Slashdot Mirror
Burn your genes on CD -- for $500,000
An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs.
It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "
If you bring your own disc, that'll only come to $499,990.00
Great, now I can pick and choose my good triats (I have those, right?) and sell them on EbaY! So long as can get past the copywrite burn protection, that is. Oh wait, I have a felt tip marker here. =]
-Valiss
what it would sound like. Take the data on the CD, convert it to MP3 or OGG and then have a listen. While most of our "songs" would sound the same, I suppose some filters could be applied to record only the major differences. It might make for some interesting electronica.
I'll do all this for 50 cents outside my home. I am prepared to prick your finger with a needle, and do exactly what Venter is doing with a 1,000,000% discount!
If you don't know what Zoo Blacklisting is, click here.
This article has been done before!
And it doesn't cost me a penny!
Government of the people, by corporate executives, for corporate profits.
Purchase your personal gene map as seen here on Slashdot. Seems the price has gone down a whole $100,000!
like, is it 1 cd(i find it hard to believe, but not that hard) or 30? 1000?
now, what if you did that and then released it as a record.. and then sue everyone who had similar genes.. like, all who are blonde or redheaded..
(yeah stupid but i'm a b**ch
world was created 5 seconds before this post as it is.
From this first post: "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500."
This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.
The snow doesn't give a soft white damn whom it touches. -- ee cummings
Can't accept it when you make a mistake and post a story twice?
Gives a whole new meaning to a "bug" in your software...
than trying to find a suitable, willing girl to carry my genes, and probably almost as much fun, too!
Or else it is a copy right issue. I can't wait to see people putting their genes on P2P networks.
I don't suffer from insanity, I enjoy every minute of it.
Just more proof that, one day, the RIAA will indeed own all of us.
Clever as he may be, his service does not provide a way that every detail about your DNA structure can be put onto CD. What will be on the CD is a large data file containing the pattern of how your DNA is built up, which chemicals are where, and so forth. However, what will be missing is the important data about how each chemical that forms your DNA is made up ITSELF.
So you'll get your CD alright, but the only people who could actually do anything productive with that data is the same company who made the CD for you! They have to keep the information about the chemical densities of DNA fragments on their own computers, since you need to have actual samples of the chemicals to do this, and you can't store chemicals on a CD.. only references to them!
It's like saying you can store a house on a CD. Sure, you can store the floor plan, and even the absolute position of every brick, but you can't store information about the chemical structure of the bricks or the glass. You take house plans and buy the parts from a building merchant.
Likewise, the genomes on the CD are just like architectural plans on building DNA, but you'd need to go to a 'DNA building merchant' like the scientist's fine company to actually find out what chemicals are referenced in the plans.
Unfortunately there's no way around this, and the guy offers a great service.. but just remember, while he's the only company out there, he pretty much has a stranglehold over the data you'll be taking away from him.
mogorific carpentry experiments
cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.
"gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"
How long till the RIAA finds out how this violates the DMCA?
I don't see what the consumer gets for $500K, but I do see what the vendor gets: your DNA and a big chunk of money.
1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?
2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)
3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.
other than interesting reading material (that is if you only know letters A,C,G and T)
Won't this infringe on the gene sequences that have been patented by various companies and institutions?
Remember it may be your body, but someone else 'owns' your genes!
-- Many men would appreciate a woman's mind more if they could fondle it
cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.
Nah. Just store it with your porn DVD collection right next to "Anal Gangbang".
I don't remember too many details, but I do recall when the human genome was first completed, I recall reading somewhere that it would take something like 40 dual-layer DVD's to hold all the information.
Now since there is only 4 different pieces of data that need to be recorded, maybe it could be compressed. Thats two bits per letter instead of eight, right? That would still only bring it down to 10 dual-layer DVD's.
Ok, now this might sound ridiculous, but who would be suprised if the cd comes with a license agreement giving Mr. Greg Venter the copyright on the cd.
You could argue that the DNA is yours, and you can give a copy to as many people as you want, but let's say the data is in a proprietary format, hard linked with the software. Copying the software would be piracy and converting the data would be infringing the DMCA.
So, in addition to the large sum of 500 large US bills, you could be charged 10,000 for every extra copy. I'm not saying this is likely or even probable. Just possible.
Is that the latest fashion now? I am so out of date! I thought that ripped jeans were the latest fashion.
Remember, this is the guy who swapped HIS OWN DNA with the "random sample" that was supposed to represent all of humanity. Maybe this DNA-on-a-CD scheme is what he wanted to do all along?
Humpty Dumpty was pushed.
Why does it cost half a million dollars to get your genes on a cd when you can get 'em put on a t-shirt for 50 bucks?
"Sic Semper Tyrannosaurus Rex."
1. Release your genetic sequence on CD 2. ??? 3. Profit Sorry, couldn't resist! :-)
"Each chemical that forms your DNA" is adenine, guanine, cytosine, or thymine, and we've known the chemical structure of all those for decades.
Sir Arthur C. Clarke has said that his own favorite novel is "The songs of distant Earth", which was originally a short story. Set about 1,000 years in our future, it tells the story of the Earth's destruction as the Sun goes supernova.
While desperately working to build a giant starship to evacuate at least some people, scientists launch unmanned probes to other solar systems. They intend these automated probes to colonize planets so that humanity will survive in some form. For this purpose they're loaded with DNA from humans, animals, plants, etc. Machinery to do the work and some heavy-duty AI to run the show complete the package.
It's actually a great story and even had a cool soundtrack by the same name composed by Mike "Tubular Bells" Oldfield!
Chromosome 1:t tagt atcgatcgttagctactggtactgtgatgctgtgatgcgtatcgtatctg tgatgcgtatgctgtgatgctgtgggtggtgtggtgattatatatataaa atattttaaaaaaaaaaaaaaaaaaaaaagtgtctgtatgctgtgagctg tgactggttagtggcgtgcgcccccccccccccccccccgtattgggatt atttattatattatatatattatctctatcgcttctgcgtctgctgtgct gctgtgctctctcttcttcttttttttctctctcccgcggcgatgcatgc ggtcttgatcgttaggcttgtatgcgtggtacgtgatgctgtgtctgagt ctggtggatggtctggtctgatgcgttggattgc
atgcgcctagtttatagcgagcgtatgctgatcagtctggtatgg
Linux - Because Mommy taught me to Share.
Will a CD like this get me through the express line at an airport, regardless of whether or not I wear a turban.
/^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
Could i get my genome sequenced onto vinyl?
"Sic Semper Tyrannosaurus Rex."
..Or you could just put a drop of blood on the back of the cd.
Then someone will be able to decode your dna with the appropriate technology in a few centuries, those 500k cd's won't be useful until then anyway.
burning individual human's entire DNA sequences onto shiny compact discs
I can do that for less than $500k:
Ingredients:
One CD (make use of an AOL one for a change).
A skin or blood sample.
Preperation:
Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.
A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!
Are you local? There's nothing for you here!
Sure, it's expensive, but think of the value! I mean, that's just pennies per gene! With all of that information you can.. uhh.... erm..... prove your genetic superiority! I mean, after they sequence your genes and find out that you share 99% of your genes with every other human on the planet, you can use the remaining 1% to find out absolutely nothing that you didn't already know about your phenotypical characteristics! I know -- I'm just getting too excited.
Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
Cheers,
-----[0_o]-----
We are not amused.
Come to think of it, it is a lot cheaper to yank off onto a CD than do it their way. Both contain the same info, one just smells better.
Table-ized A.I.
Gives whole new meaning
I heard you could get it done for $5 from some pirates in Malaysia.
Great they will own us all.....I always wanted to pirate myself :--D
Come to think of it, it is a lot cheaper to yank off onto a CD than do it their way.
Imagine a Beowolf cluster of these
I wouldn't trust you with my genome considering you can't even do simple arithmetic.
A 100% discount means you'll do it for free. Anything over that and you'd be more than bankrupt.
blog
And it's more usable in a biological format too :)
"Backups are for wimps. Real men upload their data to an FTP site and have everyone else mirror it." -- Linus Torvalds
Next time I see one of these things, I'm going to find out where you live and put an icepick through your computer monitor, and then through your eye socket. IT'S NOT FUNNY ANY MORE.
Yet another Duplicate Story...
""Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome."
Even though it's you, you know they will copyright it.
And even though it's you, you know they will prevent you from copying and sharing it.
Bad what people do for money.
1. When does SP1 come out?
2. How long till I can just download it on KaZaa?
3. Does anyone have the md5 sums, I wouldn't want to get burned?
4. Is the CD licensed under the GPL?
So humankind, in its death throes, would launch the first salvos of interstellar biological warfare.
Arthur C. Clarke is a terrorist!
It's a joke . . .
blog
@fbiTopTen = wget("http://www.fbi.gov/mostwant/topten/fugitives /fugitives.htm");
foreach $criminal (@fbiTopTen) {
1. Download $criminal iso image from Kaaza
2. Clone
3. Put $criminal in enhanced growth chamber.
4. Get Lunch
5. Take $criminal to FBI and collect ransom
}
Profit!
Live web cams
Probably for the rich who think they can be recreated after death.
OOPS!
One scratch and all we can get is a fruit fly.
As another person who replied to this, I'd like to reiterate that the chemical composition of DNA is known. Composed of four different nucloside triphosphates (GATC) in an dynamically ordered structure.
If I follow your train of thought, than all of genomes that are sequenced are worthless to me and the scientific community because we aren't "the same company who made the CD".
Look here at the National Center for Biotechnology Infortaion's Genomic Database. I'd assume you would receive something similar to this from Venter's group.
Also one can FREELY browse the human genome and look for differences between your genome and those used to construct this draft of the genome.
They seem to have a habit of doing that, not to mention posting stories that are a year old...
I'll put your DNA on a t-shirt for free. Just unzip your pants for me.
Imagine, taking someone like RMS or Linus, then burn their genes on to a CD and GPL it. Then They WIll be Truly Open Source.
What is the chance that you'll have an archaic CD-ROM drive in your computer to read it????
This looks like one of those old stories about "overcoming his death by sending a message to the future".
Presently the only good potential customer I could see would be the one that dreams on making a copy of himself when medicine gets to advanced to achieve what can't do today. This thing goes on the same wave as the frozen cadavers, frozen human cells and the frozen human DNA. However we know that all this risk to degrade in time. So the idea of writing up one's DNA would be an intersting solution to these drawbacks. Is it?
No. Because CD are also not eternal. And besides there is a huge difference between genes and what comes up after. We humans are the less genetic species on Earth, and every detail on character, behaviour and knowledge is mainly a product of our everyday experience. We are formed under the circumstances we grow up, the conditions of our family, society and the world in the whole. Besides every single piece of experience can be very fundamental to our character.
Let's remeber an old tale that many people used on several SF tales - Adolf Hitler's clones. Would Adolf Hitler revive from his genes? Absolutely not. His copies wouldn't ever seen his strict mother and his father with that very character of an austriac small burocrat. He wouldn't have suffered that poisoning in Ypres battlefield and wouldn't have seen the turmoil of the Russian October Revolution beating on the doors of Germany. He would not be the same racist bastard because his antecessor managed to wipe out a good piece of Jewish population in Germany and this populistic view that "jews are to be blamed for everything" is hardly to be overused today. Who would really be the new Adolf Hitler is hard to predict. However I would believe that his fate would not be shinny. Because he would not have parents, his artificiality would probably hunt him for the rest of his life and society, with its stupidities, faiths and superstitions would always mark him as the "Butcher of the World".
Well, probably soon we will have "an holographic image of your brain on DVD" together with instructions to reproduce it... But even then I would hardly believe that anyone may get ready for eternity. What would happen if I suddenly travel 1000 ahead from now? Well, let's take someone 1000 before us, and think the SHOCK he would get:
Boxes showing people or talking.
Mettalic tubes that spit fire and make huge thunders.
Big metallic things that move without horses, some EVEN FLY like birds.
People talking to each other on distance.
Fire that burns without wood.
Some strange boxes, made of metal and something like glass, where people write some strange symbols that look like letters and pass huge amounts of time on them. Some of these boxes even play songs or seem to talk. Others show demons, dragons and even trolls.
In other terms - The Hell...
Can I get mine on DVD or does that cost extra?
Comment removed based on user account deletion
1. Burn your genes on CD /dev/acd0c (or any other CD-ROM device ;-) | md5sum -
;)
1a. Insert the CD into your CD-ROM drive.
2. cat
3. share it, print it, do whatever you want. You could even make a barcode from it, which results in a quite fancy tattoo on your forehead.
- MD5 checksum mismatch. No, you're not my mom
Interesting. I had assumed the whole purpose was to make a back up. Compared to a contract with IBM it seemed like the price was justified.
You can get a sample of your dna on a t-shirt here for about $50
$2000 - Getting your DNA mapped
$1 - Cost of CD-R
$10 - Burn Time Charge
$497,989 - Royalties that the RIAA says you owe the original artist (AKA Your Parents)
And out of that $497,989 --
$493,000 - RIAA Fees
$4,979.89 - Artist Royalty (1% of total Royalty Fee mentioned above)
$9.11 Actual RIAA loss due to P2P Network downloading of Gene Map ISO.
Cut to image of Brittany Spears selling her implants to prevent starvation...
Blog Prophyts - Right On, Man
does it have copy protection on it?
I'm not drunk, I just have a speech impediment. And a stomach virus. And an inner ear infection.
...willing girl to carry my genes, probably almost as much fun, too! :)
probably NOT, you definitely need to get laid my geeky friend!
Satanists get good grades too...suspiciously good grades
Human and chimp DNA are about 90% the same, they say. So all human DNA must be AT least 90% identical, if not 99%. Its only that last 1% which differentiates one human from another. Once the Human Genome Project is done, and all this DNA-in-common becomes public, you can burn 99% of your DNA on a CD for the cost of media, ie 10 cents.
People will complain that such general DNA is "not me!". But neither is "your" DNA you. A CD containing "your" DNA would be identical to a CD containing your twin brother's DNA. Are you your brother?
ps. Thanks for posting this story twice, I didn't get to comment the first time.
ggcacatcgacgatcgtacgtagcgcattatatttttcgatatcgtgcta gtcgtacgtatcgatgctgatgctagctagtcgatgctagtgctacgtag agtacgcatctcgatcgtagtgatctagctagctagtcgtgctagtcagc ttcgatgctagctaggcagtagcatctcgtagcacggattcgatgctagc tacgcatcgatgatcgatagtcgctcgctagatgatcgagcagcagctag a
If you burn this to a cd,send a check for 20$ to DNA,po box 23234,california
I never spellcheck and I freely admit it. Save your karma for more worthwhile "lol erorrs" replies
I find it interesting to see the spin that CNN health put on this article (not that I'm suprised CNN would put some sort of spin on their news). Labeling Ventor as an Entrepreneur. The word many times denotes someone starting a business for profit. Though in the article it says this is a non-profit venture. Even the sentence that is said in though has spine see here..
"He said he has lined up several wealthy individuals, whom he declined to identify, who will pay to have their genomes mapped and thus kick off what he said would be a nonprofit project."
Using phrases like "He said" as if the reporter does not believe Ventor's clame of the venture being non-profit.
Maybe I'm just paranoid or I have a severe distrust of the media (both really I'll admit it). I know for a fact when writing news or anything in general, its not good practice to add good words unless you're trying to say something between the lines. In that quote.. "he said" is definately uneaded.. Of course HE SAID it.. the reporter is referenceing a quote.. Oh well thats my two cents.. Maybe the reporter is right.. but personally I'd rather find that sort of thing out from the facts and not be fooled into believeing it because of the SPIN some news outlet puts on a story because of their own hidden opinions. Editorials shouldn't be masked as clean straight forward news reports.. But hey thats just my opinion.
Who makes you Sig?
DNA expresses a digital (quadrary) language.
I doubt that a human phenotype would fit onto 700 MB.
But it might well fit onto a future disc.
Consider some of the implications...
- p2p swapping of celebrity phenotypes - "psst, swap you a rare Marilyn Monroe for a Jucy Luicy"
- technology allowing us to create fertile eggs with any phenotype we happen to have in stock.
- a booming black market in stolen phenotypes.
- Clone Wars!!!
No thanks, I'll just copy my genes the old fashioned way.
Sig for sale or rent. One previous user. Inquire within.
I for one, cannot conceive of a better way for some rich moron to spend a half-million dollars than on another monument an over-inflated ego: "Fuck all the starving people in the world, I've got me a CD of my DNA sequence". And this appears under CNN's Health section, to boot. Shouldn't it be under their "What Dumb Assholes with Too Much Money Do" (or Investment) section?
Sigs are bad for your health.
Obviously, you wouldn't be allowed to own the patent.
I can burn my genes on the stove for free. Heck I can burn my jeans too while I'm at it.
I think this would be one of the best investments a person could make.
Too bad it will be all of rich people, which will skew the results of any statistics that could pop out of the research.
All super rich people must have a gene or two that supplies an aggressive desire to spend money, and aquire stupid gold digging mates.
Saskboy's blog is good. 9 out of 10 dentists agree.
Some drink at the fountain of knowledge. Others just gargle.
Article says he wants this to become easy enough to come to the point where INSURANCE COMPANIES can buy them.
"Oh, I'm sorry, we can't cover you, as there's a 22% chance you'll die of diabetes."
GATTACA, anyone?
"And this appears under CNN's Health section, to boot."
Hey, this might have something to do with health in a few decades!
Think how long it takes to get a drug developed and approved now, doing it the old way.
Given that the length of time taken is due to bureaucracy, worries over safety, ethics and the time rquired to do all the testing and statistics, not the actual science, why should this be speeded up by genomics?
In fact, drug and medical procedures developement could actually be slowed down. Think of the FDA being flooded with millions of new drug applications, each of which requires ~5 years of testing etc. before approval!
Star Treck science is still a little ways off!
Albert Eisteins' brain is kept in a jor (really!). And of course anyone we could dig up out of the ground that's less than a thousand years old might possibly have a retrievable DNA sample.
Some drink at the fountain of knowledge. Others just gargle.
I store my entire genome for free and all I just use a few kleenex and goatse.cx
You're confusing encoding with compression. Something composed from an alphabet of 4 letters is already essentially encoded in base 4, and can be encoded in binary using 2 bits per letter.
How much you can compress the resulting bit stream completely depends on the nature of the data, and without knowing something about the actual data patterns in the genome, it's not really possible to know in advance how much it'll compress.
IIRC, the accuracy on the current sequencing, while not awful, isn't perfect. Is the company liable for errors in the half-million dollar CD you're buying?
May we never see th
According to this little-known site.
Anyone who buys it won't find out they have the Sucker Gene until they get their disc.
If I wasn't so lazy, I'd have a sig.
More speculatively, there may be other things we dont know about yet that get a free ride from mother to child. To be very speculative, certain protein sets might very well influence the exprression of your genome. That is to say different developement.
This is not an unreasonable hypothesis, despite its high degree of speculation. Your and my Genonomes are so similar it is reasonable to suppose our differences arrise in part from HOW the genese are expressed. Expression is regulated by proteins in the cell that contains the DNA. Thus implanting your genome in another cell might not produce the same phenotype individual despite the common DNA.
Some drink at the fountain of knowledge. Others just gargle.
diff OpenGLFan.dna Einstein.dna > dna1.patch
cat dna1.patch | perl 'brain_only.pl' > dna2.patch
patch OpenGLFan.dna dna2.patch
And I could pass Tuesday's exam!
Midochondrial DNA has an extremely low mutation rate. I believe that as a result their geneic diversity is pretty small. The differences between your midochondria and mine would be slight.
"Never, never suspect the dreams within the dreams of dreaming children." ~The Amazon Quartet
i usually carry my genes with me, but i left them in my other pants...
Yeah? Well I can burn my DNA into a live human being with just a few pelvic thrusts.
eTrade SUCKS
I'm certain that genetics will have a great deal more to do with the field of medicine in the future. I'm not sure why you bring up drugs, except as an inference (there is no reference to drugs in the item). Anyway the "article" is not about drugs nor is it about Genetics, the science. It is a thinly veiled advertisement for Venter's business; a press release and sales pitch disguised as news. It is designed to appeal to the egos of the rich, while suggesting to everyone that it is for the good of all humankind. Bah.
Sigs are bad for your health.
Why pay $500,000 for my genetic code on CD when I can just get it off of kazaa or gnutella for the cost of bandwidth? I mean really.
You see? You see? Your stupid minds! Stupid! Stupid!
"Greetings friend. Do you wish to look as happy as me? Well, you've got the power inside you right now. So use it. And send one dollar to Happy Dude, 742 Evergreen Terrace, Springfield. Don't delay! Eternal happiness is just a dollar away."
NP
That might be worth half a million $, but like all stuff like this, "A fool and his money are soon parted".
Wouldn't it save a lot of cost to take a sample of your blood and have it frozen? Does that contain all of your DNA, or is it just part. Taking various samples and having them put on ice would probably preserve a lot more than having then on CD anyways.
What would they use this for? To make a clone-copy of you 100 years from now? That would be weird...
In the men's room:
Hey dude, you're like, missing something
I know, damn kids scratched the CD before I had it put in safety deposit
I'm going to donate some DNA in the old-fashioned way, it's much more fun - phorm
I just download my gene sequence from Kazaa.
ANyhow the basic thrust of the comment was that DNA does not have everything on it. It's not clear what it is missing or how important that is at this point in time.
Some drink at the fountain of knowledge. Others just gargle.
500,000$ !?!
Can someone send me the rip?
(no Nero *.nrg 's please!)
J/K =)
A horse can't be sick, you know, even if he wants to.
Pretty soon, the pirates will leak some dna codes and i will finally be able to download Bob Costas over gnutella.
Disco Stu was talkin' to you.
Whose t-shirt? I'd fork over $50 to put my DNA on say, Charlize Theron's t-shirt.
"I think all foreigners should stop interfering in the internal affairs of Iraq"
-- Paul Wolfowitz, 7/21/2003
It's alway good to have a backup copy of your genes in case you have to reformat / reinstall yourself.
Ideology is for ideots.
But CD quality sucks! If you need to store your DNA, you definitely need to use vinyl, because of the better fidelity and the need to store all inaudible sequences and "junk DNA" too. It sounds warmer. You won't believe the difference until you see it yourself...
(And now probably some biologist will note that digital DNA mastering process has improved a great deal since early 1980s. Hmphf.)
The DNA helix is not a protein-based structure, the nucleotide pairings (of Adenine, Guanine, Cytosine, and Thymine ) form a sequence which represents the genetic code. The code itself is used as a blueprint in chaining together sequences of amino acids which then undergo folding to become functional proteins. Here... http://www.pinkmonkey.com/studyguides/subjects/bio logy-edited/chap8/b0808201.asp
yeah, i had a friend who partitioned himself wrong and went to unichs (unix)
Disco Stu was talkin' to you.
Man, when Jr. destroys that CD (as he has many others), the propagation of my DNA will be halted...
Love many, trust a few, do harm to none.
Before I plop down 500k, does anybody actually know if this sounds good? I mean, I could pay a lot less for bad music.
I read that wrong at first. Although, that's about what it would cost if you got caught burning lots of your games to CD...
Tcl my Pico! There are 10 kinds of people in the world: Those who understand binary, and those who don't.
Yeah, "burn your genes"! Now!
Now if they'll come up with some kind of genetic assembly language, we could debug our own genome. Anyone want to write a genetic emulator to test the code on? :)
*It's not what you can do for the Dark Side but what the Dark Side can do for you!*
So, you take a pinch of mommy, a dash of daddy, and after 9 months... [dips finger into beakers and licks it]... Mmmm... that's good Billy!"
After you have burned your genes on CD put the CD into the microwave.
Oh what fun.
What's the point of having a backup of my genes if there's no meatspace-burner available yet ? Adaptec Easy DNA Creator on a 8x TDK BioBurner, then I can sell warez copies of famous pornstars as mail-order-brides. I'm gonna be rich!
-Billco, Fnarg.com
Think of it! Someday we'll be able to warez Jack Valenti himself off of gnutella! =:)
Great, now we can fuck the latest $BIG_EVIL_CORP and our partners simultaneously!
Probly the closest most geeks are gonna come to a 3some...
Ali
Ph33r m3!!!
Evey time I pic up a cd I leave one or more skin cells on it, so I have my DNA on cd so why should I pay someone 500k to do it for me.
Another small step on the road to Frank J.Tipler's Omega Point.d ex-2.htm l#Omega
http://www.aleph.se/Trans/Global/Omega/in
N/A
Anyone serious about preservation of his/her DNA would best save $498,000 and bank their blood or other bodily fluids for 10 or so years. Some companies even offer payment plans on that $2000 charge.
In ten years time the technology to sequence quickly will allow for this operation to be done at 1% of today's cost. (Yes, I will put money on that prediction.)
Of course when the time comes, if you really want to keep the sequence a long time, I wouldn't suggest CD-ROM. With a shelf-life of 50-200 years under optimal conditions, you'd be better with a book printed on acid-free paper. There you're looking at a shelf life of half a millenium or more under the same conditions.
What is a beowulf clusterfuck, Alex?
Mad scientists create an amusement park with the theme of cloning a post-neanderthal whose DNA was discovered during the government recall of all "Boy Band" music.
When the experiment goes awry, a young female tourist saves the day with her knowledge of Unix workstations*.
*UNIX is a registered trademark of William H. Gates DCXVII
WTF sense does this make. You want mt DNA? OK scratch some skin, take some blood.
...last time I burned my jeans it only cost me a new pair of pants and my dignity at the bon-fire.
PR
what I'd love to see is the "create a kid" feature:
Pop in your CD and one from a potential mate -- then push the button and have the software generate the array of potential vital stats on offspring. propensities, diseases, height and weight, correlations. as long as I'm dreaming, a good face shot too would be nice too.
it's a long way off. probably not in my lifetime, but it'll be here within 100 years.
you know if they're your genes? They could just alter and slap one they already sequenced, you wouldn't know the difference..
Dude, c'mon. Classic super-villain maneuver. Everyone had to know that was going on.
Oh, yeah and "shiny disks". Man! That justifies the price. No use putting it on those dull disks.
"I used to have that really cool,funny sig
Tevis's cock hung limply inches from his face. Gingerly he grasped the penis before him and lifted it gently. There along the sensitive underside were letters picked out in green calligraphy. It took a moment before his brain was willing to process the name. Qui-Gon Jinn was the name of Tevis's secret love. Stunned Qui-Gon dropped his apprentice's penis as if it was a red-hot brand. Struggling to breathe to think he fell back on his heels. Trying to school his features the Master watched helplessly as his Padawan's face crumbled from resignation to hurt. From one aching breath to another the young man fled to his room, the door slamming behind him. 'What have I done', his mind screamed. He leapt to his feet and ran to Tevis's door. Quiet sobbing could clearly be heard. Laying his forehead against the cold hard surface of the door his mind raced along the training bond he shared with his Padawan to find it blocked. Not just blocked, nearly severed! Despair and panic rose in equal measure almost overwhelming him before he could disperse them into the Force. . .
.Oh suck me . .Yes. . Please!
.I'm all right. . .More! .more fingers. . Harder fuck me harder. .I want your cock in me! Please. . .Now . . Please. . Fuck me!
.am . yours. . .Yours. . Fuck me. . please.
.Are you all right? As a friend tell me what is going on. Frankly I'm worried about you. Should we take this somewhere more private?
"Tevis, Padawan, open the door he pleaded.
"It was not what it seemed. Please let me in.
Qui-Gon strained to hear an answer. The sobbing continued unabated. Centering himself he considered his options. One option was patience. He could wait until his apprentice opened the door on his own. He feared Tevis would have irrevocably come to a decision by then and be tightly shielded before the door opened. He dreaded seeing the features he knew so well set along stubborn, willful lines shutting him out. Another course would be to force the door and make the younger man listen to him. Hadn't he forced things enough already, his conscience screamed. He had handled this very badly letting his jealousy rule his actions. Closing his eyes he immersed himself in the Force seeking guidance. Determination showed in his eyes as he opened them moments later. Reaching out with the Force he tripped the locking mechanism of the door. His beloved Padawan lay before him on the narrow student sleep- couch. Still naked Tevis was pressed tightly into the join between the wall and the bed. Sobs continued to wrack the lithe form. Kneeling silently beside the crying man he leaned forward and brushed his lips against the nape of his Apprentice's neck. Tevis's back stiffened. A tendril of thought along their bond was ruthlessly repelled.
"Go away Master.
Bitterness filled the young man's voice.
"No
the Master murmured sighing,
"I will never leave you my love.
Carefully, his body trembling, he planted soft kisses along Tevis's shoulder. Kissing the delicate outer curve of the ear before him he spoke softly,
"I love you my beautiful Padawan.
Qui-Gon continued kissing outlining a shoulder blade. Kissing was too shallow a word for his obeisance. Taking his time the Master nuzzled the soft skin over his love's spine. His tongue darted out to taste the tender flesh. A shudder passed through the skin beneath his lips. Tevis had begun to slowly relax under Qui-Gon's attentions. The shuddering sobs had ceased. Heartened he moved to nibble the edge of his Apprentice's ribcage concentrating on the areas that elicited the greatest response. Still the slim body stayed resolutely turned away from him. Setting aside his own desires he cleared his mind focusing only on that which his lips touched. It became as a meditative trance. His world shrunk to ascertaining and fulfilling the needs of every square unit of the young man's back. Forgotten were his own tears as their saltiness blended with the taste of the skin he worshiped. He was erect. How could he not be aroused finally kissing the shell that contained the bright spirit he loved. The responses of his own body were immaterial. He had delayed the gratification of his flesh for so long it no longer seemed necessary. Implacably the Master covered Tevis with kisses and nips tracing bone, sinew and muscle. Diligent, he thought no further than the next portion of his Padawan's succulent tissue he needed to soothe. It was with surprise that he reached the soft rise of Tevis's buttocks. Overcome he lay his cheek gently against the small of his Apprentice's back. Closing his eyes he basked in the living warmth. Nothing had ever felt so right as this skin next to his own. Surely Obi- Wan could sense this too. He poured the love and concern that filled his heart through the bond between them hoping that his love would accept some of it. A soft moan escaped the supple body. Qui-Gon pledged his love quietly, his lips pressed into his Padawan's flesh. Inhaling deeply he let the scent of his beloved lend him strength. With the help of the Force this will work. It must work. He would not give-up after waiting so long. He would make amends, make things right with Tevis. Fresh tears leaked from beneath his lids to trickle down the smooth skin against his face. Touching his Padawan with his hand for the first time since entering the room Qui-Gon's trembling finger softly slid along the cleft in the young man's behind. The muscles on either side clenched, denying him access. Heedless of the wrench in his gut at the exclusion he followed the path of his finger with his tongue. Muscles still clenched Tevis nevertheless quaked at the intimate caress. Determined, the Master slowly licked the valley again and again until he felt the muscles on both sides relax. He nuzzled the tender flesh for moment fighting for composure. Planting small kisses down towards the ring of puckered tissue his heart leapt when he felt Tevis pushing back into his kisses. Restraining himself he merely brushed his lips over the entrance to his love's body. He promised himself that there would be time for more intensive exploration later after he had won his Padawan back. Moving to explore the young man's legs he let himself smile at the faint moan from Tevis. Using both hands as well as his mouth he made sure that the strong thighs and calves received the attention they deserved. He was about to begin on the young man's feet when they were swiftly pulled from his grasp.
"Enough, Master please.
Tevis blurted turning and raising himself to sit on the edge of the bed. He visibly trembled his eyes closed his hands white-knuckled gripping the bedding. Distress and arousal warred over his features. Qui-Gon shifted and sat back on his heels before his Padawan's knees. Flushed, tear-streaked and lips parted Tevis's face was the most beautiful thing he had ever seen. He permitted himself to drink in the sight of his beloved. Muscles jumped and twitched beneath the smooth skin as if the young man was ready to explode. The Master wanted to gather the rigidly held body in his arms but dare not. His eyes drifted down of their own accord to the upright penis. Green letters danced livid against the angry flesh bobbing up between Tevis's thighs. Tevis strove to achieve some measure of control within his self- imposed darkness. In all the fantasies he had of revealing his feelings to Qui-Gon he never came close to envisioning the events of today. He had had pleasant daydreams of seducing his Master. Overcoming his objections with his love. Other scenarios featured the older man crazed with lust just taking him. Humiliated before his Master had never been part of his dreams. It would be easy to blame Bant for telling about the tattoo. Facing three masters, one of them on the Council he knew he couldn't have done better than his friend and no doubt would have done worse. Part of him wished that the Calamarian had told all. Then maybe he could've talked to his Master. Instead things had gotten bad so quickly he was sure Qui-Gon would've sent him away if he knew. If he was honest with himself he had to admit that things had been going downhill for months by the time Bant had coughed up her egg- sack about the tattoo. He knew the exact day when his Master had changed towards him. It was the day of his astrophysics exam. Elated with his performance he had hurried back to their quarters to share his good news. His happy words died on his lips when he saw his Master. The man had looked stricken, his eyes bright with unshed tears. Tevis had waited for Qui-Gon to tell him of the tragedy that had brought the sorrowful mien. He had seen that expression or at least its kin a few times on the Master's face and composed himself to bear the bad news. However the older man had told him nothing and had forcefully rebuffed his questions. Over the next few days he had seen the unexplained sadness replaced by chilly disapproval. Soon he could do nothing right. The warm comradery he had enjoyed at his Master's side was gone. Every time he turned around he found his teacher staring at him as if he wanted to thrash him. Commands and lectures were the only words he received from the other man. Tevis wracked his brain for what he had done to offend his Master so. Then he had found his poem missing. It had been stupid to carry it around but the childish scribble had made his unrequited love more bearable somehow. If his Master had found it, read it and realized it was about him. Tevis's heart had sunk further sure that the older man had been insulted by his composition and the audacity of his feelings. Steeling himself he had gone to his Master and asked if he had seen it. Qui-Gon had denied seeing anything like it and that was that. Masters do not lie. They might withhold information if they thought it was appropriate but lie, no. Feeling more composed Tevis dared to let himself consider his Master's words and actions since the older man had forced the lock on the door. Qui-Gon whispering of love into his ear, into his skin. The words he had dreamed of for so many lonely nights. Those lips making love to his skin. He had wanted to turn into that touch, that warmth so badly. There was a time when he thought he would accept any relationship his Master offered on any terms. After the tyranny of the last months he wasn't sure. Submission, so much of his life had come down to submission. Obey the will of the Force was the cornerstone, and in his mind it had become synonymous with following Qui-Gon. Willingly he had served his Master and the Order, striving for perfect compliance. Acceding to quaint customs and ugly prejudices on every mission. Deferential to master and knight alike. Everyone's wishes took precedence over his own. He had been happy in his surrender, his duty. That changed just as his Master had. The man had been so ruthless and severe that Tevis had instinctively sought escape. Qui-Gon hadn't desired to bend him but to break him to wrest all the secrets of his soul. It seemed that keeping his tattoo private had become a fight for the integrity of his spirit. As if in yielding, a part of him would ceases to exist. He had not openly defied his Master but he had resisted as much as he dared. If he acquiesced to the large man now would he find himself helplessly dominated more of a slave than a partner? Would Qui- Gon expect him to submit? Could he agree to such subjugation, could he refuse? He knew that his Master was waiting patiently for him to respond. That Qui-Gon had stopped when he had asked him was a good sign he decided. He could not test the other man's mood without dropping his shields and he was not going to do that if he wasn't sure. Opening his eyes at last he beheld the man he loved and had learned to fear seated before him fully clothed, legs folded beneath him. Oblivious to his gaze the Jedi Master was staring at his cock. Suddenly terribly conscious of his own nudity Tevis reached to cover his groin. Even more quickly his master caught his hands and kissed them.
"Forgive me for staring Padawan
the Master murmured.
"For me to see my name on your precious flesh, especially there. .
Licking his lips Qui-Gon swallowed convulsively. Blushing furiously Tevis unconsciously leaned towards the moist mouth. Realizing what he was doing the younger man stopped and pulled back. He would not surrender his will for a kiss. Not even one from his Master. It wasn't pride. It was survival of his ego, his individuality that prompted his withdrawal. Qui-Gon surged forward following his Apprentice's retreat. The big man's chest insinuated itself between the tightly clasped knees and his long arms wrapped around the slender torso pulling Tevis close.
"No!
Tevis cried. His over-sensitized flesh rushed to climax from the added stimulus of his Master's chest. Pushing hard against the other man's shoulders he tried to stop his ejaculation. Cum spattered Qui-Gon's front spurting over his tunics, throat and beard. Uncontrollable shudders wracked the smaller man and he closed his eyes in humiliation. Tevis felt the arms release him. Fresh tears coursed down his face. Spent, the Apprentice at least found his composure more easily regained post-orgasm. Not bothering to wipe the tears from his face he once again looked upon his Master and waited for the rebuke. Qui-Gon was scraping his Padawan's seed from skin and cloth with delicate sweeps of his fingers. Stunned Tevis watched as the Master brought each captured droplet to his mouth sucking his fingers clean. Sensing the Younger man's scrutiny Qui-Gon flushed crimson continuing his cleaning nonetheless.
"I had wanted to taste this at the source but this is delightful in its own way
Tevis's Master rumbled, a shy smile transforming his features. Sighing deeply, it was a moment before the Padawan could trust his voice.
"We need to talk, Master, . . . Qui-Gon.
Tevis's voice emerged hoarse, uneven.
"Yes. Whatever you want, my love. I want to apologize. .
Tevis cut him off,
"Strip.
His tone was much more controlled this time.
"What?
A flicker of doubt flashed in the older man's eyes.
"Strip
he repeated.
"You're my Master, older and bigger than I. I can't change those things and I don't want to.
The Apprentice groped for words.
"There is already so much inequality between us. I will not accept any more. Either you strip or I need to dress.
He began to rise.
"Yes. Yes Pad . . . Tevis of course
Qui-Gon stammered attacking his clothes with trembling hands. Tevis savored each portion of his Master's body as it was exposed. He felt the tension within him ease. Maybe his Master really did want him, not a slave. Qui-Gon dropped his eyes from the younger man's turning his face away embarrassed by his own arousal. His turgid erection sprang free from his trousers, the crown slick with pre-ejaculate. His blush deepened. He visibly warred with himself not to cover his genitals. As soon as he was fully naked he again knelt before his Apprentice and abased himself. He pressed his forehead to the top of younger man's feet, his hands resting flush against the floor on either side.
"I humbly beg your forgiveness Tevis. I have lied to you, betrayed your trust. I have violated your privacy. I disregarded your feelings and undermined your self-confidence. I let my obsessive jealousy and fear harm your training.
The Padawan tried to interrupt placing a hand on the grey-streakedhair. Qui-Gon clutched his Apprentice's ankles.
"Please I beg you let me finish. I humiliated you to your friends and before the High Council. I was cold and harsh in my treatment of you. I nearly got you killed.
The Master's voice cracked.
"I don't deserve to be your master let alone your lover. I will do anything to repair the damage I've selfishly caused. I am truly sorry. I love you. I submit myself for any punishment you deem fit. Please don't leave. . . me.
Silence stretched between the two men. Shock robbed Tevis of his voice. He stared open-mouthed at the man crying against his feet. Shivers chased each other over the Master's frame. The older man's obvious distress unlocked the Apprentice's paralysis. Taking the trembling shoulders in his hands he tried to lift them. The Master began franticly kissing Tevis's toes the grip on his ankles turning almost painful. He'd thought I had been trying to push him away the Young Jedi realized. Drawing on the Force he slowly dragged Qui-Gon upright.
"Why Master? Why did you do this?
Tevis cradled his love's face wiping the tears away with his thumbs.
"What started it?
This time it was Qui-Gon who had his eyes shut.
"I found your poem. The thought of you with another tore me apart. I kept seeing him touching you, corrupting you. I had not known true jealousy before. As much as I fought it, it consumed me. Rage filled me. I had to know what man had stolen your heart from me.
"Why didn't you talk to me. I worried that you had found it. I thought you'd realized it was about you and it had sickened you. I was waiting for you to cast me off.
He kissed the older Jedi's eyelids, his forehead, the bridge of his nose.
"I know now the poem was about me.
He mused aloud more to himself than to Tevis.
"But then I did not. I was afraid if I confronted you about it I'd lose you altogether. I was a fool. All this could have been avoided if I had asked you.
Qui-Gon shook his head in shame.
"We've both been foolish. As Master Yoda said 'Plenty of blame there is for all.' Let no more fear come between us.
Tevis kissed the older man's lips chastely thrilling at their softness. He could not get enough of that mouth. More kisses followed. The sweet heat called him. His tongue traced the velvety lips demanding entrance. A wave of possessiveness engulfed the young Jedi mixing with the lust and love already there. Emotions overflowed him. Partially lowering his shields he let the heady combination pour down the link with his Master. Pushing forward the Apprentice overran the Master pressing him onto his back. The erection under him desperately thrust into his belly. His tongue took Qui-Gon's mouth much like he planned to take the Master. The older man opened under Tevis's onslaught. He was drowning in his Padawan unwilling and unable to resist. Long ignored needs soaked up sensations and emotions as the younger man ravaged his mouth. Abruptly Qui-Gon's lips were abandoned. Moaning he raised his head seeking to renew his connection to that savage heat. Arms sought to bring his suddenly devilish apprentice closer again. Evading his Master's attempts to capture him he snaked down the long chest. Using quick nips, kisses and finger tweaks he made his way to his goal. In a moment he was on his knees between his beloved's legs. Reaching Qui-Gon's engorged cock he found himself pausing overcome by the sight. He had dreamt about seeing this flesh erect countless times. Several shades darker than the surrounding tissue it arced over the taut stomach the flaring head pointing at the navel. So solid so beautiful. Well short of frightening, his Master's penis was considerable nonetheless and the thought of it thrusting inside him was generating an intense internal heat. He couldn't look at it without wanting it in his mouth. Wrapping his hands around the solid shaft he lifted the dripping head to his lips. Qui-Gon watched avidly as the young man smeared precum on his lips. A groan escaped him as Tevis took the crown of his erection into the hot recesses of his mouth. He knew he wasn't going to be able to last long he had almost come just seeing his Padawan handle his cock. He writhed trying to hold off, to prolong the exquisite agony. Watching the Jedi Master squirm he swirled his tongue softly around the head filling his mouth. Probing the small slit in the tip for more tingling fluid he felt Qui-Gon's trembling hands rest on the back of his head.
"Oh Tevis. . Oh Love that feels. .
Qui-Gon's disjointed babble started as a whisper and quickly evolved into a shout as his Apprentice swallowed his penis deeply. His Master's hands fisted in his hair. Tevis knew the man was fighting the urge to force more of his cock deeper. Tears started in his eyes as he resisted gagging on the large organ. Using the Force he soothed the muscles of his throat. Slowly he pulled back until once again only the crown was in his mouth. Pausing he waited for Qui-Gon and in a few seconds he felt the pressure of the Master's hands on his head increase prompting him. Tevis lowered his mouth over the cock taking even more into his throat. Swallowing repeatedly he massaged the hard length further down his throat. He raised and lowered his mouth again and again rapidly. Head thrown back the big man whimpered as Tevis's nose reached the curling hair at the base of his erection. His scrotum was drawn tight against his shaft meeting the young man's chin. Clever fingers stroked his balls and he was lost, his orgasm tearing through him. The cock in Tevis's mouth swelled and then pulses of thick spicy fluid were shooting down his throat. Sucking as well as he could, cum still backed up flooding his mouth. Releasing the softening flesh he sat back. Qui-Gon sprawled in front of him drenched in sweat, gasping for breath, beautiful in his abandon. Sliding his chest up along his Master's until they were once more face to face, he wet his lips with cum and kissed the parted lips beneath him. Hands clutched his head deepening the breathless kiss. Qui-Gon's tongue licked the inside of his mouth finishing by cleaning his lips and chin. Strong arms wrapped around his back holding him tight. Tevis licked a path to his Master's ear.
"Are you all right my Master?
Tevis lingered outside his room afraid that he would find a very angry Jedi Master inside. Sighing deeply he released his anxiety. There was no way to tell how Qui-Gon had reacted. He wasn't sure himself why he'd felt compelled to take this course but it felt right. Another deep breath to calm his racing pulse and he stepped into the room. Hips raised, his Master knelt before him on the narrow bed, his head pillowed on his forearms, face averted. Setting the cup of oil he'd brought from the kitchen alcove on the bedside table he eased behind the trembling form. Draping himself over Qui-Gon's back he felt the older man stiffen. Kissing the shallow hollow between shoulder blades he wrapped his arms around sleekly muscled chest.
"You are so beautiful my Master
he nuzzled the surprisingly soft skin.
"Just do it Padawan. I accept your punishment
Qui-Gon hissed between clenched teeth. Straightening he reached for some of the oil and started to slowly caress the Master's buttocks and the cleft which divided them.
"Years ago I used to watch you when you brought your lovers home to your bed. I could see everything through the vent over my desk.
He felt the tension in the flesh beneath his hands increase.
"Watched as you prepared them and then thrust into them. I'd wanted to be the one receiving the pounding of your cock. I fantasized about it all the time. You stopped bringing lovers home. Why was that Master? Did you find out I was watching? You never said anything. No matter.
Tevis's oil-slicked finger circled the other man's anus.
"I never saw you taken this way. All the times I witnessed, you were on top as it were. Why was that?
His voice was silky. The other man remained silent.
"I've never done this you know. I've read about it and watched you do it of course. Always my teacher whether you meant to be or not.
Chuckling he trapped Qui-Gon's hips against him with one arm and the assistance of the Force as the bigger man tried to pull away. The Master could've used the Force and his superior size to free himself but he didn't. One finger wormed its way into the tight ring of muscle.
"How do I do it? Tell me how to fuck you my beautiful Master.
Leisurely he pumped the single digit in and out twisting it to spread the oil more.
"Tevis. . .
Qui-Gon grunted as the invading finger found his sweet spot.
"You seem. . . to be doing a fine job on your own.
"Thank you my Master. But I do need you guidance.
He again stroked the spot that had caused such a satisfying response.
"Is this correct?
The older man jerked in his grasp.
"I've no desire to hurt you my love indeed I wish to give you pleasure. Tell me when you're ready for the next finger.
He kissed Qui-Gon's shoulder and laid his cheek against the sweat slicked skin. While he found this incredibly arousing he had no urge to hurry things. He wouldn't enter the man till he begged. Begged for him. Removing his finger he ignored Qui-Gon's moan and coated it once again with oil. Reinserting it he assumed a torpid rhythm hitting the Master's prostate with each slow thrust. Hips reluctantly started to push against the intruder. Tevis submerged into the sensations surrounding his finger and the play of muscles across the older Jedi's back.
"Another
Qui-Gon ground out finally.
"Another?
He queried absently.
"Put another finger in.
"Are you sure? There's no rush I could do this all day. Are you sure you are ready?
"Yes! Damn it put another finger in. Please.
"Of course my Master.
Withdrawing his finger languidly, he dipped two fingers into the oil. Dripping he pressed them into the Master's most intimate spot. Qui-Gon pushed back eagerly groaning with this new trespass.
"There, does that feel better?
Sluggishly he resumed thrusting rhythmically. With his other hand he gently petted the heavy erection hanging between the other man's thighs. Grunting loudly the Master thrust hard into Tevis's hand and immediately after pushed back forcefully burying the fingers deep in his ass. Tevis held him tightly stilling his movements.
"Are you all right my love? We can stop.
A small smile visited the young Jedi's face briefly but he kept his voice serious, concerned. He bent and kissed the over- heated skin of the man beneath him.
"No! Yes! Don't stop
Qui-Gon panted sweat dripping from him.
"No? Yes? Which is it my Master?
he started slowly pumping his fingers again but removed his hand from the older man's cock.
"Don't stop. . .
The Master growled between thrusts.
"More? More what? More fingers, more thrusting? Tell me what you want?
Qui-Gon threw his head back desperately trying to see his Padawan's face.
"All of it.
His voice vacillated between a whimper and a shout.
"Yes my Master.
A third oiled finger joined the other two stretching Qui-Gon's opening further. The Master sighed luxuriantly. Muscle resistance melted as he thrust harder, faster into the willing ass. He could feel and hear the other man's rock hard penis slap against his belly with each thrust. The hips were pushing back hard to meet his fingers. Abruptly he stopped and withdrew his fingers. Draping himself over the sweat-soaked back once again he let his own hard-on nestle into Qui-Gon's cleft. The Master writhed under him rubbing his backside against Tevis's shaft. The moment stretched. He could feel his Master's movements getting more frantic with each passing second.
"Fuck me! Tevis. .
"Yes, Love. It's all right. You are mine, my Master.
He stroked the well-muscled back gentling the big man as he would a spooked animal. Leaning back he poured more oil into his hand and coated his erection. Qui-Gon watched him hungrily over his shoulder.
"Please!
"Say it. If you want me to fuck you, say it.
"What. . . What do you want me to say? Fuck me?
"Say you are mine, my Master, and I will fuck you as hard as you want.
The Master hung his head no longer wishing to meet his lover's gaze.
"I
Placing the head of his cock at the stretched muscular ring he slowly slid it home.
"So hot! So perfect, my Master.
Bucking his hips Qui-Gon started a fast, hard rhythm.
"Fuck Me! Fuck Me Harder!
Holding his Master's hips in a punishing grip Tevis complied, thrusting into the other man as hard as he could. Checking the older man for pain through their bond and finding none he gave himself over to the moment. They grunted their pleasure together with each thrust. He wanted to reach and grab his Master's cock but he couldn't make himself let go of the other Jedi's hips. Then he realized Qui-Gon's own hand was furiously working the erection. The sight wrung an even more frenzied rhythm from Tevis. With surprise he felt a trickle then a torrent of emotion thunder down their bond. Love, lust, shame and guilt all were overwhelming him battering against his shields. It was too much. He arched every muscle straining intent on driving his cock ever deeper into the man under him. His shields broke with his release. Distantly he heard shouting. Qui-Gon reeled from the backlash of his Padawan's broken shields and his own climax. His body convulsed nearly throwing Tevis from his back. Helpless he collapsed into the narrow bed, Tevis's breath harsh on his back. He had volunteered for this Mace Windu reminded himself for the thousandth time. Thinking to spare Master and Padawan further embarrassment he had offered to meet with the men and report his findings to the High Council. Rubbing his face he released his feelings of guilt over the matter, again. Dread was a leaden weight in his gut. They had been such a good team he thought sadly. No use anticipating, if master and apprentice needed to be separated so be it. He'd know soon enough. It had given him some small measure of hope when he had talked to Qui-Gon this morning. Sounding weary but calm the Master had suggested the luncheon date. A public versus private meeting argued that they had managed to settle things. He hoped so it pained him to see his friend in such distress. Not to mention the boy, almost ready for knighthood, it would be more than a pity if they lost him over this. Sighing, he watched for the pair to enter the dining hall. Qui-Gon appeared at the entrance his Padawan one pace behind and to the side just as was proper. Opening himself to the Force he watched the two approach trying to glean as much information as he could before they reached him. They were both tightly shielded but that was to be expected. There was something. He relaxed further letting his intuition have free rein. Understanding dawned the Padawan led the Master. One pace behind and to the side he may be but he led his Master to the table regardless. Reserving judgement he smiled and stood in greeting.
"Master Jinn, Padawan Kenobi I'm pleased you were able to meet with me so soon.
"It is our pleasure Master Windu. Padawan?
The boy bowed.
"With your permission, my Master, I will fetch our trays. Would you like me to bring you one as well Master Windu?
Shaking his head he resumed his seat.
"That won't be necessary Padawan, thank you.
The Apprentice nodded and after exchanging a look with his Master left moving towards the food lines. Mace took the opportunity to study the master seated across from him. Qui-Gon's eyes remained trained on the youth's retreating form for the space of several heartbeats before he turned back to face him. With great deliberation Qui-Gon presented himself to his friend for closer examination. Mace searched his friend's face letting the Force guide him. Serenity glowed from the other man's features. Then again Jedi Masters were supposed to be serene. However there was serene and serene. Recently he had seen his old friend wear his serenity like a hair shirt stiffly and with an air, which bespoke long hours of meditation. This was different. Only a long time companion or one gifted in the Force would be able to see it. There was a dreamy quality to his face a softening of lines usually set. He looked younger. The anger and despair that had been lurking behind his eyes was gone.
"Well Qui-Gon?
Mace asked at last.
"Well what?
"Qui don't make this harder than it needs to be. Did the boy show you his tattoo? The High Council doesn't need to know the name as long no abuse took place and the matter has been resolved between the two of you.
"He is a man Mace not a boy. I'm sorry I had forgotten about the Council.
"Man, I stand corrected. I can believe you forgot the Council you ignore them most of the time anyway.
The Council Member couldn't keep a small smirk from his face.
"That's an exaggeration and you know it.
Qui-Gon returned the smile.
"The matter is resolved between my apprentice and I. There was no abuse.
"That is well my friend but I need to know if he showed it to you. It's an issue of compliance as you should know.
"Yes he did willingly
the master blushed deeply as he spoke. Grin broadening he clasped the other Jedi's hand.
"I don't think you need to tell me who's name you read on that man's genitalia. Imagine seeing one's name on such an intimate part of another's body.
It was interesting to watch his friend and former lover's skin turn an even more fiery shade.
"You have no idea Mace. No idea at all.
Qui-Gon suddenly pinched the bridge of his nose his eyes closing, struggling against a surge of emotion.
Qui? .
"Like last time Mace?
He snorted looking up at the man across from him his eyes too bright, his smile lopsided.
"I'm perfectly fine really. It's just that so much has happened in such a brief time I haven't been able to totally assimilate it.
"You know I'm sorry about that but you weren't exactly doing great on your own if you recall. I'm still waiting for you to tell me what is going on between you two.
Mace watched as Qui-Gon's expression turned a little distant. His Padawan calling he recognized and scanned the dining hall for the young Jedi in mind-touch with his friend. There he was loaded down with two food trays talking to that Calamarian Padawan and her master but he was looking at Qui-Gon. The intensity of this youth's gaze was startling and the Council Member found himself trying not to squirm as that predatory stare raked over him. 'Oh sweet Force now what' he wondered as he shared his attention between the master and apprentice. Full focus returning the master nevertheless let himself enjoy the afterglow of his mental exchange with Tevis.
"'Mace do you remember the games we used to play shortly after we were knighted? When we were still together.
Relief flooding Windu at the sudden change of subject made him laugh out loud.
"Of course I remember. Being on the Council doesn't cause amnesia you know.
"Pity
he replied dryly.
"I learned a lot from those games. I was so unsure of myself when I was knighted and that role-playing helped give me confidence.
"You made such a good dominant Qui but you hated it at first. Once you got the idea though you ran with it. Even now when disagreements between the Council and you heat up it I keep expecting you to have a quirt in your hands. I have to remind myself that it will not end like it used to.
Mace teased.
"It is no joke. I believe I learned those lessons in dominance too well. When I'm stressed I find myself falling back into the role far too easily without thought. Using the techniques against Tevis. I tried to break him to my will out of jealousy. It was unconscionable of me to abuse him and my authority so. He hadn't any means to stop me Mace.
"Let it go. It's over.
He gave the large hand under his a squeeze.
"Not for Tevis. It will take some time for me to regain his trust to repair some of the damage I've caused. He needs reclaim a measure of freedom and control over his life.
"And apparently over you as well. I sensed something of that when you entered the dining hall. Near to knighthood or not 'A Padawan must follow the leadership of his master'.
"When does it cease to be leadership and become control for control's sake. We are striving for a new equilibrium. What harm is there to defer to him here on Coruscant during our private time. It will not disturb our training and working relationship. I believe it is essential for restoring much needed balance.
Before he could voice his skepticism Qui-Gon's Apprentice had appeared beside his master. Mace once again felt the heat of the younger man's gaze. There was no anger or insolence in it just that disconcerting intensity.
"I apologize for my delay Master. I have your tray.
Tevis spoke quietly but it galvanized the other man. Qui-Gon quickly looked up at the youth and blushing anew snatched his hand from Mace's grasp. A flicker of guilt crossed the Master's face.
"Tevis. Master Windu and I were just discussing the wishes of the High Council.
"Indeed my Master.
Setting the trays down he seated himself next to Qui-Gon.
"Yes. Your Master was just telling me that all is settled between you. Do you agree? Can I infer from this that you think you will once more be able to work with each other effectively?
"Oh yes Master Windu. I believe or bond is stronger than before.
The Apprentice impressed him as both calm and sincere. The letter of the law had been upheld he didn't have to know what these two men did in private Mace reasoned with himself. Patience and time were needed to evaluate this 'equilibrium'.
"Master we will have to eat swiftly if we are to complete our errand before our scheduled time in the training room.
"Yes Padawan
answered Qui-Gon smiling.
"Errand
the Council Member inquired? The dreamy cast to the Master's face was back.
"Yes, we are going to visit a tattoo establishment my Apprentice is familiar with.
"Another tattoo Padawan Kenobi? Have you learned nothing?
Disbelief colored Mace's words. Qui-Gon cleared his throat.
"Master Windu I am the one who is procuring a tattoo
he said serenely.
Could this be the latest expression of what the selfish gene?
consider this: just burn your genome to cd, and lable the disk(s) "Microsoft paladium crack" and give them to an asian cd pirate and you suddenly have thousands of copies of your genome out there in the world.
It's the cheapest way to clone your genome, and no toilet training, or college educating required.
Wake me up when they can burn LIFE EXPERIENCE to a CD. Then and only then can you even come close to approximating what we are as human beings.
A stored DNA sequence is about as relevant to our desire for immortality as a camera. What does a snapshot of you say about who you are and the way you think?
What a fucking joke.
it's a very interesting way to get your research financed and have no strings atached by other companied who want to share in the knowledge.
Privacy is terrorism.
A lot of people are discussing the file format
:-)
:
/note="5S ribosomal RNA" //
and the practical problems (would it fit on
a CD etc).
I actually have a copy of all GenBank primates
in gzipped form and it takes roughly 1.0 GB.
That's primates and not just homo sapiens (it
is mostly homo sapiens, though).
There is a plain text format used (flat) and
it is pretty well documented. Look for
GenBank flat file in ncbi.nlm.nih.gov. I think
that they have migrated to a "linked" format
similar to html to allow better indentation.
The flat format is great for Perl
A sample of the actual source is
LOCUS AAURRA 118 bp ss-rRNA RNA 16-JUN-1986
DEFINITION A.auricula-judae (mushroom) 5S ribosomal RNA.
ACCESSION K03160
VERSION K03160.1 GI:173593
KEYWORDS 5S ribosomal RNA; ribosomal RNA.
SOURCE A.auricula-judae (mushroom) ribosomal RNA.
ORGANISM Auricularia auricula-judae
Eukaryota; Fungi; Eumycota; Basidiomycotina; Phragmobasidiomycetes;
Heterobasidiomycetidae; Auriculariales; Auriculariaceae.
REFERENCE 1 (bases 1 to 118)
AUTHORS Huysmans,E., Dams,E., Vandenberghe,A. and De Wachter,R.
TITLE The nucleotide sequences of the 5S rRNAs of four mushrooms and
their use in studying the phylogenetic position of basidiomycetes
among the eukaryotes
JOURNAL Nucleic Acids Res. 11, 2871-2880 (1983)
FEATURES Location/Qualifiers
rRNA 1..118
BASE COUNT 27 a 34 c 34 g 23 t
ORIGIN 5' end of mature rRNA.
1 atccacggcc ataggactct gaaagcactg catcccgtcc gatctgcaaa gttaaccaga
61 gtaccgccca gttagtacca cggtggggga ccacgcggga atcctgggtg ctgtggtt
(mushrooms are not primates, of course)
P.
For the price they can easily afford to put it on a DVD. :-)
Imagine combining the DNA of some sexy celebrity with cheap, offshore cloning. You'd get living sex toys.
Just think: every geek could have their very own Britney/Amadala/etc living toy...
Wait a minute. Was I trying to say this is a bad thing? Bring on the clones!
Ed Wedig
Graphic design services
docbrown.net
Incredible! This could have saved Cobra Commander and Destro millions of $ to put Serpentor together. Just order Hitler DNA on-line, and it comes to you in a sleeve. No need to invade tombs for King Tut's DNA...
In the future: Insurance companies asking for a copy of your DNA CD when applying.
...and now he is getting ridiculous. Or longing for big money. 1. The human genome is still not fully sequenced. 2. Getting a single human DNA 100% sequenced in a reasonable amount of time (say a few months) is science-fiction for years to come. Read the news, other scienticts talk about 2050. What would it be worth, anyway: 3. Even the exact number of genes is not known yet. Numbers are ranging from 30.000 to 40.000. Let alone what these genes really do! Some funny comments like that one "a drop of blood on a CD" contain more thruth than Ventner giving interviews.
This has been done before. Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G.
Be careful. Ayn Rand will sue for trademark infringement.
I've heard that humans share something like 97% of the same genetic code with a mouse and like 99% of the same code with a chimpanzee.
If that's true, then you could save a substantial amount of space by just burning the diffs between yourself and a standard chimp.
Well, in some cases around here you might not need a whole CD.
A floppy would probably suffice for all the diffs between some of us and the chimp.
"Provided by the management for your protection."