Slashdot Mirror


User: nbritton

nbritton's activity in the archive.

Stories
0
Comments
857
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 857

  1. Re:What does this hold for AMD on Intel Invests $218M in VMWare, Preparing for IPO · · Score: 1

    Well, considering that VMWare has been rushing to put together a Mac VMWare long since Bootcamp came out...

    You are clueless... http://www.parallels.com/products/coherence/

  2. Re:Or... Not on Free the iPhone from AT&T · · Score: 1

    You forgot step 2... Pay $200 to get out of the contract you signed with AT&T.

  3. Re:Be patient on SWSoft Out of Compliance With the GPL · · Score: 1

    "What if (say) Microsoft was including some Apple products in Vista - and hadn't responded to Apple's questions for 22 days. Would you be saying "Calm down, give Microsoft some more time to seek legal advice"?"

    Of course not, I hate Microsoft.

  4. Re:Quantum effects? on Theo de Raadt Details Intel Core 2 Bugs · · Score: 1

    "My favorite errata in the list is AI22, Sequential Code Fetch to Non-canonical Address May have Nondeterministic Results. Basically the chip decides that all of the high order bits should be '1', instead of '0' - for no apparent reason as its not consistent."

    That's not a bug, it's a random number generator.

  5. Re:What's the speed of force? on Matter Discovered Traveling at Near Light Speed · · Score: 1

    Hey guys, let's say you have a 500 foot pole out in space, far away from anything (no friction, nothing). you are on one end of the pole, and i on the other. Then i push the pole towards you. When does the other end of the pole move towards you, after MY END MOVES? is it instantaneous? or does it take .000000005 seconds of whatever. Like the atoms of the pole push each other on and on and so forth till it gets to the end. if it does take time, is it faster than light, or slower? what if the pole was 300,000,000 meters long? does it take about 1 second for u to notice the other end moves?

    Do not try to push the pole. That's impossible. Instead, only try to realize the truth: there is no pole. Then you'll see, it is not the pole that is pushed, it is only yourself.
    Are universe is infinitely small when viewed outside of it. Is it even mathematically possible to have something that's infinitely small on the outside and infinitely large on the inside? Could that explain quantum entanglement?
  6. BSD / MIT License on Closed Source On Linux and BSD? · · Score: 1

    5. Am I correct that programming in and selling BSD-based boxes won't raise any of the above problems?

    YES!!! The BSD license is basically a wordier version of the MIT license, which is displayed below:

    Copyright (c) {year} {copyright holders}

    Permission is hereby granted, free of charge, to any person
    obtaining a copy of this software and associated documentation
    files (the "Software"), to deal in the Software without
    restriction, including without limitation the rights to use,
    copy, modify, merge, publish, distribute, sublicense, and/or sell
    copies of the Software, and to permit persons to whom the
    Software is furnished to do so, subject to the following
    conditions:

    The above copyright notice and this permission notice shall be
    included in all copies or substantial portions of the Software.

    Thus BSD and MIT licensed code are treated as public domain, except for the the forced attribution, and sometimes advertising / promotional restriction, clauses. If you give credit where credit is due you won't have any problems....

    Please use are software in your software:
    MIT Licensed: http://freshmeat.net/browse/188/
    BSD Licensed (original): http://freshmeat.net/browse/187/
    BSD Licensed (revised): http://freshmeat.net/browse/1023/
    Public Domain: http://freshmeat.net/browse/197/

    ---
    "The way it was characterized politically, you had copyright, which is what the big companies use to lock everything up; you had copyleft, which is free software's way of making sure they can't lock it up; and then Berkeley had what we called 'copycenter', which is 'take it down to the copy center and make as many copies as you want.'" --Kirk McKusick
  7. Duh! on Apple Safari On Windows Broken On First Day · · Score: -1, Flamebait

    It's a beta you fucking idiot!

  8. Re:Name that quote on Classified US Intel Budget Revealed Via Powerpoint · · Score: 2, Informative
  9. How can people be so stupid? on Classified US Intel Budget Revealed Via Powerpoint · · Score: 1

    "This is even worse than declassifying documents by putting a box on top of text in a PDF. How can people be so stupid?"

    Umm... That's classified.

  10. Re:No competition on the low end on Puncturing the "PCs Are Cheaper Than Macs" Myth · · Score: 0, Offtopic

    Your right, the Dell is a bad deal... It can't even run OS X for Pete's sakes!

  11. Re:No competition on the low end on Puncturing the "PCs Are Cheaper Than Macs" Myth · · Score: 1

    The Mac mini has a Core Duo processor and the low end model, Mac mini 1.66 GHz Combo, has approximately the same computational power as a Pentium 4 3.0GHz Prescott with an 800MHz FSB and DDR400 RAM.

  12. Apples, Not Oranges. on Puncturing the "PCs Are Cheaper Than Macs" Myth · · Score: 1

    "Macs are still more expensive, and as far as I'm concerned". "The reason the Dell came out so expensive" "is that he insisted that the Dell have the exact same specs as the mac."

    Wouldn't that be an apples to apples comparison?

  13. Re:Faith is a poison upon mankind. on A Field Trip To the Creation Museum · · Score: 1

    He didn't say Christian, he said Christian Science. Christian Science really does discourage the use of most modern medicine, including blood transfusions. They believe illness can be cured by prayer and growing closer to God, and intervening with conventional medicine will counteract or contradict that process.
    What's so bad about that? It's a self correcting problem.
  14. Re:Looking at the schedule on their website.... on A Field Trip To the Creation Museum · · Score: 1
    "I notice they're not closed for Jewish holidays. As a jewish person, I always find that interesting."

    They're open on Sunday*...

    "Ye shall keep the sabbath therefore; for it is holy unto you: every one that defileth it shall surely be put to death: for whosoever doeth any work therein, that soul shall be cut off from among his people. Six days may work be done; but in the seventh is the sabbath of rest, holy to the LORD: whosoever doeth any work in the sabbath day, he shall surely be put to death." Exodus 31:14~15 and Exodus 35:2
    So if you believe in a literal interpretation, can I kill you for working on Sunday? It's a god given right yea know. We should kill everyone who works on Sunday, it's what the bible says we should do and the bible is always right.

    * http://www.creationmuseum.org/hours-rates
  15. Christianity and Science are Diametrically Opposed on A Field Trip To the Creation Museum · · Score: 1

    "I know plenty of Christians that are perfectly happy with evolution and science."

    No you don't. "The big bang, and evolution, invalidates a literal interpretation of the Old Testament, especially Genesis.

    Genesis -> Eve -> Sin -> Jesus -> Salvation = Christianity.

    A symbolic interpretation of Genesis invalidates Christianity. This is why all Christians have to believe in creation pseudo science."
    http://www.youtube.com/watch?v=IFcZUe0ADpY
  16. Re:Voting time on AT&T CEO Attacks Network Neutrality · · Score: 1

    For those Americans here who are of voting age, I suggest you start voicing opinions

    I did: http://www.youtube.com/watch?v=w5Rh0iH3_X4

    and the only thing I managed to get was a bunch of haters. WTF?

    ---
    Yes I know the message was poorly executed... but the facts are 100% correct.
  17. Re:Would the OS benefit from using this? on Intel Updates Compilers For Multicore CPUs · · Score: 1

    I wonder if Microsoft compiles Windows using the Intel compilers?

    Microsoft uses its own cl.exe to build Windows.

    GIGO.
  18. Your right, it's not Alpha! on OpenOffice.org for Mac OS X Alpha Released! · · Score: 1

    Pre_Alpha = Feature incomplete and lots of bugs.
    Alpha = Feature complete and lots of bugs.
    Beta = Feature complete and less bugs.
    RC = Speak up if you still have bugs.
    Release = Since no one is speaking out we'll assume it's golden.
    Release Patch = We missed some obscure stuff.

    If you look at the download torrent it says "pre-alpha development snapshot".

  19. OpenOffice Draw? on Alternatives To Adobe's Creative Suite? · · Score: 1

    What about OpenOffice Draw? It works fairly well for light DTP needs and it has a nifty built in PDF export feature.

    If you don't believe me have a look: http://en.wikipedia.org/wiki/Image:OOo_Draw_Screen shot.png

    Whatever you decide, stay far away from GIMP. It's a POS. If you have access to KDE try Krita: http://www.koffice.org/krita/

  20. UNIX Philosophy on GNU Coughs Up Emacs 22 After Six Year Wait · · Score: 2, Interesting

    Is it just me or does emacs go completely against the grains of *nix philosophy? i.e. simple, modular, parsimony, etc. The emacs base distribution is 126 megabytes, larger then the FreeBSD operating system... How did emacs get to be like this?

  21. Perfect time to boycott. on Insight Into AMD's Linux Driver Development · · Score: 1

    Now that Intel's back in the drivers seat we can leverage AMD into releasing ATI chipset documentation. Send a message that we won't stand for this bullshit anymore... boycott them.

    Let the president of AMD know why you won't buy his products: dirk.meyer@amd.com

  22. I want 450 MHz instead. on Google et al. Want 700 MHz Auction Opened Up · · Score: 1

    "Why not just leave the spectrum completely open to the public like 900MHz and 2.4GHz?"
    That would be great... But I'd rather have something around 450 MHz. 450 MHz is easier to propagate, compared to 900 and 2400 MHz, and it's also cheaper to make equipment and cabling for it. 450 MHz would be great for longer links and mesh networking.
  23. Re:Yeah! on A New Global Memory Card Standard · · Score: 2, Interesting

    "Most devices don't support CF, btw.

    You mean most of your devices. Professional photographers have standardized on CF. We've dumped millions into CF gear and it will be around for a very long time.

  24. Is that all I am? on Genome of DNA Pioneer Is Deciphered · · Score: 1

    >gnl|ti|1741299339 name:1094373133425 mate:1742401149
    gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt

    That's it, just 10^643 unique individuals? Anyone know if combination restrictions apply?

    ---
    I feel so finite.

  25. Nuclear Reactions. on 40% Efficiency Solar Cells Developed · · Score: 1