Slashdot Mirror


User: Jhan

Jhan's activity in the archive.

Stories
0
Comments
405
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 405

  1. Re:to paraphrase on Microsoft Tries a "Switch" Campaign · · Score: 5, Interesting

    The thing is that Apple users have heard all the anti-Apple flack for years and know where their loyalties lie. The average Windows user doesn't know that anything else exists.

    Hear, hear. They can have some pretty absolute opinions about other OS's though, without ever having used them, or even seen them.

    I've been a pretty avid alternativist for the last two decades. I used to be (still am in some ways) an Amiga nut. I dived into BeOS when it was new. I was an early adopter of Linux, and have had one or two BSD machines.

    My father (without actually bothering to look at any of the machines for 10s) would always say "Give it up! There is no alternative! Windows has won! No-one will ever use anything else!"

    Well, the last time Pops came over, I showed him my new flat-panel iMac. I just did some basic demoing, like showing him the zooming dock at the bottom, window shadows, speach recognition, and of course the fish in the background (yes, any OpenGL screen saver can be run as a desktop background).

    Response? We'll, he looked a bit shocked. Then he looked a bit flabbergasted. The he looked stunned for a while. Then he said "I want that in my computer".

    At which point I explained "You can't have that in your computer. It's nigh impossible in Windows. But if you got a Mac..."

    May be one more convert for the Gray Side.

  2. Re:It makes sense on Smaller Than The Mini PC, The P4/2400 Micro PC · · Score: 3, Interesting

    Interesting points... Summary:

    • OS in read only memory
    • Booting applications or even full OS environments from removable media
    • Cheap, yet powerful machines that are ultracompact, quiet and cool.

    Something similar to this A600, perhaps? This fits nicely with my theory that the market for home computers (as oppsed to office computers transplanted to the home) never really went away. They just stopped being produced, for no very good reason.

  3. Re:What about brainfuck on If Programming Languages Could Speak · · Score: 2

    I would say "kill... meee..."

  4. Re:I think so on Generation Wrecked · · Score: 2

    That would be generation 'Å'. In the Swedish alphabet 'Å' follows 'Z'. Then 'Ä' and 'Ö'.

    However, if we want to be strictly 7-bit ASCII, it would be "Generation [", or perhaps "generation {". Generation "Left Bracket" in any case.

  5. Re:What about liability? on Come on Up (to the ISS) You're the Next Contestant · · Score: 2

    No, they emphatically would not buy insurance. Why should they? Do you buy insurance before buying an ice cream, just in case you spill it down the front of some lady, causing her to sue you for, I don't know, sexual harassment?

    In Russia the situation is the opposite. People do not sue even if there's plenty of reason to do so. They'll just bite the sour apple, bitch a lot, and have another shot of vodka:-) (of course, this is all changing as we speak, though I doubt they'll ever get as bad as the Americans :-)

  6. Re:Hehehehe on What Would You Do With a New Form of Encryption? · · Score: 2

    I don't want to break you, but you understand nothing at all about One Time Pads

    Using a (randomized) OTP, your encoded data is turned into randomized (really, fully, totally!) data.

    Trying to use a 'Known Plaintext' attack against this is totally meaningless. Try this: "cat /dev/random > test.txt".

    How could you match your known plaintext against the random data in "test.txt"? It's meaningless! You will get any possible decoding.

    The way you depicted it looked like a cesar cipher, about the most primitive cipher ever constructed. No one has done it that way for hundreds of years. If you're a troll, I'm caught :-)

  7. Re:What about liability? on Come on Up (to the ISS) You're the Next Contestant · · Score: 2
    [Hopefully] in this sue-happy society, the Russians have considered the ramifications of a situation where something bad happens

    Woah, Ahmericun alert!

    The Russians (as in "living in Russia"? You know, the non-US country?) are hardly affected by the current state of "this" (meaning US, I suppose) country.

    Liability suits taken to an insane level, and then two notches beyond that (what did that woman in he recent case against Philip Morris get? $28 billion(!?) 28 BILLION dollars?!?!? - Gasp, gasp, gasp - Insanity) do not exist outside USA. In the rest of the world, we base claims on actual damage done, not the carrying capacity of the defendent.

    Back to space accidents: Russians do not think like Americans do on these issues. If you paid $plenty to get on a russian mission and it challengered, the russians would just say (to your family) "Very bad. These things happen. What? Pay you? Why?". Harras them enough and they would say "OK, you'll get standard loss-of-life compensation, $5,000. Now get out before we let the dogs eat you."

  8. The backbone of sex on What Does The Internet Look Like? · · Score: 5, Funny

    So, could anyone give me a few examples of the people who are the backbones of sex? I'd sure like to bone them right back, since they obviously handle a large percentage of all sex in the world.

    Even if they won't be boned by me, maybe they could carry my requests to distant parts of the world to someone who might?

  9. Re:Consider This... on Burn your genes on CD -- for $500,000 · · Score: 2

    Interesting, interesting....

    AFAIK, chimpanzee DNA has never been fully sequenced(?). Comparisons have probably been made using simpler DNA typing procedures.

    However, by now we have at least two complete human DNA's. Has anyone run a diff on them to determine exactly how much difference there is between two not exactly random but anyway humans? Assuming the DNA is 99.9% identical, your chromosomal uniqueness (stored as a diff from some Standard Human DNA) should fit on a single floppy!

    Heck, using this scheme, you should be able to store the DNA code of every single human being alive in < 10 PB, soon within reach of SAN storage clusters. The mind boggles... Of course, that would cost < $5e15 with current pricing. Maybe I can get a volume discount.

    BTW, is anyone working on mapping mitochondric DNA? How large is that, anyway?

  10. Re:Broken Time Machine on Burn your genes on CD -- for $500,000 · · Score: 2

    Being frozen for 1000 years and waking up in the year 3000?

    I think I've watched enough Star Trek to get along. I'd probably find some decendant to leach from...

    Then again, I'm just some pizza parlor dude, what do I know?

  11. Re:some questions on Burn your genes on CD -- for $500,000 · · Score: 2

    1> cd /mnt
    1> ls -l
    -rw------- 1 johf wheel 660000000 Sep 20 09:15 dna.txt
    1> more dna.txt
    CGAAGACTCTTTCAGATCGGCTAGATTGATTACATCTCGGG ATCTCTATTGCGCTTAGCCTTAGCGTCTCTCGAGATCGAGATCTCGGCCT ATATTATGACAT
    dna.txt (0%)

    Seriously, the research crowd tend to use simple and open file formats. No need to worry.

  12. Re:Write your Congressman on Russian Snared By The FBI Sentenced To 3 Years · · Score: 2, Troll

    ... [a country that] ignores UN resolutions,

    Indeed. Kyoto, Haag, plenty more...

    has weapons of mass destruction,

    A, B and C. And lots of them.

    has invaded some of its neighbours,

    I wasn't aware of his? Mexico?

    treats ethnic groups in their territories badly

    Yes, the poor American Indians.

    and is lead by a nasty man.

    Sure, Bush-2 is extremely nasty. One of the nastiest so far. But hey, about the "invaded" point... We are talking about the US, yes?

    Conclusion: Bush-2 is the most dangerous man in the world today. We must nuke him at the first opportunity.

  13. Re:Does everything have to become a movie? on Napster: The Movie · · Score: 2

    ... He didn't revolutionize anything.

    He sure as hell revolutionized the way I steal music. The best thing since sounds.sdsu.edu. Mmmm... <=64 kB/s .au Bjork samples... (Pathetic side note: in 1993 I bought a MPEG card. The advertized cost was $2100 (!!), but since I was a poor student, they sold it to me for 'just' $700. I was so happy, because this upgrade would finally allow me to play all these musical .mp2 files that had started to appear on the Internet. ...doh! (no, the card could NOT handle .mp3)

    He didn't improve the standard of living for anyone.

    Thanks to him, and his followers, I now have a multi gigabyte collection of hi-def music I truly like, which soothes me every day. My standard of life has improved, thanks to Napster (and followers).

    He didn't create anything that had an impact on the majority of Americans.

    No, but he created something that had an immense impact on a huge minority (net-savvy people, all around the world.)

    No.. he wrote some software that pissed off the wrong people.

    ... who are acting the part of King Canute.

  14. 2002 Ignobel Prize Winners on Ig Nobels Awarded · · Score: 4, Informative

    No one seems to have posted an actual list of winners yet, so here you go.

    BIOLOGY
    "Courtship Behaviour of Ostriches (Struthio camelus) Towards Humans Under Farming Conditions in Britain," Norma E. Bubier, Charles G.M. Paxton, P. Bowers, D.C. Deeming, British Poultry Science, vol. 39, no. 4, September 1998, pp. 477-481.

    PHYSICS
    "Demonstration of the Exponential Decay Law Using Beer Froth," Arnd Leike, European Journal of Physics, vol. 23, January 2002, pp. 21-26.

    INTERDISCIPLINARY RESEARCH
    Karl Kruszelnicki of The University of Sydney, for performing a comprehensive survey of human belly button lint -- who gets it, when, what color, and how much.

    CHEMISTRY
    Theo Gray of Wolfram Research, in Champaign, Illinois, for gathering many elements of the periodic table, and assembling them into the form of a four-legged periodic table table.

    MATHEMATICS
    "Estimation of the Total Surface Area in Indian Elephants (Elephas maximus indicus)," K.P. Sreekumar and G. Nirmalan, Veterinary Research Communications, vol. 14, no. 1, 1990, pp. 5-17.

    LITERATURE
    "The Effects of Pre-Existing Inappropriate Highlighting on Reading Comprehension." Vicki L. Silvers and David S. Kreiner, Reading Research and Instruction, vol. 36, no. 3, 1997, pp. 217-23.

    PEACE
    Keita Sato, President of Takara Co., Dr. Matsumi Suzuki, President of Japan Acoustic Lab, and Dr. Norio Kogure, Executive Director, Kogure Veterinary Hospital, for promoting peace and harmony between the species by inventing Bow-Lingual, a computer-based automatic dog-to-human language translation device.

    HYGEINE
    Eduardo Segura, of Lavakan de Aste, in Tarragona, Spain, for inventing a washing machine for cats and dogs.

    ECONOMICS
    The executives, corporate directors, and auditors of Enron, Lernaut & Hausbie [Belgium], Adelphia, Bank of Commerce and Credit International [Pakistan], Cendant, CMS Energy, Duke Energy, Dynegy, Gazprom [Russia], Global Crossing, HIH Insurance [Australia], Informix, Kmart, Maxwell Communications [UK], McKessonHBOC, Merrill Lynch, Merck, Peregrine Systems, Qwest Communications, Reliant Resources, Rent-Way, Rite Aid, Sunbeam, Tyco, Waste Management, WorldCom, Xerox, and Arthur Andersen, for adapting the mathematical concept of imaginary numbers for use in the business world. [NOTE: all companies are US-based unless otherwise noted.]

    MEDICINE
    "Scrotal Asymmetry in Man and in Ancient Sculpture." Chris McManus, Nature, vol. 259, February 5, 1976, p. 426.

  15. Re:How to break this transmission. on Ultrasecure Quantum Communications Over Thin Air · · Score: 1

    They'd be pretty stupid to do it that way, wouldn't they? Try this:

    1. Observe that a transmission is taking place and intercept some fraction of the one time pad, say, 66%.
    2. Recipient says "oh no, I only recieved 33% of the one time pad, it must have been random interference, please send more random numbers."
    3. Sender sends a new set of random numbers, this time all is allowed to go through. They attribute the bad signal to poor weather or whatever.
    4. S & R use the 33% of the data that got through in the first attempt, and 66% of the data that got through in the second attempt as their one time pad.
    5. Saddam: "Doh!"

    It's still not 100% secure, though. As many other posters have noted, a classic man-in-the-middle attack would work well.

  16. Re:The "Need" for speed? Bah! on Pentium-Based Macs The Future of Apple? · · Score: 1

    Dog-armed it! Missed a < :-)

    However, with IDE the bus mastering seems to just interrupt the CPU less for disk transfers, not totally absolve it from those duties. This is why SCSI has historically had a 2-3% CPU utilitization with the bus maxed.

    <anecdote>
    After spending many years as a sysadm/programmer for small corporations, I was given a consulting gig as a programmer at a major 'enterprise' (one of the largest public hospitals in Sweden).

    One day (sysadming dies hard), I spent some time checking up their system (clustered HP refridgerators, 40 disk SCSI fibre channel SANs). After some checks, I went to the local sysadm guy and quoth:
    "Your CPUs are only <20% loaded, but your disks are like 99% loaded all the time! You really need to get more drives!"

    The sysadm guy looked at me like I was slightly retarded, and said (slowly, using simple words)
    "Disks will always be the bottle neck, and we have the fastest ones as we can afford. Any good system will fully saturate the disks. 99% disk saturation is a sign of a well balanced system!"

    To which I could only reply
    "Doh!"

    To tie back into the SCSI Vs. IDE debate (and the post I'm replying to), if any 'real' system - real meaning 1000's of IO bound tasks - uses the disks to the max, then CPU load from IO can become a major selling point.

    Oh, and a final word. The above system, which served ~10,000 users, including many high bandwidth medical applications, had two 266 MHz PA-Riscs(!).
    </anecdote>

  17. Re:The "Need" for speed? Bah! on Pentium-Based Macs The Future of Apple? · · Score: 1

    However, with IDE the bus mastering seems to just interrupt the CPU less for disk transfers, not totally absolve it from those duties. This is why SCSI has historically had a 2-3% CPU utilitization with the bus maxed.

    <anecdote>
    After spending many years as a sysadm/programmer for small corporations, I was given a consulting gig as a programmer at a major 'enterprise' (one of the largest public hospitals in Sweden).

    One day (sysadming dies hard), I spent some time checking up their system (clustered HP refridgerators, 40 disk SCSI fibre channel SANs). After some checks, I went to the local sysadm guy and quoth:
    "Your CPUs are only

    The sysadm guy looked at me like I was slightly retarded, and said (slowly, using simple words)
    "Disks will always be the bottle neck, and we have the fastest ones as we can afford. Any good system will fully saturate the disks. 99% disk saturation is a sign of a well balanced system!"

    To which I could only reply
    "Doh!"

    To tie back into the SCSI Vs. IDE debate (and the post I'm replying to), if any 'real' system - real meaning 1000's of IO bound tasks - uses the disks to the max, then CPU load from IO can become a major selling point.

    Oh, and a final word. The above system, which served ~10,000 users, including many high bandwidth medical applications, had two 266 MHz PA-Riscs(!).
    </anecdote>

  18. Apex Design on Zaurus Software Reviews · · Score: 1

    I'm waiting for Payback by Apex Design.

    An awesome looking GTA2 killer, should be availible any week now.

  19. Re:power your CPU by burning wood on Power Your AMD Via Tesla Coils · · Score: 1

    You're willing to chop of your woody and burn it? Continously?! OW....

  20. Re:the best on When Users Attack · · Score: 1

    Ye olde cup holder... Reminds me of a nice CD anecdote told to me by a friend who used to work in support.

    This guy calls support.
    "I inserted a CD, but it didn't show up on the desktop, and it wouldn't play, or eject. So, I inserted another CD. Didn't work either, wouldn't eject. Nor did the third.

    It turned out that the user in question had as his normal CD player a Panasonic slot-in. His computer, OTOH, did not have a CD.

    It had a slot-in like gap below the disk drive, and the CD's had been falling right down onto the mother board...

  21. Expunged wimps on When Users Attack · · Score: 1

    12 volts 'shock' you?! Bah, that's hardly enough to leave sour taste.

    Back in school we had an electrical outlet that was severly broken for a few months. The unprotected copper wires hung right out into a well-populated set of stairs. As I live in Sweden we had 220V of brute power coming out of those wires, and kids would brush against them by the dozen every day...

    After I got shocked a few times, I used to go there and shock myself voluntarily every now and then. High voltage, high current AC is the ultimate pick-me-upper... BANG and your adreline is pumping, your 100% awake, 100% alert, ready to go, Go, GO!

  22. Zips... on When Users Attack · · Score: 1

    More Zip anecdotes...

    When we first got Zip drives at my workplace, we had a case of bad firmware leading to the drive not ejecting. My supposedly tech-savvy cow-orkers (who had never seen a mac) didn't realize what the pinhole ejection, erh, hole was for. They didn't bother to read the manual either.

    They agreed that the best way to save that expensive media was to apply a large plier and main force. They ripped that sucker right out of the drive.

    Needless to say, both drive and disk were in shreds after this. Me later: "All you had to do was poke the hole! Yeah, poke the hole! Have you guys never even seen a Macintosh?!"

    Lamenting the loss of Mac Eject Holes,
    Johan

  23. Yes, it can on ViewSonic shows 200 dpi display · · Score: 1

    I do realize that Aqua widgets aren't vectorized. Even so, scaling them up wouldn't be very noticeable (since we've also upped the resolution by the same amount). Vectorized graphics, including fonts, would look vastly better.

    In OSX v 11 I predict there will be a settings panel where you can enter the physical size in inches of the screen, and a second setting where you can enter logical-to-physical zoom factor. Vector content will render at physical resolution, bitmaps (including many gadgets) in logical, then scaled.

    After all, Apple have always been rabid proponents of WYSIWYG, and a major part of WYSIWYG is making sure that the on screen documents is the exact size of the printed document. You can't get that without knowing the actual DPI of the screen, can you?

    In this utopia, a 12 point font would be 12 typographical points in any resolution, on a screen of any size. And as I said earlier, changing the resolution of the screen would not affect icon/window sizes and positions, only their resolution. Come on Apple, it's easy.

  24. Re:OS X can do it on ViewSonic shows 200 dpi display · · Score: 1

    That statement is deliberately misleading. OS X "Zoom" simply scales the pixels (with interpolation, hence "smooth"). Also, the logical resolution isn't changed. so you have to scroll around using the mouse.

    Sigh. All the technology is there, why isn't Apple using it?!

  25. Re:What is this good for? on SGI Demos 64-Proc Linux Box · · Score: 5, Insightful

    Typical super-computing problems are weather prediction, air flow computations and nuclear reaction modelling. Physical models in other words.

    Generally, you attack these kinds of problem by partitioning 3-d space into many small cells, and then running relatively simple calculations on every cell. The better the resolution, the better the model.

    The thing about three dimensions is, storage space increases with resolution^3... For instance, I believe the weather guys are currently pushing 1kmx1kmx100m resolutions. That means about 3,2e11 cells. If each cell has 1 kB of state, the total memory usage would be about 320 TB.

    Super computing problems eat memory like Takeru Kobayashi eats hot dogs. In many (most?) cases the calculations are simple. Hence, bandwidth is King.