>The only working democracy in the Middle East, ever, was started by a bunch of desperate Greek murderers-for-hire.
You forgot about Israel, which is the MOST functional democracy in the middle east, parliament and all. Both Jews and Arabs have full voting rights in Israel.
Re:bad article summary from bad article title
on
Photoshop for DNA
·
· Score: 1
>What the article lacks is one critical detail - how exactly they plan on doing all this.
They synthesize the gene in very small pieces on a solid surface using a microarray with microfluidics, cleave the pieces off the support, error check them, and put the pieces together. Clever.
Read about it in a Nature article linked to by their website.
Good guess, but only part of that sequence is actually in the human genome, in chromosome 20 (with one error):
Query: 103 catcagctactatgtagctacgatc 127
Sbjct: 84163 catcagctactttgtagctacgatc 84187
The quality of match is rated at E=0.65, which means that you would expect to find a match this good by chance 65% of the time. (E value will change slightly if you search different databases.)
Try searching for the sequence yourself here under Nucleotide-nucleotide BLAST (blastn)
If you want to see the real thing, you can browse one version of the "real" human genome here. If you click on the blue chromosome 1, and then "Download/View Sequence/Evidence", then "display", you can see the repeating "telomere" sequence at the beginning of chromosome 1.
There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer,
Nor should there be; general estimates of the number of genes have nothing to do with mechanisms by which gene therapy might cause cancer. Nor is it unexpected that gene therapy can cause cancer; that has always been a known risk.
To be more specific, the cancer caused by that form of gene therapy seems that the retrovirus used to insert a block of engineered DNA into the genome inserts the piece in an "unlucky" spot. The genes are broadly spaced in most regions of the genome, and most insertion sites will not cause problems. But if the engineered DNA gets inserted in the wrong place- say in the midst of a potential oncogene (cancer-promoting gene)- then cancer might result.
So if there are less genes in the genome, if anything there would be less "vulnerable" spots to hit that would cause cancer. But really the number of total genes is not tightly linked to the number of insertion sites that could be oncogenic.
Besides, there is still plenty of complexity. Alternative splicing can take one gene and make many alternative mRNAs that can produce different proteins. Alternative splicing takes the estimated number of _transcripts_ back up to several times (?) the number of genes.
not exactly correct - experts say:
In a nutshell, small vehicles account for more than twice as many occupant deaths as large vehicles, according to HDLI figures. Why are large vehicles safer? "The laws of physics dictate that, everything else being equal, the larger the vehicle the lower the crash forces reaching the occupant compartment," explains Hazelbaker. This is because the energy in an impact has a larger area over which to spread and therefore dissipates more readily.
But don't equate weight and size, cautions Clarence Ditlow, executive director of the nonprofit consumer advocacy group, Center for Auto Safety. Quoting the late Dr. William Haddon, former administrator both of NHTSA and IIHS, Ditlow points out that "size is beneficial, weight is hostile" when it comes to crash safety. A heavy vehicle, while it tends to push lighter vehicles out of the way in a crash, also delivers more impact and therefore can inflict more harm.
The Bottom Line
The safest vehicles are large and lightweight, designed especially to absorb crash impact without causing it. Large, heavy vehicles are safer than smaller vehicles for occupants but their weight usually contributes to overall damage in a crash. Small vehicles are the most dangerous for occupants but the safest for others and for property, especially if the vehicle is lightweight.
Hmm. Based on your explanation, I don't understand how the engine can turn the vacuum pump if the ignition is OFF. I was under the impression that even though the wheels are turning, if you turn the key off, no gas is sent to the engine and the engine would quickly be at 0 RPM- no pistons moving, no fanbelt turning, no vacuum pump, nothing. Are you saying that the inertia of the vehicle spinning the wheels keeps the engine turning when there is no gas? Or is the vacuum pump attached to something that moves when the engine is not turning? (If so, how does it turn when the car is stopped?)
I know that even after turning the engine off, there is a little bit of vacuum built up that will give you one or two pumps on the brake. Is that what you are referring to? I don't know if that would be sufficient to stop from 120 mph though.
There is one instance where the actual value of the stock price makes a difference. Some exchanges delist you when yoru share price falls and stays below $1/share. So to avoid an embarassing reverse-stock split, companies that issue a split have to be confident that their share price will stay well above $1. This embarassing nature of a reverse stock split is psychological, true, but the $1 limit is real.
Most people going to med school these days are NOT primarily concerning with getting out of the hospital with a Mercedes. I graduated from Harvard college in 1997, and my classmates who DID want a Mercedes went into management consulting and investment banking, and have been making 6 figure salaries for 7 years now. Some of them are millionaires. In contrast, your average medical student: lives in a tiny dorm/apartment throughout med school, takes out an average of $95,000 in loans, and when they finally graduate and do a residency, they make only $40,000 per year. (Subtract out loan payments.) When they do their fellowship to become a specialist, they will get paid about the same.
You are wrong about the timing: it's more than 10 years to become a specialist- at a minimum: 4 college, 4 med school, 3 residency, 3 fellowship= 14 years with negative or small salary.
And the training is grueling- if prisoners were forced to work as hard as residents, it would be ruled cruel and unusual. You can look at the new
work-hour guidelines for residents that are supposed to IMPROVE the situation- 80 hours/week averaged over a month, work an average of 6 days a week, shifts can't be longer than 36 hours straight! Note that many programs are still working residents harder than that!
Even after finishing training and starting a successful practice, would you want to continue to work 60-70 hours per week, plus be woken up receiving phone calls from patients all night for the rest of your adult life? How about regularly being woken up to go into the hospital in the middle of the night when one of your patients has a heart attack?
Honestly, most doctors deserve to be paid more than what they are making. There are still a couple of specialties where doctors are RELATIVELY overpaid, but your average doctor deserves at least what he or she is making. There are plenty of valid criticisms of the medical profession, but doctors getting paid too much is not one of them. And to address the original topic, the contribution of doctor's fees to total healthcare expeditures in this country is miniscule. Some of it has do do with liability insurance and the high cost of hospitalizing patients with all of our expensive, modern technology.
Slashdot Mirror
original article in Nature
news article in Nature
Space is supposed to be reserved for peaceful purposes only. Check out these treaties. Sounds like this satellite might be illegal.
>The only working democracy in the Middle East, ever, was started by a bunch of desperate Greek murderers-for-hire.
You forgot about Israel, which is the MOST functional democracy in the middle east, parliament and all. Both Jews and Arabs have full voting rights in Israel.
>What the article lacks is one critical detail - how exactly they plan on doing all this.
They synthesize the gene in very small pieces on a solid surface using a microarray with microfluidics, cleave the pieces off the support, error check them, and put the pieces together. Clever.
Read about it in a Nature article linked to by their website.
Good guess, but only part of that sequence is actually in the human genome, in chromosome 20 (with one error):
Query: 103 catcagctactatgtagctacgatc 127
Sbjct: 84163 catcagctactttgtagctacgatc 84187
The quality of match is rated at E=0.65, which means that you would expect to find a match this good by chance 65% of the time. (E value will change slightly if you search different databases.)
Try searching for the sequence yourself here under Nucleotide-nucleotide BLAST (blastn)
If you want to see the real thing, you can browse one version of the "real" human genome here. If you click on the blue chromosome 1, and then "Download/View Sequence/Evidence", then "display", you can see the repeating "telomere" sequence at the beginning of chromosome 1.
There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer,
Nor should there be; general estimates of the number of genes have nothing to do with mechanisms by which gene therapy might cause cancer. Nor is it unexpected that gene therapy can cause cancer; that has always been a known risk.
To be more specific, the cancer caused by that form of gene therapy seems that the retrovirus used to insert a block of engineered DNA into the genome inserts the piece in an "unlucky" spot. The genes are broadly spaced in most regions of the genome, and most insertion sites will not cause problems. But if the engineered DNA gets inserted in the wrong place- say in the midst of a potential oncogene (cancer-promoting gene)- then cancer might result.
So if there are less genes in the genome, if anything there would be less "vulnerable" spots to hit that would cause cancer. But really the number of total genes is not tightly linked to the number of insertion sites that could be oncogenic.
Besides, there is still plenty of complexity. Alternative splicing can take one gene and make many alternative mRNAs that can produce different proteins. Alternative splicing takes the estimated number of _transcripts_ back up to several times (?) the number of genes.
not exactly correct - experts say:
In a nutshell, small vehicles account for more than twice as many occupant deaths as large vehicles, according to HDLI figures. Why are large vehicles safer? "The laws of physics dictate that, everything else being equal, the larger the vehicle the lower the crash forces reaching the occupant compartment," explains Hazelbaker. This is because the energy in an impact has a larger area over which to spread and therefore dissipates more readily.
But don't equate weight and size, cautions Clarence Ditlow, executive director of the nonprofit consumer advocacy group, Center for Auto Safety. Quoting the late Dr. William Haddon, former administrator both of NHTSA and IIHS, Ditlow points out that "size is beneficial, weight is hostile" when it comes to crash safety. A heavy vehicle, while it tends to push lighter vehicles out of the way in a crash, also delivers more impact and therefore can inflict more harm.
The Bottom Line
The safest vehicles are large and lightweight, designed especially to absorb crash impact without causing it. Large, heavy vehicles are safer than smaller vehicles for occupants but their weight usually contributes to overall damage in a crash. Small vehicles are the most dangerous for occupants but the safest for others and for property, especially if the vehicle is lightweight.
Hmm. Based on your explanation, I don't understand how the engine can turn the vacuum pump if the ignition is OFF. I was under the impression that even though the wheels are turning, if you turn the key off, no gas is sent to the engine and the engine would quickly be at 0 RPM- no pistons moving, no fanbelt turning, no vacuum pump, nothing. Are you saying that the inertia of the vehicle spinning the wheels keeps the engine turning when there is no gas? Or is the vacuum pump attached to something that moves when the engine is not turning? (If so, how does it turn when the car is stopped?) I know that even after turning the engine off, there is a little bit of vacuum built up that will give you one or two pumps on the brake. Is that what you are referring to? I don't know if that would be sufficient to stop from 120 mph though.
There is one instance where the actual value of the stock price makes a difference. Some exchanges delist you when yoru share price falls and stays below $1/share. So to avoid an embarassing reverse-stock split, companies that issue a split have to be confident that their share price will stay well above $1. This embarassing nature of a reverse stock split is psychological, true, but the $1 limit is real.
How can alcohol based pens be bad yet the parent's "Quick page of Do's and Don'ts" reccommends cleaning CDs with alcohols?
There ARE tools that support WAV tagging. Try ATWavTag, designed to be used with the Turtle Beach AudioTron , a network connected MP3/WMA/WAV player.
The AudioTron is a neat gadget by the way, you should check out the geeks who support it.
Most people going to med school these days are NOT primarily concerning with getting out of the hospital with a Mercedes. I graduated from Harvard college in 1997, and my classmates who DID want a Mercedes went into management consulting and investment banking, and have been making 6 figure salaries for 7 years now. Some of them are millionaires.
In contrast, your average medical student: lives in a tiny dorm/apartment throughout med school, takes out an average of $95,000 in loans, and when they finally graduate and do a residency, they make only $40,000 per year. (Subtract out loan payments.) When they do their fellowship to become a specialist, they will get paid about the same.
You are wrong about the timing: it's more than 10 years to become a specialist- at a minimum: 4 college, 4 med school, 3 residency, 3 fellowship= 14 years with negative or small salary.
And the training is grueling- if prisoners were forced to work as hard as residents, it would be ruled cruel and unusual. You can look at the new work-hour guidelines for residents that are supposed to IMPROVE the situation- 80 hours/week averaged over a month, work an average of 6 days a week, shifts can't be longer than 36 hours straight! Note that many programs are still working residents harder than that!
Even after finishing training and starting a successful practice, would you want to continue to work 60-70 hours per week, plus be woken up receiving phone calls from patients all night for the rest of your adult life? How about regularly being woken up to go into the hospital in the middle of the night when one of your patients has a heart attack?
Honestly, most doctors deserve to be paid more than what they are making. There are still a couple of specialties where doctors are RELATIVELY overpaid, but your average doctor deserves at least what he or she is making. There are plenty of valid criticisms of the medical profession, but doctors getting paid too much is not one of them. And to address the original topic, the contribution of doctor's fees to total healthcare expeditures in this country is miniscule. Some of it has do do with liability insurance and the high cost of hospitalizing patients with all of our expensive, modern technology.