are certain aspects which simply MUST be taken literally. Such as the existence of god and that he's talking to someone. Simply put, it would be preposterous to believe that assumption. Therefore, you can't believe in it.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
I believe your comment was a longwinded way of saying "it's all metaphor".
So, if the bible is all metaphor, what does god stand for?
Let me push this a bit further.
If you told me, "I just counted about 68 dogs and at least 93 cats raining out of the sky over the course of sixty seconds", I would know you're not just using a figure of speech, and I would probably be able to disprove it. The same is true for the bible, which states many, many, many things as factual. And even if you ignored ALL of that, simply accepting certain concepts presented in the bible, metaphor or not, would place you quite squarely in the realm of falseness.
It is simply illogical to state that you believe in the bible, because it is utterly impossible. You can say you enjoy the bible, or you learn from the bible, or any of those things, but stating belief in it is as ridiculous as stating belief in any other provably incorrect account of a set of events, or any other work of fiction.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
...I've met many creationists who, for example, thought that fossils were ...
Have you ever met an evolutionist who has actually MADE a fossil, rather than speculate about how they were made? If it cannot be duplicated in the lab or observed in nature TODAY, is is NOT science, but belief (assumptions). Adding lots of time does NOT solve the problem.
The word "assume" is the scientific code word for believe (faith). Can any evolutionist cite a "scientific" paper and its references, of major importance, of say more than five or six pages, that does NOT contain "assume", "believe" or similar expressions?
Science, like every human endeavor, has two components. Facts and belief. All of our lives are governed much more by what we believe than what we actually KNOW for sure. Scientific textbooks ought to carefully separate the facts of science from the beliefs of scientists. Facts should be stated as such, as should beliefs and interpretations of facts be labeled.
All theory is gray
That's nice. What's your point?
Anyone who knows anything about it won't tell you that the ages of things are established FACTs. The only facts in science are the observations. The conclusions drawn from them are not facts and are not considered as such.
The current assumption is that these clocks have remained consistent. This is because there has yet to be any evidence to the contrary, and because it's hard to get any useful results at all if they haven't. But this isn't treated as some kind of invariable fact the way fundamentalists treat the creation of the Earth in 4004BC. If something comes along to show that these clocks have changed through time then that will simply change the way things are done.
If you mod me Overrated, you are admitting that you have no penis.
They (atheists) I would aregue do care very much what other people believe. Just look at slashdot and the vitriol being poured by *drum roll* atheists. As far as your "lack of organization" theory, that's baloney.
No, I'm merely pointing out that in the modern world it is systematically ok to bash religion. People keep babbling the assertion that religion has no place except in its own "safe little box" yet are quite happy for science, and philosophy (and other realms) to go outside "safe little boxes" (as in only a loony would believe anything but what we think science/philosopy/etc tells us). It's a pathetic double standard, that I find very objectionable.
Does the word "backlash" mean anything to you..?
Science is not a collection of facts. Science is a technique to gain knowledge about the world.
Yes, "assume" is just another way to say "believe". Ask any good scientist about this and he'll admit that certainly the flow of time in the past could have been different. But in the absence of evidence for such a thing, the question cannot go beyond simple speculation.
Evolution is not a fact. It's "just a theory", an idea which fits the available facts extremely well and makes a great many accurate and useful predictions. That's all it is, and all it ever claimed to be.
If you mod me Overrated, you are admitting that you have no penis.
No, I'm merely pointing out that in the modern world it is systematically ok to bash believing in the tooth fairy. People keep babbling the assertion that believing in the tooth fairy has no place except in its own "safe childhood age" yet are quite happy for science, and philosophy (and other realms) to go outside "safe childhood ages" (as in only a loony would believe anything but what we think science/philosopy/etc tells us). It's a pathetic double standard, that I find very objectionable.
As long as it's your religion, right?
Some people, when they see bullshit, don't have a problem with calling it out. Others get offended when their sacred bullshit is called on. It's systematically ok to bash religion these days because for the most part you don't get killed for doing so anymore. For the most part.
kurzweil_freak
5th Kyu Genbukan Ninpo/KJJR student
Be the darkness that allows the light to shine.
And therefore falls outside the realm of the observable universe which is tied to things like cause and effect. And therefore is not in the universe. And therefore does not exist. No flaw in the understanding of science here, mate.
You're limiting your definition of "exists" to exclude anything that is outside of our physical universe. When you define your terms this way, of course nothing supernatural "exists".
If god exists, it is only as an outside observer, and undetectable. If he is not just an observer but is actively "involved", his actions will be scientifically measurable in SOME regard, most likely by some heinous breach of the laws of thermodynamics.
So, either he doesn't exist, or he does but exerts absolutely no control over anything in the universe, including doing things like talking to humans and writing on clay tablets -- and by definition therefore, all religion and understanding of him does not come from him.
Alright, that's fair. I would argue that the influences of the Holy Spirit are subtle enough that they cannot be measured (at least not practically - I don't mean that they couldn't be measured theoretically, merely that we don't really have a way to do it right now), but beyond that, God has not chosen to reveal Himself to us physically in the last 2,000 years. That's not a permanent situation; God will reveal Himself to us again - but not even Jesus Christ knew when that would be. Unfortunately in the mean time, we have nothing to measure.
The other issue is that God usually uses natural phenomena to achieve supernatural goals. God exists outside of time, which means if God wants to cause something to happen tomorrow, He can set events in motion thousands of years ago that will culminate at that exact point - no heinous breach of thermodynamics required. For this kind of event, the only thing that makes it supernatural is the prophecies foretelling it and the significance ascribed to it; the event itself is a natural event.
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
As for Americans getting dumber, well that seems to fit.
Well... at least we've evolved past burning women at the stake for being witches.
I'd just like to point out that the existence of a theory of evolution does not, in principle, exclude evolution from also being fact. After all, it is a theory about a process that is proposed to exist in nature, and if it does, it will continue to be true to its nature whether the theory is correct or not.
Ultimately, science and religion must converge to whatever the ultimate "truth" is. Some may say that reality is subjective (as New Agers seem to be fond of believing), but as long as there is a real world to know anything about, it must be the ultimate arbiter of knowledge. Theories and beliefs that don't jibe with reality will eventually get thrown out, either methodically (as with science) or through attrition (as with religion). Religions evolve too; they arise, change, split, and go extinct all the time.
"Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
Good point about evolution being a fact. It may or may not be one, but the evolution that scientists talk about is not a fact of evolution, but a theory.
As for religion and science converging, it seems like crap to me. Science is the realm of what is, religion is the realm of what's beyond. They are essentially unrelated and ought to stay that way.
If you mod me Overrated, you are admitting that you have no penis.
Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.
This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.
How can we "prove" evolution? I want to see it in a lab.
It's all about one religion vs. another... One God, multiple gods, or none. Big Bang, Steady State, Punctuated Equilibrium, et cetera ad nauseum... You're all just monkeys throwing feces at each other...
I'd like see folks just up and admit their presuppositions before using all of the personal attacks on those who disagree with their pet version of How It All Started(tm).
Believe what you want about it; but since it cannot be duplicated, objectively measured, or recreated, please have the decency to avoid calling it "science".
All of you.
One nitpick... the Louisiana law doesn't "mandate that it be taught in school".
No, because it's pretty much been going on for far too long to be considered a backlash.
Interesting but rather lame attempt at quotation. Oh, and as far as bs is concerned, science and philosophy is full of it, so don't try and claim they are somehow "higher" or "less fallible" than other human constructs. Just see what Chandrasekhar had to go through as one example of how science "works" in practice.
You can't prove evolution. It's the nature of scientific theories that they can never be proven, only potentially disproven. Young-Earth Creationism is not science because it's not falsifiable. That is, in a hypothetical world where it's wrong, there is no conceivable test which can show it to be wrong, because any result can be explained by "God did it". Whereas in a hypothetical world where evolution is wrong, there are plenty of tests which could disprove it.
If you mod me Overrated, you are admitting that you have no penis.
So, that explains the success and also literacy of fun pagan cultures like the Norse and their offshoots. It was all the monks fault. And of course the Chinese, Indians and Mongols were all kept in ignorance by Christian monks. Please tell me you have not had a formal education in history. For if you have, I'd have to ask you to go back to your teachers and ask to have your class grades changed to fails.
I tried to find a link here which would dice the EE book into little pieces but, I could not find one. The only review linked appears to trash the teaching methodology, not the content. Where can I find a review of the scientific content, or lack thereof?
...This is because there has yet to be any evidence to the contrary....
Well there is evidence that the electromagnetic properties of the medium of space itself have indeed changed over time. This would demand that certain numbers, assumed to be "constants" have changed as well. One of these is Planck's constant which is measured to be smaller today than when it was first measured. Light-speed is related inversely to that. That means light moved much faster through the medium of space, when the Universe was very young, small, dense and hot. Just as sound travels faster in rock or water than in air, so too light traveled faster through a denser Universe.
There is evidence from past light-speed measurements using a gravity time-base, which have shown a decrease since such measurements were first done in the early 1600s. When an atomic time-base clock is used, this is not seen, since the product hc appears to be truly constant, with h and c moving in opposite directions. If a ruler elongates at the same rate as a distance to be measured by it, the distance will always be measured to be the same, even though it really is changing. Gravity equations have neither h nor c in them. Therefore, any clock based on gravity will not be affected by the changes in h or c and measure them directly, without any correction factors needed.
Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected. So there IS evidence that call into question the belief that these "clocks" are truly constant over time.
It is interesting that it possible to determine the approximate, highly non-linear function of the slow-down of the speed of light over time. If that correction is applied, the time scales given by the Bible and those given by the atomic clock measurements of radioactivity are not nearly so far apart, so they cannot be attributed to simple errors in measurements and biblical interpretation. The billions and millions shrink down into the range of only thousands.
All theory is gray
From the 'review': 'What follows is not a comprehensive examination of the information contained in the text (which would require more text than EE itself), but rather a summary of the history and politics that make the book significant, and my own perspective as a biologist on how that context produced a text that's wildly inappropriate for use in a science classroom.' Why do you say 'a review shows it to be chock full of bad science and questionable reasoning', in light of the above admission that the reviewer isn't even actually reviewing the book?
Says the person typing on the computer that was conjured up by prayer. Oh, what? You aren't? Science you say?
Science works, bitches.
kurzweil_freak
5th Kyu Genbukan Ninpo/KJJR student
Be the darkness that allows the light to shine.
...But in the absence of evidence for such a thing...
I will include a portion of a reply I made earlier on this subject.
There is evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time. This would demand that certain numbers, ASSUMED to be "constants" have changed as well. One of these is Planck's constant which is measured to be smaller today than when it was first measured. Light-speed is related inversely to that. Light moved much faster through the medium of space, when the Universe was very young, small, dense and hot. Just as sound travels faster in rock or water than in air, so too light traveled faster through a denser Universe.
Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected. So there IS evidence that call into question the belief that these "clocks" are truly constant over time.
All theory is gray
...Ultimately, science and religion must converge to whatever the ultimate "truth" is...
Scientific FACT and interpretation of these facts are two entirely different things. What is actually written in the Bible and how it is interpreted are also often quite different.
Nobody has ever demonstrated a scientific fact to be in conflict to any actual written statement in the Bible. The interpretations of both often do conflict greatly however. Therefore, scientific and biblical TRUTH are NEVER in conflict, only the opinions of men about the meaning of both. Scientists do and of necessity have to make certain assumptions (beliefs). If these assumptions are wrong, then the conclusions will also be wrong. Using computers only obfuscates and/or amplifies the errors.
All theory is gray
...but the evolution that scientists talk about is not a fact of evolution, but a theory...
Exactly right! Why then do most text books present it as fact? Why is then so objectionable to present ID as just another theory as well? After all, both are only theories trying to explain the actual facts we observe and measure.
All theory is gray
Social evolution is another can of worms.
Time flies like an arrow. Fruit flies like a banana.
...Plate tectonics is a theory... we test it often....
Yes, indeed, scientists observe California move a few inches and then extrapolate that movement and come up with utter crap stating that in x number of millions of years California will be next to Alaska. They assume (believe) this rate will be or has been constant for all that time. They do this backwards in time also. It can be observed that the continents sort of fit together like a huge jigsaw puzzle. What cannot be derived from this however is the time scale over which this continental drifting took place. This assumed, not measured or observed. Assuming that rate of present processes can be applied over vast time scales may be correct, but it is nevertheless an unprovable assumption. Most processes observed in nature today are neither linear nor constant.
It is quite conceivable, that when the earth was younger and hotter, the underlying layers where more fluid. This would mean that the continents moved much more easily and faster than we observe them to be doing today.
All theory is gray
..i suppose you think coal can be made in 4000 years as well?...
Why do you think it can NOT be made in that time or less? After all we can make charCOAL in hours today. We can make oil out of vegetable and animal organic matter in hours or days also. What evidence do you have that it MUST take millions of years to do these things?
All theory is gray
....By all human measurements, the rocks will appear to be hundreds of thousands of years old...
Shortly after you were born, someone tattooed a ruler onto your little body. It is the only ruler anyone has. Therefore you are still only as tall as you were then, as measured by that ruler.
Scientist measure time by the atomic clock. They assume (believe) that this is an independent standard of time measurement. The problem is that they don't know that this standard of time changed right along with the growing universe. The nature of space itself demands, as evidence shows, that the ruler of time, not time itself, must change as the universe expands, just as the ruler tattooed on a baby would.
All theory is gray
...I believe that light travels (roughly) 186000 miles per second...
Can you prove it ALWAYS did travel at that speed for all time? No? Well then, maybe it travelled much faster through a smaller, denser Universe than we measure today? Maybe sort of the way sound goes much faster through a denser medium, such as water than through air? Could that be possible? Is there any evidence of this?
All theory is gray
...they risk being proved wrong by scientific evidence...
Be careful not to confuse hard facts with the interpretation of these. There are NO hard facts that prove age one way or another. Both are based on certain assumptions (beliefs). Only scientific and biblical interpretations are in conflict. The facts are not.
All theory is gray
I LOVE how you spout off for pages about shit you don't understand!
The fact that you can keep going on and on saying "well it MIGHT NOT be true! All the evidence could be WRONG! Didja ever think about that? Huh? The scientists don't have a clue what they're doing!!"
It really is quite impressive. I'm no expert in these areas, but even I can see you're grasping at straws, parroting back all the old creationist bullshit.
Just stick your head back in the sand, cover up your ears, and go "LALALALA!!"
..."Creationism", for those who think magic is involved...
Evolutionists believe in magic also. By their magic, a frog, or even a rock can turn into a handsome prince.
Here is how their magic works:
When children are small, we often tell them about Santa Claus, fairies, hobbits, trolls, witches, ghosts, goblins and a multitude of other mythical creatures. Some of these have magical powers that can help them accomplish impossible tasks. Magic can spin straw into gold and a kiss can turn a frog into a prince. However, children grow up, and learn that all of these tales are not really true, but imaginative fiction. There is one tale however, that continues to be told repeatedly and with ever increasing imagination and detail all the way through the highest degree a university can bestow. It is a tale that public educators try to make even adults believe that it really happened "once upon a time", not in a galaxy far, far away, but right here on our own planet.
In many of these stories we have magical tools, actions or words, such as wands, kisses, rings, incantations, swords and almost anything else that can help the hero or villain accomplish otherwise impossible tasks. In this modern tale, there are only two magical things. One of these is chance. The other one, by far the most important and powerful magic, is time.
Let's exmine, how these magical twins can turn, not only a frog, but even a rock, into a handsome prince. Children's stories often begin with "Once upon a time...." This tale is similar. You can find the intoning magic words: "Billions of years ago...." in big thick books with lots of fanciful, beautifully done illustrations. It is amazing how often the word "assume" is found in these authoritative appearing tomes. "Assume" is a more educated way of saying "believe", but when you assume something, you don't know it, but are guessing.
Somewhere near the beginning of such books you can read: Billions of years ago, ceaseless torrents of rain washed minerals from the rocky (minerals come from rocks) land and other compounds formed by the aid of innumerable lightening bolts into the pre-biotic soup (Campbell's?) of the warm seas. There these compounds, bumping into each other, by chance over time, made larger molecules called amino acids. These are the basic building blocks of all life, sort of like the bricks of a house.
After more time, (magic) these amino acids and other components organized themselves into single celled organisms, such as simple (actually very complex) bacteria. Some of them called algae, in time evolved to use sunlight to get energy. Green algae are part of the plant kingdom. In the course of millions of years, algae turned into roses, sunflowers and 300 foot tall redwood trees as well as all other plants we have today.
Some of these bacteria and other single celled organisms floating around in the lukewarm oceans, again by chance, came together as beneficial co-ops of multi celled groups. By unknown means or the magic of chance, over time, some of these became animals such as worms, snails and millions of years later, (a lot more time) some of them became fish.
Some of these dwellers of the sea, after several million years, got bored with the ocean and were able to also live on land. When the tide went out, some of them were left stuck on the beach. Somehow, maybe by trial and error (chance) some did not dry out, but figured out (smart, because they had brains already) how to breathe air for a while. Creatures that can live both in the water and on land are called amphibians. This is where the frogs come in.
After more time, some of these left the water and evolved to live entirely on land. They found they could also make a good living there, eating plants and each other. After a lot more time some even figured out how to fly. The Wright Brothers copied them and made the first airplane. They had first been insects or reptiles, some of which could fly, but then after more time, evolved into birds, which are much better fliers, partly
All theory is gray
Speaking as a guy who went "All the way", in my science education and then some, let's not get carried away piling on to the creationism debate. I mean, look at water. Its dielectric constant is 81 friggin times that of free space. This compresses the Debye length so that intermolecular interactions are suppressed outside a radius corresponding to typical amino acid's molecular diameters. Lucky break allowing life on earth to exist or divine plan? I'm not religious, and I believe Darwin got it right, but I also keep noticing, and marveling at how "lucky" we are, how perfectly things worked out for life to exist and all. Really people, some humility, and awe, are called for here, whether you believe in a creator or not.
Such as the existence of god and that he's talking to someone.
There's a reason I started my post by saying "if you are going to choose to believe in it [the bible] at all." My point was against your claim that you can't believe in something and at the same time not take it literally. My example proves that you can do just that, and that it is in fact more rational than taking it literally.
Simply put, it would be preposterous to believe that assumption. Therefore, you can't believe in it.
That brings me to another point in your original post, when you claimed that "Nah mate, science and Christianity are NOT compatible, so long as Christianity promotes any kind of belief that is either at odds with provable fact, or is not supported by any direct evidence."
That is incorrect, and shows a lack of understanding about the scientific method. Anything that is at odds with provable fact is obviously incompatible not only with science, but with rationality. However, science does not preclude the existence of things unsupported by direct evidence. It simply says nothing one way or another.
In fact there is no claim that all answers may be found scientifically. It's merely the best way to state things that we are sure of, and to minimize assumptions. We make observations, we form a hypothesis to predict behavior based on our observations, we test our hypothesis by seeing if any of our predictions are being contradicted. If the predictions have not been contradicted, we say that our theory fits current observations (but not that our theory is correct...nothing that is not directly observed is ever claimed to be true in science. We can only prove theories false, not prove them correct). If the predictions are contradicted, we refine our model.
If we have multiple theories that give the same predictions, Occam's Razor says we should prefer the simplest theory. However, here's a common misconception: that's not because the simplest theory will be the correct one. In the absence of data that differentiates them, you can't make that prediction. The actual statement is "entities should not be multiplied beyond necessity." In essence, if two theories are giving you the exact same predictions, why should you waste your time taking into account extra variables if the result is the same? It doesn't give you at advantages. The true mechanism could be the most complex theory, but without anything to differentiate them, there's no justification for being overly complex.
By that token, the reason ID should not be taught in science classrooms has nothing to do with the fact that science says god doesn't exist and evolution wasn't directed. ID should not be taught as science because by the scientific method, you can't test they hypothesis that "god guided evolution." And if it's untestable, it's not science, even if it's true.
Now, you and I have practical minds, and we're comfortable with the idea that god doesn't exist. So the whole idea of adding an extra variable to something that already works without it doesn't seem practical, and it violates occam's razor. We're adding things to a theory that already explains current observation, and it's not changing the testable predictions. So we don't need anything more than science after we leave the classroom.
Other people would simply be completely unable to function in society if they didn't believe in something else. Some people can't handle the idea of true mortality. If they believed that once they died, they wouldn't continue living an eternal life in heaven they would become paralyzed with a fear of death (my mother would probably have committed suicide the first time one of her siblings died if she believed that they were completely gone). So religion actually helps those people. As long as they're not denying evidence to the contrary, they're not even being irrational and they're not contradicting science. They're being impractical, but he
As an ex-christian I'll help interpret for you. Since I understand both sides of the fence.
I'm an ex-catholic turned agnostic, and I'm a bit curious about your explanation. From what you said, from personal experience, being certain that you were right brought you a lot of happiness. Any uncertainty brought you pain. That leads me to two questions:
What exactly brought you comfort from your beliefs? I turned agnostic because I never really had the warm fuzzy feeling from the whole god thing. Was it just a fear of mortality, and the certainty that you wouldn't "die" and instead would lead an eternal life of bliss? I guess that's why I never got the happy feeling, I really don't find anything to fear from fading into nothingness. It's nothingness, how can you fear something you'll never experience?
Since you did get the "beautiful all enveloping right-hemisphere of the brain oneness with God" religious experience thing that I've never had, what exactly made you stop being a christian?
Warning: Opinions known to be heavily biased.
Can you prove it ALWAYS did travel at that speed for all time? No? Well then, maybe it travelled much faster through a smaller, denser Universe than we measure today?
Is there any rational reason to suspect that it did? Is there any evidence for such a thing?
Of course not.
You keep insisting on idiotic things because you are desperate to believe a very stupid old fairy tale.
That makes you both sad and pathetic. It does not mean that you've raised any valid points. You haven't.
So that would be the Slashdot Bukake website?
Have to go scrub my brains out with bleach now.
Down With Slashdot BETA!!! I've been around the corner and seen the oliphant; you can only abuse me from your perspecti
I still don't get the Jews connection with embryos.
Just for a second, look at this from the other side. There we hold that embryos and fetuses are human beings. You say I shouldn't be concerned if other people are killing human beings as long as I'm not killing them myself. Imagine that we were talking about four-year-olds. Would you remain silent while one sector of your society slaughtered all four-year-olds who didn't meet a certain standard?
The real non-sequitur here is the whole miscarriage argument. No one (except apparently you) thinks that a miscarriage is the same morally as an abortion. There is no free decision to kill a living being in a miscarriage. It's like the difference between your four-year-old son dying of cancer despite your best efforts to heal him and you pulling out a pistol and shooting your four-year-old. They are not anywhere near related.
As for embryos in Heaven, we really have no idea what will happen there. Some medieval philosophers held that the soul was created at some point after conception, so that, while maintaining that abortion was always evil, the question of the destiny of these souls is moot. However, I don't really see that position as tenable today, given the state of our knowledge of embyology, and would see conception as the only real moment where the creation of the soul could occur.
Oh, if the pharmacists gives the money he earns with the sale to a charity, he may save the life of a kid in Africa with it.
And I suppose if the guards at the concentration camps gave their salaries to a charity to save the life of a child in Africa, that would make it O.K., too... The Nuremburg courts wouldn't have agreed with you there.
Right, so if you don't take it literally, you can't believe in it. By definition.
I don't think you understand.
Metaphors can describe reality as well as literal texts, and unlike literal texts, they describe it in abstraction and can remain accurate over the centuries as varying scientific ideas come and go.
(See how much the ancients knew about science that we didn't know they knew -- The Ancient Mechanics and How They Thought at the New York Times)
This is why you can believe in them more than you can believe in literal texts; a literal text is detail work you need proven, a metaphorical text is a theory in abstraction.
Anti-Globalism, Traditionalism, and FreeBSD.
Holy crap; I was joking, but some other commenter replied to you saying the same shit, but absolutely seriously.
Apparently plate tectonics is *also* disputed by the creationists, and subject to the same muddy "theory" attacks? I guess it must be, though I hadn't thought of it... after all, it's yet another pile of evidence that points to an earth much older than a few thousand years.
Yes, indeed, scientists observe California move a few inches and then extrapolate that movement and come up with utter crap stating that in x number of millions of years California will be next to Alaska. They assume (believe) this rate will be or has been constant for all that time. They do this backwards in time also.
Once rock is forced up to the surface, it doesn't weather the same as rock still in liquid (or solid) form under the surface.
I'm no geologist, and I came up with that just off the top of my head. Why would they assume constant movement? They can't, so they have to correlate those observations with other sources of data to come up with any kind of extrapolation.
We have far more ways of gathering data on the plate movements than just taking California's movement over a few years and extrapolating to millions of years.
It can be observed that the continents sort of fit together like a huge jigsaw puzzle. What cannot be derived from this however is the time scale over which this continental drifting took place. This assumed, not measured or observed. Assuming that rate of present processes can be applied over vast time scales may be correct, but it is nevertheless an unprovable assumption. Most processes observed in nature today are neither linear nor constant.
It is quite conceivable, that when the earth was younger and hotter, the underlying layers where more fluid. This would mean that the continents moved much more easily and faster than we observe them to be doing today.
Sources?
Follow-up: I did 30 seconds of research and pretty much confirmed my guesses -- the plate tectonics concept sat on the shelf for years because of lack of solid evidence... until the 1950s, when we developed methods of mapping out the ocean floor, which held a lot of clues.
I can't believe I'm going to bite on this... but that would be a water hypothesis... not a theory. It's not provable or disprovable (or even testable) and therefore is not a theory.
I should also mention that it's not even a hypothesis, not in scientific terms.
A hypothesis must be a reasoned explanation of existing observations that IS testable (but not yet tested). It has to be coherent and not already disproved by existing evidence.
"Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof", The fact that that statement is, in its entirety, regarding the same subject matter. Not even as two separate sentences, but merely separated by a comma. But more importantly, that the 2nd part clearly reveals the writer's "defense" of religion. Is what reveals that the intent in saying "no law respecting an establishment", was to ensure 1 of 2 things. Either it means that Congress can't force the citizens to deny their religion for a single, national religion, established by the state. Thus protecting the freedom "for" the religions practiced by citizens. Not elimination of religion from all public institutions. Or, it means that Congress will make "NO" law!!! Regarding(respecting) an establishment of religion. Such as a law prohibiting the establishment of the citizens religion. I makes sense. Congress can't prohibit the establishment of a religion, "or prohibit the free exercise thereof"! It makes even more sense when one adds the reason for the pilgrimage from England of the persecuted(prohibited) original settlers. Also, the fact that during the Revolutionary War, Congress, were nicknamed "The Bible Congress". "Separation of church and state", has also been misinterpreted. It was amended in the 1800's as a result of the massive waves of Catholic immigrants from Europe at the time. The predominantly Protestant population in America, knowing the history of Europe. In which every time a nations rulers were Catholic, it was in fact, the Vatican who truly ruled that country. The amendment's intention was to prevent a repetition of that history. Otherwise, it makes no sense that a religious majority(by far) populations' representatives. Would amend something equivalent to "shooting themselves in the foot". This would be highly unlikely, since Protestants' history, is one of placing an emphasis on being a learned people. It was the Romans who outlawed reading! Besides, the notion of that "ID" science is somehow the promotion of some religion, is absurd. It does two things. It reveals the scientific data discovered, which exposes evolution as the hoax that it is. Since if they don't, who will? Evolutionary scientists are the ones whom have, numerous times, morphologically evolved their theory to accommodate the new, damning, empirical data. The theory, is the only thing that has evolved by extensive mutation. Appropriately enough! Also, ID science reveals the often times found in nature, extremely improbable, if not impossible. Particularly configured existence of many things, if intelligent design were absent. The "very real" science which ID'ers have drawn attention to in recent years. Is science of which its validity is made evidential, from the fact that its the reason why Dawkins went on a religion intolerance, hating rampage. That when science is obviously burying evolution, the strategy was to attempt to first bury evo's only real competition. Thus, evo would gain indirect, pseudo validation. Even the existence of Atheism can't escape the truth of Gods existence and couldn't exist without him. For if he didn't, what would there be to attach the "A" to?
I'm trying to communicate. And I thank you for your response.
My point is that the "value" of an embryo/foetus increases during pregnancy. Yes, like the woman you mentioned, the women I mentioned were struck by their miscarriages. But I'm sure that if they'd lost a baby, they'd visit the grave frequently. I doubt they still know the dates of their miscarriages and they are not on the calendar which apart from birth days contains the date of departure of deceased family members (sorry, struggling with English here). I've never heard of a woman mourning over the fact that she was a week late with her period. Just some disappointment. So, I think I've provided you with the foundation of my statement of increase in "value" (for lack of a better word. Don't take it as dollars, or something).
I certainly don't think that a miscarriage is morally the same as an abortion. Per the above, a fertilized egg is less "valuable" than a 3 months foetus and that is less "valuable" than a baby. At some (early) point it is acceptable to be outweighed by other circumstances and an abortion may be acceptable. As an example of the relevance of circumstances, in case of rape I'm fine if the point is a bit later.
If you're think that the soul is created at the moment of conception, then I don't understand your problems with the pill etc (as taught to you in school). Woody Allen (for once I thought him funny) told a joke that he was involved in a case of anticonception. He asked a girl to sleep with him, and she said no.
I'm sorry to learn that you misunderstood my donation example, but then I certainly was indirect there. I was trying to mock the pharmacist for not putting equal weight to human lives as such. A life involved in an issue of religious debate is more important than a life elsewhere where life just plain sucks.
Bert
TO: All
RE: Timmer's Polemic
First off, I have not had read the book in question.
However, after watching all the fun and games the Democrats have had with passing bad information on thinks like Palin's library book ban and such, I've learned to be a little suspicious of polemics from ONE SOURCE.
And I notice how Glenn 'Instapundit' Reynolds has behaved on this matter like most of the Democrats have with regards to reports about Palin, accepting it without critical thought. He gets SO MANY BOOKS and apparently looks at them. So why doesn't he get THIS book and look at it before he buys this report passed on by Slashdot from someone obviously on a tear?
Regards,
Chuck(le)
[On man tells a lie and a thousand repeat it as the truth. -- Ben Franklin]
P.S. Not that Timmer is wrong, but I don't know him well enough to trust him on an important matter. Something I learned from the US Army Command and General Staff Course during the Intelligence Preparation of the Battlefield (IPB) phase. Has to do with accuracy and reliability.
If you're think that the soul is created at the moment of conception, then I don't understand your problems with the pill etc (as taught to you in school).
The problem with contraceptives is (in general) unrelated to the abortion debate. Although most instances of "The Pill" have an abortifacient effect if taken after conception. Since we're pretty far off topic here, I'll just appeal to "Humanae Vitae" by Pope Paul VI, which explains the moral problem with artificial contraception.
I think I understood your point with the pharmacist, but if you really believed you were facilitating a murder by dispensing a drug (position of the pharmacist), would you do it, thinking that you can donate to a charity and save a life somewhere else, so that the world will not be plus or minus a life? I wouldn't find that all-too-acceptable.
A wizard did it. I mean, an almight god[dess] did it.
Tom Swiss | the infamous tms | my blog
You cannot wash away blood with blood
Exactly right! Why then do most text books present it as fact?
Because it is burdensome and redundant to preface every single topic discussed in a science textbook with "this is not, and cannot be, proven, it is simply believed to be true to the best of our knowledge at the time this text book is written." Much simpler to talk about the nature of scientific investigation somewhere near the beginning and let that inform the rest of it. That's certainly what all of my high school textbooks did.
Why is then so objectionable to present ID as just another theory as well? After all, both are only theories trying to explain the actual facts we observe and measure.
Because ID, not being falsifiable, is not a scientific theory at all.
If you mod me Overrated, you are admitting that you have no penis.
No, that would not be acceptable. A hero could rescue a child from a pond and then have the right to kill another? Of course not.
The point I intended to convey is that if a life is a life, the pharmacist should be equally concerned with both ways a life gets lost. And it is my hypothesis/suspicion that the pharmacist isn't equally concerned, supported by the "would he spend (the) money on saving the life in Africa" argument.
Back the drug. The pharmacist doesn't know the position the parent(s) are in and should not impose his judgement. (BTW Drugs to induce abortion are prescription drugs, not over the counter drugs).
About the pope. He doesn't have a hot line with god. And then, which one with thousands of religions and multiple thousands of gods. I guess all religions claim to be right despite being contradictory, so which one are we to believe. Why not ask the Dalai Lama instead? As far as I'm concerned, the pope, queen, the professor, the janitor, the baker and I all go to the bathroom every day. I respect a person based on his properly supported arguments, not on his function.
Bert
Hosea 13:16 Samaria shall become desolate; for she hath rebelled against her God: they shall fall by the sword: their infants shall be dashed in pieces, and their women with child shall be ripped up.
Deuteronomy 2
33 And the LORD our God delivered him {THAT IS, THE LEADER OF THE ENEMY} before us; and we smote him, and his sons, and all his people.
34 And we took all his cities at that time, and utterly destroyed the men, and the women, and the little ones, of every city, we left none to remain:
And those are just two quotes from the bible. Read it and conclude for yourself: Your deity really doesn't care about innocent children. But then I may be wrong. I'm not a jew so I may indeed not have the privilege of smiting fertilized egss and all.
...Why would they assume constant movement?...
You tell me and we'll both know. There is plenty of evidence that the earth's crust and the continents move around like ice floes in the arctic oceans. We know by measurement how fast they drift today, but there is no way to MEASURE how fast the travelled in the past. We can make some assumptions which may or may not be right. In the absence of having information how the rate of movement changed, I suppose a linear guess is as good as any. However we do know from most phenomena in nature that linearity of anything is strangely rare. So it is likely that the rate of movement, was NOT linear and we are left guessing how LONG the drifting continents took to get to where they from where they were.
Extrapolating anything where the curve of the rate of change is unknown is pure guesswork.
We do observe that the interior of the Earth is rather toasty still. This means that in times past the molten rocks of the mantle, upon which the continents and the oceans float should have been hotter and therefore less viscous and so allowed the continents to move more freely than they do today. Maybe science will figure out how much more fluid things were way back in time and then come up with a reasonable estimate of fast the continents could have drifted around. It would most certainly be much faster than what we observe today.
All theory is gray
How strange. Parts of both my degrees involved logic; from them, I found that it is as interesting to know that some conditions cannot exist as it is to prove they do.
Based on what you're attempting to prove/achieve, you prove that certain events/conditions do occur, or that they do not/cannot (basic example, though mathematically tortuous, take finding the conditions where 1+1=7 in base 10).
I believe that's easier to prove that the condition where that is true does not exist, than to prove that it does.
True, all that we understand now does not point to a higher being. However, it also doesn't preclude that (thus some very logical, and very bright physicists are also religious, and find absolutely no contradiction, as they understand that what they know now will likely be considered about as primitive as we consider cavemen using sparks to light fire, which was the height of technology back then).
Again, wholeheartedly with you on the big question being the nature of the universe. A person that denies what is observed by relying on "a book/person told me that is not true, so it is not true despite evidence" is, quite simply, wrong. Possibly deluded. Highly likely scared.
However, if there is a question for which we have no answer, and cannot answer (with the best of our technical ability), and has no bearing on every day life, apart from to influence being happy, then by all means, choose what you believe (or don't believe). Saying you know better is simply not true. You believe otherwise based on your perceptions.
Just a note to you, assuming that someone else is ignorant, because they don't subscribe to your point of view is both rude, and closed minded.
You seem pretty well educated, and quite bright, and I honestly think that attitude is beneath you.
I agree with some of what you say, disagree with other parts. Can see the way your arguments flow, and believe that you're employing some spurious logic of your own in there.
You just spoiled what could otherwise be a decent discussion with off handed rudeness. *Shrug*
I suspect you are quite likely right in the atheistic view, but rather hope you're not. I choose to say "I don't know". Which is entirely correct.
Evolution has been singled out for special ire by Discovery, as it provides an explanation for the origin of humanity based solely on natural processes.
There's two claims here-- 1. Evolution is singled out. 2. It is singled out because it offers an explanation for the origin of humanity based solely on natural processes.
On the first:
William Paley predated Darwin. And, certainly Creationists have not in the interim ceased 'preaching' the same message which has gone forth since before either of them.
They have certainly modified the message over time. You are familiar with the "God of the gaps" argument, I presume? Whenever science comes up with a decent explanation of something that the creationists claimed "god did it", they change their message. See dover trial and the flagellum argument for one example, or their find/replace of "God did it" with "some intelligent designer did it" when they changed their name from creationism to ID.
Does evolution really offer an explanation for the origin of humanity based solely on natural processes? If you really believe that, then ask yourself two questions. 1 - Where did the original matter making up the primordial soup (or the infinitesimally small mass before the big bang) come from? and 2 - What about these natural laws that seem to govern the universe which make natural processes possible?
That is a moving the goalposts argument.
And, even if evolution did offer this explanation, it is solely a conjecture that rebuffing evolution is ID theorists' sole motive in advancing their theory.
Conjecture, my hindquarters..
"The concept of intelligent design (hereinafter âoeIDâ), in its current form, came into existence after the Edwards case was decided in 1987. For the reasons that follow, we conclude that the religious nature of ID would be readily apparent to an objective observer, adult or child."
It is quite clear that the ID movement was born after the creationists' failed attempts to get creationism into the school curriculum. If rebuffing the theory of evolution isn't their goal then what is?
Why should I continue any further? [..] Why should I waste any more time on this?
I ask myself the same question. (1) "Creationists not changing their message" and (2) "ID is not an attempt to rebuff evolution". I typically stop rebuffing /. comments after the first few errant statements, but in this case, two are enough.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
So, which papers have you read where an actual scientist takes constant speed for plate movement as assumed? You keep saying "they assume this", but I can't find even "geology for laypeople" web pages containing that huge logical gap. Can you?
1) what are you actually arguing for (i.e., do you believe the plates moved drastically faster, say, 5500 years ago)?
2) You ignored the rest of my comment -- about there being many other sources of information, not just current direct measurements of drift. The theory didn't have any real backing until other sources of data fell into place.
We also do have a good understanding of how heat transference works (again, bringing to bear another set of observations and scientific knowledge) that will give us separate data on how fast heat can actually convect through the mantle, crust, etc. From what I remember of geology (ages ago), it's a pretty damned slow process -- which we know not because we just extrapolate, but because heat doesn't convect through rock at random; it obeys natural laws.
Based on all of those differing sources of data, scientists can define *ranges* of when the continents would have been at different locations. That's how it works when you don't have exact ways to pin down a date -- you calculate your margin of error based on the precision of your data and you work from there.
Because when plates move it makes such dramatic changes on the surface (mountain ranges which then age on the surface, volcanoes, levels of sediment on the sea floor, etc. etc..) we don't just have to guess at historical movement, we can track it *also* based on all of that external change.
It would most certainly be much faster than what we observe today.
Er... WHEN would it have been "much faster" than today? If you want to make actual arguments, I can probably address them, or at least tell you where to look. If you want to look at areas of plate tectonic theory that still need expansion, sure -- like all theories, it's still being extended as new observations become possible, and if you could actually advance it you'd probably win some awards (tenure, at least). You can also ask the scientists themselves which parts they'd most like to improve.
If you want to draw a conclusion that's drastically different from what actual geologists support, though, you have to be able to address the whole body of data their theories cover. If you don't even understand the basis for the theory in the first place, you don't have much hope of saying anything coherent at all.
....Because ID, not being falsifiable, is not a scientific theory at all...
That line of reasoning is absolutely pure BS. If I find a watch or other complex device somewhere, I can claim it is designed and you can deny that claim. The same is true of complex natural things. We know that man-made things are designed. How do we know this? How do we know for example that Stonehenge is a man-made object and not a natural rock formation? There are many mountains and rock formations on earth. In North Dakota at Mount Rushmore there is a mountainside which is quite different from any other mountainside. It happens to have the likenesses of several American presidents chiseled into it. How do we know that this is not a natural rock formation, but of human, intelligent origin?
The same evidences of design can be found in human systems and devices, is also present in the systems and devices that exist in the natural world.
All theory is gray
Not sure where your definition of supernatural comes from, but most people use the concept to describe something that is in this universe and that interacts with it in some way beyond the possibilities of nature and beyond cause-and-effect as defined by possible physical forces. See the laws of thermodynamics if you are unsure what I'm getting at.
Also, there is absolutely NO proof that god has ever revealed himself in any shape or form. Your assumptions are based on hearsay and zero evidence. See the problem?
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
I don't assume you are ignorant because you don't share my point of view. I assume you are ignorant because you fail to re-assess the very fundamental assumptions from which you launch your arguments -- assumptions which are clearly flawed to begin with. It's not rude to point this out, although when dealing with someone whose arguments are so, it is fruitless to discuss anything.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
I understand perfectly. Metaphor, by its very DEFINITION, is not literal. Get it? You can't "believe" in something if it has no literal meaning. As I said before, and as should be obvious, you can choose to interpret or learn from such things, but unless you take the writings as written literal truth, it is not possible for you to believe in them.
Another thing I said before, if it is metaphor, explain the book of Numbers? Then explain Leviticus. Did people not take those texts as perfectly literal? How about the gospels. Do people not take those as literal accounts?
Do you see how completely flawed it is to say these things are metaphor? They were clearly never intended as such.
Today's weirdness is tomorrow's reason why. -- Hunter S. Thompson
The claim that a watch was made by humans is falsifiable. Search the planet for the manufacturer. If none is found, the watch was not made by humans.
The claim that Stonehenge was made by a particular group of humans is falsifiable. The area in and around the stones will contain their artifacts if so. Search that area, and if none are found, the claim is false.
ID is not falsifiable. No matter what you find, "God did it" is always a conforming response. If we find a specific mechanism for how a particularly "irreducibly complex" construct came to be by natural evolution, ID will not be false, it will just come up with some other reason why there must be an intelligent designer. ID has many of the trappings of science but fundamentally it is not science, but religion.
If you mod me Overrated, you are admitting that you have no penis.
...Er... WHEN would it have been "much faster" than today....
That "when" questioned is not only asked in the science of geology but in all other sciences trying to probe what might have happened in the past. To answer that question, not only in geology, but other sciences as well, present-day observations are applied to the past. It is _always_ assumed that this is a valid way to proceed. Such assumptions may be correct, but they are nevertheless assumptions and always will be. We simply do not _know_ how to answer these "when" questions without making some assumptions.
For example, scientists come up with dates of rocks and other things based on the phenomena of radioactivity. They can confidently give ranges of dates, but they are all based on the _assumption_ that the rate of radioactivity has always been what we observe it to be today. Again, this may be a valid assumption, but it is still an assumption. In a sense, the interpretations (not the facts) of science are based as much on faith as any religion.
All theory is gray
The same evidences of design can be found in human systems and devices, is also present in the systems and devices that exist in the natural world.
Sorry, no. (Or in your words, "pure BS")
We know humans. We can study them and get a reasonably good assurance that they are intelligent. We also can tell what other properties they have, like their ability to make and use tools and their ability to organise to make works that would require more than one human. We also have a reasonably complete written record of at least some of human history. Not to mention the remains of human artefacts, which would indicate that humans inhabited a particular place at a particular time.
Using that knowledge, it isn't that difficult to infer that Stonehenge, the pyramids, the stone faces of mt. Rushmore or the Easter Island stone statues were made by man.
When it comes to God, we have hardly any such knowledge. We can't exactly ask him to step into a lab so we can test his cognitive abilities or what tools he has available for shaping the world. How, then, can we make any reasoned argument whether any systems or devices that exist in the natural world are God-made?
To say "sorry, we don't know how that could happen by purely causal mechanisms" is not the same as "God must have done it". That is just the faulty argument of god-of-the-gaps. It tells us to infer design when we have ruled out all the chance (i.e. non-design) hypotheses we can think of. The design hypothesis says nothing whatsoever about the identity, nature, aims, capabilities or methods of the designer. It just says, in effect, "a designer did it".
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
In a sense, the interpretations (not the facts) of science are based as much on faith as any religion.
As opposed to certain religions, science does at the very least allow for their interpretations to change. That is pretty much the only "tenet" that science has - that current interpretations are not holy and that if facts are found that contradict current interpretation, then the interpretation must change to fit the facts.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
but they are all based on the _assumption_ that the rate of radioactivity has always been what we observe it to be today. Again, this may be a valid assumption, but it is still an assumption
But where should one draw a line on these assumptions? We have seen nothing so far to indicate that decay rates have changed over time (including analysis of spectra of supernovas) so it seems like a reasonable assumption to make.
We also make the assumption that our senses don't (intentionally) lie to us and thus most of us assume that we are not used as biological batteries with our brains plugged into the Matrix.
We have to draw the line somewhere, because if we take the path of doubting every assumption would have us all in catatonic state because we would be unable to trust anything at all.
In most cases we feel fairly comfortable with making assumptions when we have a considerable amount of facts that seem to support the assumption and a lack of contradicting facts - even when actively looking for contradicting facts.
So my question would be - where do you draw that line?
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
Not sure where your definition of supernatural comes from, but most people use the concept to describe something that is in this universe and that interacts with it in some way beyond the possibilities of nature and beyond cause-and-effect as defined by possible physical forces. See the laws of thermodynamics if you are unsure what I'm getting at.
How about Merriam-Webster? "Of or relating to an order of existence beyond the visible observable universe." Or the American Heritage Dictionary: "Of or relating to existence outside the natural world."
Also, there is absolutely NO proof that god has ever revealed himself in any shape or form. Your assumptions are based on hearsay and zero evidence. See the problem?
There is no proof any more. There was proof 2,000 years ago. There were eyewitnesses to clearly supernatural events, and natural events that fulfilled centuries-old prophecies in a significant way. But we no longer have this proof; all we have is what people wrote about it later. And since God has not chosen to reveal Himself in a testable way since then, we have no current proof. I don't claim otherwise. However, the absence of proof is not proof of absence.
By definition, the existence of God cannot be disproven by science. That doesn't mean God exists, and it doesn't mean God doesn't exist. Either belief must be held on faith, and I respect your belief in this matter even though it differs from mine.
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
There is no proof anymore that Zeus appeared to Europa as a white bull. There was proof 2,000 years ago. There were eyewitnesses to clearly supernatural events... But we no longer have this proof; all we have is what people wrote about it later.
Naturally, you believe that story as well, right?
"Slow down, Cowboy! It has been 3 years, 7 months and 26 days since you last successfully posted a comment."
Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.
And here's an equivalent:
God created the universe just a few minutes ago, with all this stuff in it, to appear as though we've all been here for thousands of years.
In fact, he didn't bother to create a whole universe. Just the parts anyone happens to be looking at right now.
God sure is one clever creator!
-- thinkyhead software and media
You've been modded "funny" but frankly I know you're not kidding.
Deceived monkeys can be dumb. dumb. dumb.
-- thinkyhead software and media
.....The design hypothesis says nothing whatsoever about the identity, nature, aims, capabilities or methods of the designer. It just says, in effect, "a designer did it"...
That is true, even in human terms. However there are some things we can infer from a design. Since this is a computer oriented nerdy forum, the design of software in general or operating system specifically comes to mind. We can infer that those who designed the UNIX-based operating systems are better, smarter designers than those who came up with Windows. We can safely infer, that those who designed a 747 airliner had a bit of knowledge about aerodynamics and mechanics.
Of course we know nothing about what kind of people they are, what kind of families they have, what cars they drive etc. The only way we can get that kind of information is if these designers choose to reveal it to us and we get to know them in person.
We can infer from the intricacies and complexities of the universe we find ourselves in, that the designer has knowledge and information about the natural world far beyond our own. Especially in living things, he has come up with technology, the workings of which we have only very faint clues. For every answer that science gives, ten new questions arise.
In this book we call the Bible, there are many hundreds of statements along the lines of "thus says the Lord". How can we ascertain the authenticity and authorship of these writings? How do we determine truth or falsehood in human affairs, such as in courts of law? If you are preparing a document, how can you ensure that the recipients of this document will have a reasonable assurance that it is truly from you and not an artful forgery?
This has been and still is an ongoing problem in human communications. We do this with computers of course using encryption and passwords. These are used both to authenticate and to protect the message. The essence of these authentication methods involves knowledge that only the true author possesses.
This is exactly what God has done in the Bible. Because he is eternal and outside of and not subject to time, he uses his perfect knowledge of all time to write history in advance. We humans are singularly bad predicting the future. We can't even accurately predict the weather or the stock market. These predictions of the future in the Bible are not vague or self-fulfilling, but quite specific of events, places and times and NEVER miss. In ancient Israel, anyone who made predictions that clearly failed to come to pass was subject to capital punishment. Being a prophet or soothsayer was a rather dangerous profession back then.
There are plenty of books that describe many of these Bible prophecies, how they were fulfilled in the past and how they are being fulfilled today. If you are truly interested, I am sure you can find some and study them.
All theory is gray
William Paley predated Darwin. And, certainly Creationists have not in the interim ceased 'preaching' the same message which has gone forth since before either of them.
They have certainly modified the message over time. You are familiar with the "God of the gaps" argument, I presume? Whenever science comes up with a decent explanation of something that the creationists claimed "god did it", they change their message. See dover trial and the flagellum argument for one example, or their find/replace of "God did it" with "some intelligent designer did it" when they changed their name from creationism to ID.
I don't justify or feel responsible in any way for the arguments of the last 200 years or so coming from Creationists. And, I'm sure that you would not want to claim responsibility for the embarrassing moves your side has made either (such as the 'discovery' of cro-magnum man or neanderthal man based entirely on archaeological unearthing of one single pig's tooth!).
My point remains the same, but maybe I should've used Moses instead of Paley as surely you couldn't say that Moses was 'targetting' evolution some 3200 years before Darwin? I think it is safe to say though that Moses' work was in part to combat paganism and early forms of atheism (which are philosophical stances, not scientific ones). Genesis was never intended to provide detail about scientific processes.
And, Dover proves nothing except that a liberal judge continued the status quo. The supposed 'refutation' of irreducible complexity does nothing more than multiply imagination upon imagination. And those imaginations come up very short. Even if they were sufficient (and they're not--they're way short) to explain how the bacteria flagellum *could* have evolved, they certainly come no where close to showing how they *did* evolve. You should read Michael Behe's book on this subject--_Darwin's Black Box_. There's way more proteins and enzymes involved than can be explained with a simple vague guess as to how it might have happened. What Dr. Behe says is lacking is detail of a step-by-step process (and this process is still yet to be detailed).
The evolutionists' argument here is really a logical fallacy--argument ad ignorantiam. While providing only far-fetched and imaginative theories about everything from how smart Neanderthal man was to how much fur specific dinosaurs must've had, they claim that since no one has disproved evolution (and their imaginations), it must be true.
How can you say I moved the goalposts when the author used the word 'origin'? Is not origin an endpoint? Is there such a thing as an original origin. Or, is one origin more original than another? Obviously, if the author had chosen another less absolute word, then my refutation would not have applied.
And, even if evolution did offer this explanation, it is solely a conjecture that rebuffing evolution is ID theorists' sole motive in advancing their theory.
Conjecture, my hindquarters.. "The concept of intelligent design (hereinafter ÃoeIDÃ), in its current form, came into existence after the Edwards case was decided in 1987. For the reasons that follow, we conclude that the religious nature of ID would be readily apparent to an objective observer, adult or child." [wikisource.org] It is quite clear that the ID movement was born after the creationists' failed attempts to get creationism into the school curriculum. If rebuffing the theory of evolution isn't their goal then what is?
Well, I personally consider myself an ID theorist (attacking the problem from an information science perspective), so I can speak for myself. I think the theory has interesting ideas and merits on its own. Rebuffing evolution certainly isn't my sole motive. I agree that Creationism has morphed into ID, but isn't it the message that should matter, not the messenger? [Also, I know a bi
P.S. It is another logical fallacy to conclude that ID theory has nothing scientific to offer because its predecessor Creationism included religious aspects: ad hominem.
Science should be concerned with deciding the truth values of claims no matter their source.
Hoo boy. You might as well just paint a big sign on your forehead that says "I DON'T KNOW WHAT I'M TALKING ABOUT!"
http://www.talkorigins.org/faqs/homs/wolfmellett.html
http://www.talkorigins.org/faqs/homs/specimen.html#cromagnon
http://www.talkorigins.org/faqs/homs/specimen.html#neandertals
> And, Dover proves nothing except that a liberal judge continued the status quo.
You mean the "liberal judge" who is a Christian and Republican, and was appointed by George W. Bush?
http://www.collegenews.org/x6455.xml
http://en.wikipedia.org/wiki/John_E._Jones_III
...We have seen nothing so far to indicate that decay rates have changed over time (including analysis of spectra of supernovas) so it seems like a reasonable assumption to make...
We DO have some evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time. This would demand that certain numbers, assumed to be "constants" have changed as well. One of these is Planck's constant which is measured to be smaller today than when it was first measured. Light-speed is related inversely to that. That means light moved much faster through the medium of space, when the Universe was very young, small, dense and hot. Just as sound travels faster in rock or water than in air, so too light traveled faster through a denser Universe.
There is evidence from past light-speed measurements using a gravity time-base, which have shown a decrease since such measurements were first done in the early 1600s. When an atomic time-base clock is used to measure the speed of light, as is being done today, this is not seen, since the product hc appears to be truly constant, with h and c moving in opposite directions. If a ruler elongates at the same rate as a distance to be measured by it, the distance will always be measured to be the same, even though it really is changing. Gravity equations have neither h nor c in them. Therefore, any clock based on gravity will not be affected by the changes in h or c and measure them directly, without any correction factors needed.
Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected. So there IS evidence that call into question the belief that these "clocks" are truly constant over time.
All theory is gray
The humanistic sanctioned doctrine of evolution is taught under the guise of science and other views such as those of the founding fathers and other dissenters...
"Other" views? Dissenters?? The Founding Fathers were educated intellectuals who abhorred religion. They said so:
"Religions are all alike - founded upon fables and mythologies."
-- Thomas Jefferson
"I do not find in orthodox Christianity one redeeming feature."
-- Thomas Jefferson
"Christianity is the most perverted system that ever shone on man."
-- Thomas Jefferson
"The Christian god can easily be pictured as virtually the same god as the many ancient gods of past civilizations. The Christian god is a three headed monster: cruel, vengeful and capricious. If one wishes to know more of this raging, three-headed beast-like god, one only needs to look at the caliber of people who say they serve him. They are always of two classes: fools and hypocrites."
-- Thomas Jefferson
In those parts of the world where learning and science have prevailed, miracles have ceased; but in those parts of it as are barbarous and ignorant, miracles are still in vogue.
-- Ethan Allen
While we are under the tyranny of Priests...it will ever be their interest, to invalidate the law of nature and reason, in order to establish systems incompatible therewith.
-- Ethan Allen
But you seem to be an old, life-long Christian zealot with a Slashdot account, posting two dozen uneducated and ill-reasoned comments in ever discussion that conflicts with strict Christian literalism to the point of adopting fringe science so as not to rule out special creationism.
I see it's been another wild weekend in which you've written much, copied-and-pasted it several times into different threads, yet conceded not a single point no matter how overwhelming, nor learned a single thing about nature, scientific inquiry, or reality no matter how blatant.
One of every 30 posts in this article's discussion is you, defending the idea that the universe was created only "several thousand" years ago and not millions, let alone billions, and that a creator deity did it. There have been far more than 29 other readers who've posted comments.
Please consider that it is possible that your particular interpretation of the universe is wrong, even to the point that it was not made by a deity at all.
Of course we know nothing about what kind of people they are, what kind of families they have, what cars they drive etc.
Are you purposefully trying to miss the point, did I trig some sort of mental block?
To rephrase my point - we know humans to the point where we have a reasonably good grasp of our mental capabilities, what kind of tools we had available at different times in history, what government/social structures we had (or were likely to have), what motives and incentives we might have had, etc..
The purpose of this is so that when we are presented with an artefact and ask the question "did Man make this?" we have a large amount of background material that can help us decide the likely answer for this question. First of all, would man - at that point in time - have the required tools to make this artefact? Second, would he have any likely motive for making it? Continue down this line of questions for every property of the artefact and what was known about humans at the time and place the artefact was made.
On the other hand - An attempt to do the same line of reasoning with "did intelligent designer make it?" to something like the flagellum would be an exercise in futility. We simply don't know enough (or anything at all) about this supposed intelligent designer to make any sort of reasoned judgement as to whether this intelligent designer made the artefact or not.
These predictions of the future in the Bible are not vague or self-fulfilling, but quite specific of events, places and times and NEVER miss
Ok, now I definitely know that you are either trolling or so brain-addled that you are in dire need of professional help. Never miss? The end-times have been proclaimed how many times exactly? Oh, or were those foretold by people not following the right kind of Christianity?
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
In a sense, the interpretations (not the facts) of science are based as much on faith as any religion.
This is a profound misunderstanding of science.
You're (unknowingly) pointing to the exact reason why the scientific method was developed, and why the scientific approach has been so extremely successful at winnowing out valid, supported, useful theories from all of the possible conceptions of how the world works.
Removing faith from the search for knowledge was essential. Removing "unquestionable fact" from consideration was essential. No theory or conclusion is ever a closed book -- as more observations are made (and more are possible, because our technology continues to advance), theory must always be updated to account for those observations.
It's amazing to me that we're born into a world where one set of grownups tell us that X and Y happened magically, done by a magic invisible being, and we must take their word for it because *other* people wrote it down rather cryptically a long time ago, and there's no way to investigate for ourselves. And ANOTHER group of grownups tells us no, we can get a pretty good idea of how X and Y happened if we gather up the clues left everywhere and apply a strict process to weed out the weak ideas... and here, you can try it for yourself, and read how we figured it out in as much depth as you want, and even help us figure out more.
Why does anyone join the first group? Because they seem nice? (well, not all of them...) Because they were forced to decide while still children (and it can be hard to change)?
Sources?
And what alternate interpretations have you considered and discarded?
Unfortunately, there's a large mass of scientific-sounding drivel on the internet that makes incoherent points based on basic misunderstandings of the science involved -- you can often do a tiny amount of research and find that they are misrepresenting the situation, often maliciously and with an unsubtle agenda.
If you provide some sources perhaps you might get help evaluating them.
If you're actually doing ground-breaking research yourself, bravo, and let us know when the Nobel prize ceremony is. I'm not getting that sense, though.
Minor addendum -- we also have other sources of data that are less precise, but that provide independent dating methods.
Example -- different kinds of rock erode at different rates. We don't know exactly what the weather has been like over X millions of years, but we can deduce a range (hint: huge mountains of hard rock don't get worn to nubs in a thousand years). Sediment build-up is another similar clue.
That's how science works -- you gather *all* the clues possible, and if your theory doesn't account for all of them, it has to change.
We DO have some evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time.
Source?
One of these is Planck's constant which is measured to be smaller today than when it was first measured.
Source?
There is evidence from past light-speed measurements using a gravity time-base, which have shown a decrease since such measurements were first done in the early 1600s.
Which measurements? You know, this would be so much easier if you would do the very basic courtesy of providing sources for your assertions.
If a ruler elongates at the same rate as a distance to be measured by it, the distance will always be measured to be the same, even though it really is changing.
Though it would be possible to measure the changes of the ruler. For one, if you elongate it enough it would simply break apart because the molecules in the ruler would be too far apart for the intermolecular bonding forces to hold them together. That is, unless you also assume that the inter- and intra-molecular forces change accordingly.
Since Planck's "constant" appears in equations describing the behavior of atoms, radioactive clocks must also be affected.
But it does not follow that it would affect other kinds of clocks, and even if it did it might not affect them to the same degree. If we were to compare these clocks, it would be fairly straight forward to discover that something funky is going on with the atomic clock.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
There is evidence that the electromagnetic properties of the medium of space itself have indeed changed dramatically over time.
Then you should be able to reference this evidence. Please do so.
STOP MISUSING APOSTROPHES, YOU MORONS!!!
...You know, this would be so much easier if you would do the very basic courtesy of providing sources for your assertions...
Well, if you really want to dig deeply into this, here is a place to start:
http://www.setterfield.org/report/report.html
Pay special attention to the references given at the end of the article. I hope you have plenty of time to look into this with an open mind.
Remember, that real progress in science has NEVER been done by the consensus of the majority or a large committee.
Any time constancy and linearity over a large amount of time is promulgated, it is time to get suspicious. About the only thing constant in nature is change. We live in a dynamic, ever changing universe. Postulating slow uniform processes over great spans of time is not in keeping with the observed dynamics of the Universe. The entire solar system bears the hallmarks of a violent past. On Earth there is evidence of sudden catastrophes, such as impacts of asteroids, monstrous volcanic outbursts and floods that made great changes very quickly. One look look at the moon or mars will show you the great number of these events.
Therefore, it is not so far fetched to assume that NOTHING is truly constant for very long. Ask any Physicist. There is NO law of physics that says that the speed of light MUST be constant.
All theory is gray
A couple of comments on c decreasing:
Once fairly accurate measurements of c became available (post 1960), the supposed c decay seems to vanish. So, he uses the measurements of c pre-60 (which have huge potential errors) to build the case for his decaying c argument but his proposed graph conveniently levels off post-60.
A decaying c would also have wide ranging effects, which we should be able to observe today. For one, e=mc^2. With a higher c, chemical reactions would release more energy than it does today. Not to mention that it would alter the fine structure constant (α = vH/c), which we would definitely be able to observe the effects of (the temperature of stars depends strongly on α, so we should be able to detect even a slight change - one of which is that we would have been bbq'd by the sun in the 1000 or so years after genesis).
And that's only scratching the surface of the changes that c-decay would imply, change one of the basic values of physics and lots of stuff happens.
Oh, and it would be interesting to see how one would reconcile this with the idea of c-decay.
There is NO law of physics that says that the speed of light MUST be constant.
That is true, as far as I know. However, that is not the same as saying that the effects of this historic change of c would not be DETECTABLE today.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
"Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school." ~ I guess that the big chicken thinks that this lie will go a long way to convince anybody that isn't in the choir to join the side of "honest science". ~ How... ideological...
I understand perfectly. Metaphor, by its very DEFINITION, is not literal. Get it? You can't "believe" in something if it has no literal meaning.
People can believe anything they want. As I showed you, abstraction is what differentiates metaphor from literal text. People can believe an abstract solution more than a literal one.
For example:
(a) I believe the sun will come up tomorrow, because every part of life is a cycle, including both days and seasons.
(b) I believe the sun will come up tomorrow because of the rotation of the earth.
The first is not a literal description, but it is accurate, even if abstract.
The second is literal.
People can believe both, and in many cases, prefer the abstraction.
Anti-Globalism, Traditionalism, and FreeBSD.
....Once fairly accurate measurements of c became available (post 1960), ...
That is the time when the atomic clocks began to be used for the time base for this. The clocks change exactly the same as the quantity to be measured. The earlier measurements were all made using orbital clocks based on gravity. Gravity is disconnected from atomic behavior. Measuring with the distance between points with a ruler that stretches at the same rate as the distance does, will give you a constant measurement. If someone tattoos a ruler on a child's body, that kid doesn't grow at all, as measured by that ruler. Atomic clocks are not an independent measuring stick to measure time or distance.
We KNOW that light is affected by the medium it traverses. Space is not an empty nothing, but has electromagnetic properties that HAVE to change as space expands. The fact is that space is not expanding much any longer and so the change of the speed of light is very small, yet still measurable IF an independent clock is used.
Recently there were headlines even, that light has been slowed to crawl in the lab. Don't you think that if light can be slowed down way, it can also be speeded up? There is no way we can actually MEASURE the distances to objects using trigonometry more than a few light years away. The biggest base we have is the orbit of the earth. That is a very tiny distance compared to the galaxy dimensions. The angles become simply too small to measure. The stated distances are arrived at by brightness comparisons and the Hubble red-shift = distance assumption. It is because such vast distances are assumed, that makes the energy output of things like quasars appear to be so great. If the distances are really much less, then these objects become quite normal stars.
from the link article: (..Let's start by considering a pulsar which is 170,000 light-years away..
Here is again one of these flat out statements based on an assumption, namely that said object really is that distant. So there again ONLY if that assumption is true, does all the math pan out and bolster the writer's argument. Slinging math around is great only if the underlying numbers are based on actual measurements and not baseless assumptions.
from the link article: (..The amount of coal and oil existing today greatly exceeds what could have been produced by decaying plants and animals ..)
Again, the underlying assumption here is that the growth conditions and the biosphere was similar to what we have today. There is evidence that life on earth was much more prolific when the earth was young.
The creationists also make assumptions about the biblical text that are not really there. Creationists forget that the main purpose of the Bible is not to give us an accurate account of how God did things, but to tell us of His love and what plans he has for mankind.
When it comes to the past, only someone who was actually there can give us an accurate account of what REALLY happened. Since God doesn't give us any where near as much detail as we'd like, both sides have to do a lot of guesswork.
I suppose you might have noticed my sig by now!
cheers -- have a good day!
All theory is gray
But the abortion-rights lobby decided that it would be far too traumatic for a woman to hear, "I'm sorry, I can't fill this prescription, but Joe's pharmacy down the street can."
I'm sure that wouldn't be too traumatic, but what about when a pharmacist not only refuses to fill the prescription, but also refuses to have it transfered or give it back to the woman to take down to Joe's?
kurzweil_freak
5th Kyu Genbukan Ninpo/KJJR student
Be the darkness that allows the light to shine.
That is the time when the atomic clocks began to be used for the time base for this. The clocks change exactly the same as the quantity to be measured.
So the speed of oscillation of caesium atoms changed at the same rate that the speed of light in a vacuum does? Sounds like a convenient radom event to me.
Besides, how would this change in atomic clocks not be detected by comparing it to other potential sources of time. Or did those happen to change at the same rate too?
We KNOW that light is affected by the medium it traverses. [..] Recently there were headlines even, that light has been slowed to crawl in the lab.
That is true. So?
Space is not an empty nothing, but has electromagnetic properties that HAVE to change as space expands. The fact is that space is not expanding much any longer
Source? Or is this an assumption? ;-p
There is no way we can actually MEASURE the distances to objects using trigonometry more than a few light years away. The biggest base we have is the orbit of the earth.
Correct. Parallax works out to about 200ly.
That is a very tiny distance compared to the galaxy dimensions. The angles become simply too small to measure. The stated distances are arrived at by brightness comparisons and the Hubble red-shift = distance assumption.
Not quite. We usually use Cepheid variables. You use stars that are close enough for parallax distance measurement for calibration.
Red-shift really only tells you how fast they are moving, and while there is a relationship between the amount of shift and distance we shouldn't use that alone.
Creationists forget that the main purpose of the Bible is not to give us an accurate account of how God did things, but to tell us of His love and what plans he has for mankind.
Agreed. So why do you insist on a quite literal interpretation of genesis and the flood?
When it comes to the past, only someone who was actually there can give us an accurate account of what REALLY happened.
Just one sec, I need to change the battery of my camcorder before I go for a trip in my time machine.
While absolute concrete utterly non-disputable evidence is hard to come by, there is more circumstantial evidence out there than you seem to believe.
Since God doesn't give us any where near as much detail as we'd like, both sides have to do a lot of guesswork.
Science at the very least has the advantage of having some system to the guesswork. Scientific method refers to bodies of techniques for investigating phenomena, acquiring new knowledge, or correcting and integrating previous knowledge. To be termed scientific, a method of inquiry must be based on gathering observable, empirical and measurable evidence subject to specific principles of reasoning. A scientific method consists of the collection of data through observation and experimentation, and the formulation and testing of hypotheses.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
Pro-choice people don't force abortions on other people who are against abortions.
Well... except unborn children.
Actually, your citations of other finds do nothing to refute my point about the one particular find where scientists worldwide got all giddy over a pig's tooth. If I'm not mistaken, it was before the other finds you cite (if they are for real this time.... once bitten, twice shy you know).
And, explaining how the guy could've made the mistake, although noble, hardly erases the mistake.
I suppose that is the one. Unfortunately, it seems, the right's judges have a bit more of a tendency to forget how they got there than the left's do. Sandra Day O'Connor also comes to mind.
They do, actually. Did you read the first article I linked? Most scientists at the time were skeptical, and almost none of them thought the find justified the claims being made.
Forestier's reconstruction of Nebraska Man was not reproduced in any other contemporary publication and has only recently been "rediscovered" and reprinted by critics of evolution
Yes, it was before the other finds linked. The other finds are indeed legit, just RTFA if you want to know how and why.
No, careful examination of evidence corrects the mistake. Why would any qualified scientist "claim responsibility" for such a mistake? They didn't and still don't. Your attempt at guilt-by-association is shallow and easily seen through.
Thanks for admitting that your claim was false.
Right. And the scientific interpretation of facts must hove closer to truth than to falsity, by virtue of the method.
Right. And because theology, history, and philosophy have no way of validating any particular interpretation of the words written, they are destined to talk in circles without any guarantee of approaching truth. HOWEVER, they are still limited by real experience of the world by the people doing the interpretation, so it is unlikely that any interpretations that contradict real-world experience ('empirical evidence' if you will) can gain any ground.
The bible is filled with descriptions of miracles, none of which has ever been demonstrated to be scientifically plausible. God making the sun stand still for Joshua comes to mind. There's no possible way for this to happen without it being noticed worldwide, yet no other culture recorded any evidence of it happening. Why is that?
Likewise the resurrection. There is no evidence that anyone has ever been able to return from the dead once all cellular metabolism has stopped. This normally happens within a few hours after the heart stops beating. Granted, if there were a scientific explanation, it would not be a 'miracle', but you might as well insist that skeletons could get up and dance around - it requires magic of the highest order.
Agreed, but only because Truth is Truth, and any conflict would be like saying A != A. Anything in the bible that is true is necessarily scientifically true. There is, however, no proof whatsoever that anything written in the bible is true; it is entirely hearsay. (Yes, that includes the archeological discovery of ancient cities mentioned in the bible. There is no evidence that any of the events in the bible happened there as described, even in real locations.)
..Science at the very least has the advantage of having some system to the guesswork..
Actually science is NOT t all guesswork. It is based on present observations and experiments, done in real time, TODAY! The guesswork is in the interpretation of the data so gathered. We measure the speed of light today and it is a certain speed. That tells us nothing about what it was a million or even a thousand years ago. We assume the stars are a certain distance away and try to match brightnesses assuming that the other stars are equally far away and equally bright.
In 1968, the scientific community changed Planck's constant from 0.0014350 to 0.0014388. Why, just for fun or is it because it indeed is not truly constant?
(...Besides, how would this change in atomic clocks not be detected by comparing it to other potential sources of time...)
The only other source of time is orbital time which is dependent on gravity. Gravity equations do not contain a time element such as c or h. The atomic clocks indeed have lost a few seconds since 1967 against orbital clocks. In 1967 the time standard was changed from an orbital definition to an atomic definition.
If light can be slowed down, then its speed is not a constant.
http://en.wikipedia.org/wiki/Slow_light
If it can be slower, then why not also faster?
All theory is gray
..Science at the very least has the advantage of having some system to the guesswork..
Actually science is NOT t all guesswork. It is based on present observations and experiments, done in real time, TODAY!
I notice that you conveniently didn't address my point that science sets strict scrutiny standards to how they deal with their guesses.
You observe something or test something in the lab. You make a guess based on those facts. Then comes the crucial step - you look at this guess and then ask "what else would we expect to see if the guess is correct?". Then you go back to the lab or out in the field to see if the new facts you uncover fits with the guess or not. See the link to The Scientific Theory that I included in my previous post for a more detailed description of the process.
That second step - the "what else would we expect to see" and then going out and looking for those other facts is what is conspicuously missing from your guesswork like "c-decay" or "earth's rotational axis was altered during the flood". Hence, the trust one would apply to those guesses is small because they lack corroborating evidence. Not to mention that those theories have significant problems that have not been addressed in a satisfactory manner.
Scientific guesses only gets elevated to scientific theory once the guess has been poked and prodded at from every angle possible for us to do by doing work in the lab or going out and observing facts.
*that* is the main reason that you don't see ID in school textbooks. They have not done this meticulous work of testing their guesses in every way possible.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
....you look at this guess and then ask "what else would we expect to see if the guess is correct?"...
The problem is that when the evolutionists guesses do NOT accord with observations TODAY, they resort to telling everybody that evolutionary processes are very SLOW and take so much TIME, so of course we don't see them taking place today.
Everybody, not just highly educated scientists, observes and has observed for centuries that living things do NOT evolve the way evolution preaches. Dogs forever produce ONLY more dogs, cats make more cats, birds lay eggs which only hatch into more birds of a certain kind. Woodpeckers don't produce sparrows or ostriches. This holds true in more "primitive" life forms also. One celled algae produce only more algae. Your mother would have been very upset and unbelieving if the doctors or nurses had brought a chimpanzee to her instead of you and told her that she just had experienced evolution happening backwards. After all, evolutionists preach that evolution can happen the other way also and might be called devolution.
The Creator simply tells us in the Bible that is what He did. He made each kind reproduce after their own kind. Birch trees don't make Pine or Fir seedlings, only more Birch trees. This is ALL we observe. Creationists don't HAVE to make guesses about the past, because they are TOLD what happened by the one that made it happen. We all see it STILL happening every day of our lives as corroborating evidence that what God has said about this subject is true.
When evolutionists are confronted with this undeniable FACT of nature, they dismiss all that everyday fact with: "It takes millions of years for that sort of evolution" and so we can't expect to see this in our life time".
I say that is BS and a cop out into the magic land of time. If it can't be seen or duplicated TODAY, it didn't happen. You can go visit the pyramids and if someone really wanted to build one today, they could, even though they were made thousands of years ago. All history, including natural history cannot be scientifically tested, but must be believed by whatever records we have. There is no way to experimentally or observationally determine that Julius Caesar ever lived. You have to BELIEVE the written records of historians.
We find fossils all over, but WHO has ever made a fossil? Make me a fossil and explain how you did it. Take an e-coli bacteria and evolve it into a streptococcus or spirochete or the other way round and explain how you did that in an experimental report. You'd win a Nobel prize for sure. Experiments and observations is what REAL science is all about, not speculations and conjectures of what might have taken place millions of years ago, but cannot be duplicated or observed today.
(..what else would we expect to see..)
The current interpretation of the observed red-shift of distant starlight is the doppler effect. Another interpretation of it is that it is caused by the slowing of the speed of light. Not the "tired light" interpretation, but the changing nature of space itself. This change must also change the energies of the atomic orbits. Since atomic phenomena are quantized, the red shift should also be quantized. This is indeed what scientists have observed. The red-shift is not smooth, but occurs in tiny jumps. If you are interested look here:
http://www.cs.unc.edu/~plaisted/ce/redshift.html
This is credible evidence that allows calculation of exactly how much the speed of light has changed. It also gives us a basis for correcting radiometric time bases into the past, because Planck's "constant" is inversely related to c. Planck's constant has been _measured_ to be increasing still today.
Evolution is NOT science, but a philosophy dependent on the magic of time. If any scientists who believes in evolution could ever make it happen now, in the lab or observe it in nature, there would be screaming headlines everywhere.
All theory is gray
There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.
It's important to understand the difference between philosophy and religion.
The concept, not belief, that God created everything; (including the Big Bang, Multiverse, and what came before and outside of them,) is so universally accepted that our Supreme Court allows us to put "In God We Trust" on our money, even though our Constitution expressly forbids Congress from endorsing any religion through law.
Philosohpy argues for the existance of God through the logic; there is no belief at all. Religion, or Faith, would state things like "God loves you", "creation is good", "man is the keeper of the world."
Many people approach God as a subject of philosophy, and not faith or belief.
No, I will not work for your startup
That is such a blatant misunderstanding of the Theory of Evolution that I find it absolutely mind blowing.
ToE is about gradual change. We see gradual change. DNA comparisons show gradual change. The fossil record shows gradual change.
ToE does *not* say that the offspring will differ greatly from its parents. If we saw sparrows giving birth to mockingbirds, it would not be a proof of ToE - it would be the exact opposite.
But then again, if you manage to misunderstand so thoroughly what ToE actually says then I really see no reason to continue this attempt at having a reasoned discussion with you.
At the very least, it has provided me with a good example of the rationalisation that happens in the mind of someone who feels that his childhood beliefs are under attack.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
...The fossil record shows gradual change...
That is not true. The so called evolutionary column is found NOWHERE on earth in any single spot. "Earlier" life forms are at times wildly jumbled up with "later" ones, all in the same layer.
(...ToE is about gradual change...)
ToE is about _widely believed_ gradual change. There, fixed it for you. Nobody, anywhere has ever demonstrated sparrows giving birth to mockingbirds, but evolution teaches that "eventually", over time, a LOT of time, birds became mammals, apes evolved into humans and other magic we don't see happening. Without lots of time even evolutionists admit that ToE cannot work. The actual real evidence we have TODAY, shows that evolution doesn't happen at all, at least not the monkey to man sort. Believing that it can or did happen is OK, but it is a belief, not an observed scientific fact. I can give you the story how the magic of time helped here and there by chance, as described in public school text books, can turn not only a frog, but even rock into a handsome prince. A pretty maiden's kiss is not needed.
Can you not understand that science is what we observe happening TODAY and _history_ is what happened in the past? Nobody can do experiments or observe past history. We have to rely on human or natural witnesses. Fossils are nature's witnesses as are radioactive rocks and light from outer space. Pyramids, cuneiform tablets, papyrus and animal skin scrolls, such as the dead sea scrolls and the books of the Bible are witnesses of human history. ALL witnesses, natural or human NEVER prove anything, but must be BELIEVED or not.
You believe, have faith, that natural witnesses are testifying that monkeys eventually, over lots of time, became human. I believe, have faith in what God had written in the witness of a historic book. There He tells us that He created monkeys, men and all other creatures distinct and only able to each reproduce their own kind. We STILL see this and only this happening today. That makes the biblical interpretation far more believable than the evolutionary conjecture. Even so, we are both stuck with belief as far as the past goes.
All theory is gray
It's called the geological column, not the "evolutionary column." And why would you expect the entire thing to be found intact anywhere?
Completely false. You never find a species from one period "jumbled" with species from other periods. You never find a species from one period in the stratum of any other period.
ToE is about gene alleles and their change in populations. It is NOT about sudden jumps ("saltations") from parent genome to child genome.
Because sparrows and mockingbirds are in different families. Go back far enough, though, and you'll find two divergent populations of birds, which resemble each other closely, but one branch leads to sparrows and the other to mockingbirds. Evolution is a branching process.
As I said before, I LOVE how you spout off about shit you don't understand!
We have actual specimens of actual creatures which have some features of men, some features of apes. Interestingly enough, the older ones are more apelike, the younger ones are more human-like.
You lose; Thanks for playing.
You're closing your mind. As a result, you're arguing poorly and being unnecessarily hostile. As a result, many religious people tend to stop listening to athiests, since the most outspoken atheists tend to make sloppy, ignorant arguments, nitpick minor details, and generally act like dicks. If you're sincere about wanting to eliminate religion, maybe you should actually listen to your opponents for a while to learn to better communicate with them. I assure you that mocking them is not going to help your cause.
As to the Bible, when someone says they believe the Bible or believe in the Bible, they (usually) mean they believe that it is the divinely inspired word of God. Exactly what this means varies from one Christian denomination to another, and even from person to person. Sure, some believe it absolutely literally. Others believe parts are "true" in that they are truly divinely inspired metaphorical stories (say, chunks of old testament), while other parts are true in a literal sense (say, the gospels of the New Testament). It was written over the span of hundreds of years by dozens of authors in multiple languages targeting wildly different initial audiences; expecting it to be a a singular thing seems a bit much.
Search 2010 Gen Con events
That is not true. The so called evolutionary column is found NOWHERE on earth in any single spot.
Red herring.
"Earlier" life forms are at times wildly jumbled up with "later" ones, all in the same layer.
At times.
ToE is about _widely believed_ gradual change. There, fixed it for you.
Are you saying that we have not observed gradual change?
Nobody, anywhere has ever demonstrated sparrows giving birth to mockingbirds
Neither do we expect to see that.
The actual real evidence we have TODAY, shows that evolution doesn't happen at all, at least not the monkey to man sort.
That makes as much sense as saying:" The actual real evidence we have TODAY, shows that gravity doesn't happen at all, at least not the earth falling into the sun sort."
Believing that it can or did happen is OK, but it is a belief, not an observed scientific fact.
You move the goalposts all the way to exact detailed fact. That is a quite convenient rationalisation if you want to keep your belief in a young earth, a literal genesis and a global flood.
That is probably the only rationalisation you can use to keep your internal model of how the world works intact. You set the barrier for proof so high that it makes it possible for you to ignore the substantial amount of circumstantial evidence which implies that it isn't so. You eagerly grasp any tiny detail you can find that casts doubt on current scientific theory, no matter how flimsy.
Can you not understand that science is what we observe happening TODAY
That is part of science, but not the most important part. The important part is (1) the process of taking the things we observe and make reasoned guesses at how the world works and (2) then look at what those guesses imply and then go out and do observations/tests to see if those guesses have any value.
Fossils are nature's witnesses as are radioactive rocks and light from outer space. Pyramids, cuneiform tablets, papyrus and animal skin scrolls, such as the dead sea scrolls and the books of the Bible are witnesses of human history. ALL witnesses, natural or human NEVER prove anything, but must be BELIEVED or not.
Yup, as I said above - you set the standard for proof so high that in your mind there is no difference between (1) a scientific theory with heaps of supporting evidence and (2) what someone wrote in a book.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
We have actual specimens of actual creatures which have some features of men, some features of apes. Interestingly enough, the older ones are more apelike, the younger ones are more human-like.
Agreed. But in his mind the following happens:
"Can you not understand that science is what we observe happening TODAY and _history_ is what happened in the past? Nobody can do experiments or observe past history. We have to rely on human or natural witnesses. Fossils are nature's witnesses as are radioactive rocks and light from outer space. Pyramids, cuneiform tablets, papyrus and animal skin scrolls, such as the dead sea scrolls and the books of the Bible are witnesses of human history. ALL witnesses, natural or human NEVER prove anything, but must be BELIEVED or not."
In arminw's mind the specimens are not real, they are instead "witnesses". Thus he is free to choose which witnesses he wants to believe, and the truth value that his mind assigns to those specimens can then be set lower than the truth value his mind has set for the bible and genesis/flood. All this is so that he does not have to change the model he currently has of how the world works.
If J.K.R wrote Windows: Puteulanus fenestra mortalis!
...If you CHANGE those numbers, you CHANGE a lot of things...
Originally posted by by arminw (717974)
Not so. For example, take the famous equation e=mc^2. Atomic rest masses "m" are proportional to 1/(c^2). Thus when c was higher, rest masses were lower. If the rest mass does down as c goes up then energy will be conserved.
LOL arminw you are a God of illogical thinking, having your cake and eating it too!
Simply put on this off-topic discussion. The majority of evidence points to an unchanging value of c, with a small amount of evidence which could be a changing value of c.
Either way this has nothing to do with evolution because many different lines of evidence points to the Earth being billions of years old. Such evidence includes geology, cosmology, radio active decay and evolution.
The most dangerous drug