Slashdot Mirror


User: smellsofbikes

smellsofbikes's activity in the archive.

Stories
0
Comments
2,874
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 2,874

  1. A moral use for a botnet on Pay Or Else, News Site Threatens · · Score: 1

    Tell your army of pwned Windows machines to hit that server and read to page two: irritating blog vs. a couple hundred thousand clueless computer owners in court should be not only comedy gold but also a good lesson to everyone involved.

  2. Re:Knowlege workers on Information Rage Coming Soon To an Office Near You · · Score: 1

    Excellent clarification: thanks. I've never really been in that area of employment (unfortunately) so it's hard for me to do any sort of accurate assessment.

  3. Re:Easy fix on US Supreme Court Expected Political Ad Transparency · · Score: 1
    I see what you're trying to do. I propose the following experiment: Dan Maes is running for governor of Colorado. I think he's kind of a jerk because he doesn't like bicycles. So because the person who benefits from the speech gets punished, I dump a couple thousand dollars into a pro-Dan-Maes advertisement... And you may scoff, but that's already happening: people set up vile-sounding, vile-named associations to campaign for the opposing candidate: "Dan Maes is endorsed by NAMBLA!" for a made-up example. People have even paid individuals to run disgraceful campaigns to affect voter turnout: from the Wikipedia page on Alvin Greene, "Clyburn said he "just felt this was 1990 all over again", referring to the events in the 1990 primary in South Carolina when political consultant Rod Shealy recruited an unemployed black fisherman to run in a Republican congressional primary in order to boost white turnout for a different election on the same ballot."

    People are tricky and nasty and there are scads of unintended consequences to changing the law structure we currently have.

    Note that I *like* what you're trying to do: I just don't think it's going to work as well as it seems.

  4. Re:Agree with Parent on Information Rage Coming Soon To an Office Near You · · Score: 1

    David Allen talks about this in Getting Things Done, and what most people have on their plates are lots of amorphous blobs of stuff, not actionable items. So the first step is to break up big blobs into little actions, then take the first action.

    Another thing Allen says when most people say they don't have enough time, its not really time its how they use/don't use it that matters.

    I've been in both the how-to-use-time situation and the simply-not-enough-time situation (which is more typical in manufacturing: it takes a certain amount of time to replace a laser tube, and a certain amount of time to run a given amount of material through the laser, and they're not parallelizable tasks, for instance) and based on what I've seen I think David Allen has an unstated bias in writing to managers -- who are the people reading his book, for the most part. A producer has a workload largely determined by a manager, and a bad manager can give a producer more stuff to do than the amount of time the producer has available. Under many circumstances it isn't possible for the producer to make meaningful choices about how to spend time approaching the task. (Time spent on figuring out how to do the project more efficiently comes from the total time budget, and there's a risk that it will take longer to figure out how to be more efficient than it would have been to just do the project inefficiently. If the producer suffers the consequences of that risk, the producer is very unlikely to take the risk. This is where good management helps.)

    *Managers* have a problem with how they use/don't use their time. Poor managers result in producers who simply don't have enough time to do the jobs they've been assigned.

    So it's not that Allen is *wrong*, it's just that he's right concerning managers, but not wholly accurate concerning production in general. In my opinion, of course.

  5. Re:Easy fix on US Supreme Court Expected Political Ad Transparency · · Score: 2, Insightful

    Easier fix: all funding must come from the gov't, in equal (and relatively small) amounts for each candidate. Offer each candidate who gets the required number of signatures to be on the ballot, a set amount of TV time, a set amount of ad money, and tell everyone else to butt the fuck out of the process.

    I *like* this plan, and have always liked it, but it seems to run afoul of the first amendment. You can't prevent people (or, apparently, corporations) from endorsing candidates, and getting together in groups to form support coalitions for candidates, without stepping on their freedom of speech. Likewise, you can't stop them spending their money advertising in favor of a candidate, without stepping on the freedom of the press to print whatever they want (or are paid to print.) So how do we implement something that does restrict one or both of those, for the greater good of the democratic process, without hacking the first amendment into tiny bloody pieces?

  6. Re:Same method used for Soviet Bombers on How Allies Used Math Against German Tanks · · Score: 1
    I've been told, but can't find an online cite, that something similar happened with Soviet airforce flybys in parades: one of the companies building aircraft couldn't produce a new aircraft in quantity, so in a parade flyby they had the four existing manufacturing samples fly by, followed by a bunch of older aircraft, giving the four a chance to fly around in a circle and fly by again, giving the impression that the aircraft was in quantity production. People checking tail numbers or identification schemes might notice this but everyone else would buy the hoax. (I know the opposite happened, in a manner of speaking, with the TU-4 bomber, which was an identical copy of the B-29 Superfortress, based on Superfortresses the Soviets had acquired: the US knew they had three, and in a major parade observers saw the three fly by, and then while they were still in sight, a fourth flew by, at which point the US freaked because they realized the Soviets had a production line making bombers capable of reaching pretty much anywhere in America.)

    In a less militaristic use of serial numbers, people who own old higher-price equipment use serialization to estimate date of manufacture. In my case, I have an antique metal lathe and a few people who have owned them since they were new have posted the serial numbers and dates of purchase, allowing the rest of us to estimate by linear interpolation the date of manufacture of our lathes. A side-benefit of this is the ability to see if numbered or dated parts are original: the bearings in my lathe are stamped with manufacturing dates, and with the interpolated serial number date I can tell if they've been replaced.

  7. Slime molds do something similar on Bees Beat Machines At 'Traveling Salesman' Problem · · Score: 5, Interesting

    If you build a maze that has multiple routes through it, and two pieces of food in it, and drop a bunch of slime molds into the maze in various places, they will fairly rapidly coalesce into a single slime mold that extends through the maze on the shortest route between the two bits of food. Now, that's no traveling salesman problem -- but slime molds are single-celled animals, so they don't have *any* brains to do the calculations. They just rely on minimizing surface area and maximizing access to food. (And being able to stop being multiple organisms and start being a single organism, but that's an aside.)

  8. Re:Missing a Component on Building a Telegraph Using Only Stone Age Materials · · Score: 1

    He made a battery in the woods, and that's cool. I hadn't realized that copper and iron were that easy to get without digging much. And, I can see how he could get at least some distance of copper wire. However, he did not tackle sensing the voltage that's turning on and off and communicating that to the user at the other end of the wire. At least not in this video. Does anyone have an idea of how to do that?

    The first telegraphs were made with galvanometer detectors. In fact, one of the first designs used 5 wires and an array of galvanometers that essentially demultiplexed to point at letters -- a sort of ASCII display. Here's a picture of a cooke & wheatstone five-needle display. (and in case you wonder, yes, this is THE Wheatstone who invented the Wheatstone Bridge quad resistor sensor.) The galvanometers were essentially magnetic needles suspended by silk threads with electromagnets at one end, so a milliamp current flow from the closed key, many km away, would visibly deflect the magnetic needle.

  9. Re:Related: POW radio on Building a Telegraph Using Only Stone Age Materials · · Score: 1

    There is a long and glorious history of making Cat's Whisker Rectifiers out of a bit of wire and a rusty razor blade, or a chunk of pyrite or galena, to build crystal radios that required no external source of power. These were the first semiconductor devices, and were responsible for much if not most of radio receivers from 1900 until the late 1930's, and were regularly constructed in foxholes out of found materials throughout WWII and the Korean war.

  10. Re:Yes office, on Australian Visitors Must Declare Illegal Porn To Customs Officers · · Score: 4, Interesting

    The therapist you saw speak was Dan Savage, who writes the sex advice column Savage Love. He's fond of telling that story when people ask him what's the weirdest question he's ever been asked. Savage is largely known for popularizing a sexually offensive neologism, 'santorum' (I'll let you look it up) to the point that it's now the first hit on google, rather than the target of the satire, ex-senator and likely 2012 presidential candidate Rick Santorum. Savage's current big publicity project is the It Gets Better Project, trying to encourage gay teenagers to not kill themselves because of abuse; it's been getting a fair amount of news attention in the last month.

  11. Re:Water? on UK-Developed 'DNA Spray' Marks Dutch Thieves With Trackable Water · · Score: 1

    ""How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X" Are you sure it was only issued to company X? Show my evidence that no other bottle could possibly contain the same solution. See, with humans this process occurs naturally, everyone has different DNA (with extremely high probability) because of how biology works. Once you start making your own, you've shown that it's possible to duplicate DNA, thus the solution is NOT necessarily unique.

    It's fairly trivial to synthesize a chunk of DNA that is extremely unlikely to be natural: a couple kilobases of repeated GGGTTTCCCAAAGGGTTTCCCAAA is as unlikely to appear in nature as a monkey typing a couple kilobytes of Shakespeare. Of course it's *possible*, just as it's *possible* that someone else out there has exactly the same fingerprints as you do and that person was the one who left the fingerprints at the scene, but this is why we invented statistics.

    Add to that huge long repeating sequence, a 30 base sequence for actually identifying which customer bought this particular batch, and you have something that is at least as accurate as fingerprinting.

  12. Re:Honor Amongst Thieves on Thief Returns Stolen Laptop Contents On USB Stick · · Score: 1
    My sis-in-law had the experience that in downtown Denver her rusty Chevy Cavalier got broken into three times, including once when she hadn't bothered to replace the stereo after the previous time so there were wires hanging out of a hole in the dashboard... but when the car finally got stolen and beat up and she replaced it with a late-model Subaru Outback, nobody has touched it since. And sure that might just be chance, but three breakins in three years, followed by zero breakins in five years, with the car parked in exactly the same place, sure seems odd.

    And she'd left the Cavalier unlocked the last time and from the glass on the ground it looked likely someone still bashed the window before taking the car: the unlocked door only works if thieves check for it rather than assuming the door's locked.

    My girlfriend always leaves her car clean and unlocked, and nobody's smashed a window, although several times she's gotten in it to find trash that wasn't there previously, so she presumes someone has gotten in, gone through the pockets, and left. Makes me think wistful thoughts about an RFID proximity tag on the keyring, wired to an airhorn in the dashboard. Of course, the failure mode of that would suck greatly, but maybe a hidden cutoff switch...

  13. Re:He gets to meet Kari! on President Obama To Appear On Mythbusters · · Score: 1

    That woman is an idiot. I can't stand her. She used to be attractive, then she put on weight. A lot of weight. She may have been pregnant at one point, though, causing the weight gain afterward. [ stuff about flirting clipped]

    For the record, yes, she had a baby; she's been married for almost the entire time she's been on Mythbusters and she seems to be regarded by people who know her as a funny, reasonably intelligent woman who gets to be a sort of scientist on TV while pursuing a somewhat successful career as an artist. Sure, that's not a stunning endorsement, but it's an order of magnitude more success, in the world's eyes, than 99.9% of the rest of humanity will ever achieve.

  14. He gets to meet Kari! on President Obama To Appear On Mythbusters · · Score: 5, Funny

    I'd love to get to meet Kari Byron, too, but he went to all the trouble to get elected *President* just to arrange an introduction? Guy's got style and determination, no doubt.

  15. Re:FEH on Genetically Engineered Silkworms Spin Spider Silk · · Score: 1

    But to make a steel frame lighter than those made out of aluminium, titanium and carbon fibre the tube walls need to be so thin that they can be crushed between two fingers.

    Well... the thing is, there are two different goals in bike frame design: light weight and stiffness. (I'm presuming we don't care about durability.) Stiffness is, for the sake of this argument, a function of the cube of the diameter of the tubing and the specific modulus of elasticity of the material being used. The revolutionary idea Gary Klein had was that by using aluminum, with 1/3 the specific modulus of elasticity of steel, you only had increase the tubing diameter by the cube root of three, to get the same frame stiffness as a steel frame, while the frame weight was only a bit more than 1/3 as much as the steel bike, by using *really* thin aluminum tubing. As soon as he made that leap, titanium frames also made sense for the same general reason. But they both necessarily have very thin tubing, especially compared to steel, because a steel frame with an acceptable stiffness can be made with smaller-diameter tubing. So modern ultra-light-weigh steel bikes, made with True Temper S3, Reynolds 953, or Columbus OCx, can be built under 1300 grams, comparable, if not quite as light, as the lightest aluminum or titanium bikes, and only about 500 grams heavier than lightweight carbon frames. But at the same time, they're mechanically stronger because the ratio of the steel thickness to the tube diameter is *much* higher than a comparable aluminum tube. I've seen sub-1000 gram steel frames: Brent Steelman makes one, and I believe Rodriguez does as well. I can tell you for certain that the Indy Fab SSR and the Pegorotti Responsorium, which are both sub-1300-gram steel frames, are *markedly* more resistant to denting than a Cannondale aluminum downtube, because they're made from steel tubing that at its thinnest is still 0.3mm thick, and only 28mm in diameter, so it's much less suseptible to Euler column buckling than someone using, say, Easton Ultralight 7005 for a downtube, which is 1mm thick mid-tube but 60 mm in diameter. As a rule of thumb you start getting nervous when your tubing thickness is less than 1/20th of your tubing diameter, because past that it's getting quite suseptible to bucking, particularly if you have a dent.

  16. Re:Maybe stop surfing /. all day long on IT's Last Hope — a Job In the Boonies? · · Score: 1

    The executives want no employees, yet still want a mass market they can sell to and get big salaries themselves.

    That's ending as the mass market hollows out. Increasingly under 1% of the population takes most the money and doesn't share it. They are destroying their own market by not contributing any employee/customers to it.

    They believe that they can sell to developing countries and that will save their asses. Unfortunately for them, they are also under the impression that after off-shoring industrialized manufacturing and development, they will also be the ones making the stuff. Nope, technology will transfer and local firms will take over. Eventually, companies like Intel, GM, and any other big American corp that has moved pretty much overseas (except for mgt) will be made irrelevant. All those foreign scientists, engineers, accountants and other knowledge workers will wise up, start their own firms, and destroy the old stodgy firms.

    And this is *precisely* why patent and copyright law are increasingly featured in treaty negotiations between countries: because all the current executives know quite well that they only hold onto their jobs and paychecks as long as they can make the barriers to entry into their markets so high that they can retire before disaster strikes.

  17. Re:Rabbits chew wires regardless on Denver Airport Overrun by Car-Eating Rabbits · · Score: 0
    Eh, as I've said in our other thread, squirrels run on powerlines all the time, and hawks perch on them, and nobody gets hurt. All you have to do is just touch one line.

    When I was working at Advanced Energy, building high voltage power supplies, they had a nice little first-day lecture on safety. It was mostly visual so I'll have to describe it.

    Guy puts down a (not-plugged-in) 19kV power supply. He leans towards it with one hand, and says "fine." He leans towards it with both hands, and says "dead."

    The point being: you can touch as much voltage as you want, with one hand, and you'll be fine if you're not grounded in some other way, and if you have shoes on, or in the case of rabbits, hairy feet on carpet or wood or tile or linoleum, there's no path to ground. I have to wonder what sort of flooring you have in your house, anyway. The only current return paths I have in my whole house are the sink faucets, because I have copper plumbing, and ... I don't even know what else, since all the faceplates on my outlets are plastic. No, I take that back: the refrigerator has some exposed metal where the screw attaches the handle to the fridge body, and that's attached to earth ground, as any good double-insulated appliance will be. But the rest of the fridge is enamel-coated, and I know from checking that a decent enamel coating is good to at least 500 volts since we're designing consumer and commercial electronics in the 110-1000V range and we have to figure out what's a shock hazard on them.

    The rest of the house is all wood and gypsum, and they're *terrible* conductors.

  18. Re:Rabbits chew wires regardless on Denver Airport Overrun by Car-Eating Rabbits · · Score: 1
    Aw, man, you're going to start being civil. Okay, me too. Yeah, I'm an EE. I just used a Keithley 2600 to measure how much current flows when I stick one lead of the Keithley into a 110V receptacle and grab the other end with my hand. It's under 100 nanoamps, is the best I can tell you, but the Keithley probably isn't fast enough to catch the peak: within milliseconds it's equilibrated to zero current -- because zero voltage is flowing, so no current. At work we presume you can't feel a shock of less than 1 milliamp, so that'd be a million times less than a sensible shock. Since I work in an AC lab the floor is insulated (as are my shoes) so that's not surprising. Same thing with my rabbit: she was standing on a wooden floor, chewing through the line, and I presume she clipped the lines one at a time on the unpowered computer. Likewise my aunt's rabbit, again on a wooden floor, and the rabbit must have been lucky the compressor wasn't on. We also presume around here that we have roughly .5 to 1 megohm skin resistance. Lemme go measure myself... my Tektronix TX3 says thumb to thumb I'm 33 megohms, which is *really* high, but it's *really* dry.

    More generally, let's go over this from first principles.

    1. You can't get electrocuted or feel a shock unless there is current flowing. I can't prove this one but it's what Wikipedia says too.

    2. You can't have a current flow unless there is a potential difference. That's derived from Kirchhoff's mesh rule: the sum of the emf in a circuit is the sum of the potential drop in the circuit.

    3. You can't have a potential difference if there is only one wire, because there's nowhere to establish a difference: there isn't a circuit, by definition.

    4. As such, if you touch a single wire, there cannot be a current flow. (I'm neglecting the capacitance of a body, but I specifically noted that in the original post -- and that's what I measured with the Keithley, and it's negligible.)

    5. Cutting a single wire, regardless of its voltage, still does not provide a potential difference, as there is still no circuit.

    Let's review to my original post, just to make sure everything is covered.

    I said: "if the appliance isn't drawing power right then" -- which means no current is flowing, which means the entire line is at the same potential. So, no potential difference, so no way for there to be any current flow.

    Likewise, I said "as long as they only chew through one wire at a time" meaning the rabbit does not establish a potential difference between two lines: the rabbit is at a high potential with respect to ground but there isn't a circuit, so no current can flow.

    If you see any errors, I'd be interested to know about them.

  19. Re:Rabbits chew wires regardless on Denver Airport Overrun by Car-Eating Rabbits · · Score: 1

    That's not how electricity works. The hot wire is hot regardless, but if nothing is drawing power, you can cut the hot wire with impunity. You can grab it and lick it, and your body will run up to 110V but if there isn't a path to ground, there isn't any current flow. Here's a great video [youtube.com] about a guy who works on high voltage lines, who is crawling along an uninsulated million volt line, working on it, because there's no ground return path so he's fine.

    Uhhh. Okay, explain this to me. Since I'm both an electrician and an electrical engineer you can use the fanciest words you want. I have a wire. It is connected to 110 volts. It is not connected to anything else, which is why I specified that it is *unloaded*. I cut it in half. You're saying I'm going to get a shock? Where, exactly, are those electrons going, and why are they going there? What is the electromotive force that moves them? Because if you can tell me this, I'm going to use the power derived from this to drive a motor and call it a perpetual motion machine.

    Why don't you do an experiment -- walk up to your refrigerator outlet (which should have no GFCI to protect you), stick a screwdriver into the hot side and hold onto the metal shaft of the screwdriver and see what happens. It's likely that you'll feel a shock. If you're unlucky you could die.

    I've done this hundreds of times. I'm guessing you haven't. If there's nowhere for the electrons to go, you don't get shocked. Your body runs up to the line voltage, but you won't even notice that until you touch something that's grounded.

  20. Re:Rabbits chew wires regardless on Denver Airport Overrun by Car-Eating Rabbits · · Score: 5, Informative

    Black is Neutral. The white ones are the hot ones (or red in 3-wire). Green or non-insulated for Ground. Unless a dipshit who doesn't follow code wired your house.

    Nope. Please to not ever be working on house wiring in the US, kthxby.

  21. Re:Rabbits chew wires regardless on Denver Airport Overrun by Car-Eating Rabbits · · Score: 1

    but the black live line only had a few nicks in the insulation, so either the black vinyl doesn't taste good or squirrels are smarter than rabbits.

    I'd venture a guess that the second squirrel was a lot smarter than the first one. I'd bet that at least a couple of the nicks somewhere were all the way through, and somewhere out there there's a squirrel with some interesting facial marks that all the other squirrels have nicknamed "Sparky".

    I'm guessing it was a learning experience, but likely not fatal (there weren't any bones in the space.) I've *watched* a skunk short 220V from its mouth to the ground (long stinky story) and while it certainly didn't enjoy the experience, it was back the next night to try again, so it clearly didn't REALLY HATE the experience. If you have dry skin in a dry environment -- or particularly if you have furry paws, because hair is a terrible conductor -- it's hard to get enough current flow to kill yourself. Obviously that's not something you want to bet your life upon, but it's a nice benefit of a desert environment.

  22. Re:Rabbits chew wires regardless on Denver Airport Overrun by Car-Eating Rabbits · · Score: 1

    Thing is: if the appliance isn't drawing power right then, they can chew through with impunity, and even if it *is* drawing power, as long as they only chew through one wire at a time they'll just get a quick shock when they cut that wire. And given how dry a rabbit's mouth is, and that it's cutting through with its non-conductive teeth, they might not even notice.

    That's not how electricity works -- the hot wire is hot regardless of whether or not the appliance is drawing power.

    There are 3 wires in your refrigerator's power cord -- the ground wire (which the rabbit can suck on all day with no ill effect), the neutral wire, which is bonded to the ground wire at the distribution panel, so it should be at the same potential as the ground wire in a properly wired house, and the third wire is the hot wire. This is the one with the juice and the one that will cause a shock regardless of whether or not the appliance is running or not.

    That's not how electricity works. The hot wire is hot regardless, but if nothing is drawing power, you can cut the hot wire with impunity. You can grab it and lick it, and your body will run up to 110V but if there isn't a path to ground, there isn't any current flow. Here's a great video about a guy who works on high voltage lines, who is crawling along an uninsulated million volt line, working on it, because there's no ground return path so he's fine.

    If you don't believe me try it out yourself. You can cut a live wire with steel clippers as long as you only cut one wire at a time, and make sure your clippers don't touch any of the already-cut wires. There won't be a spark, because there's nowhere for the electrons to go aside from the capacitance of your body, and that's filled up by the flow of a couple hundred thousand electrons and you won't even notice it.

  23. Re:Rabbits chew wires regardless on Denver Airport Overrun by Car-Eating Rabbits · · Score: 4, Interesting

    If you let them chew on a cable or wire with a little but of current running through it, the rabbit usually stops chewing on wires. Our family had rabbits as pets for a while. One of them liked to chew wires. He chewed the lamp wires. After the shock, he stopped chewing on the wires. The rabbit was alive (he lived another 9 years). His whiskers were a bit singed and shorter. We did have to replace every lamp cord he got to.

    I've had a different experience. My aunt's rabbit chewed through her refrigerator power cable twice, and one of my rabbits, before she was no longer allowed to roam the house, chewed every cable off the back of a computer (all low-current save the power cable) on two occasions. Thing is: if the appliance isn't drawing power right then, they can chew through with impunity, and even if it *is* drawing power, as long as they only chew through one wire at a time they'll just get a quick shock when they cut that wire. And given how dry a rabbit's mouth is, and that it's cutting through with its non-conductive teeth, they might not even notice. This particular rabbit is smart enough to know the meaning of the word "no" and run over to me when I call her name (which my other rabbit is either too stupid or too uninterested in humans to do) so it's not like she's too dumb to learn about getting shocked. I think she just didn't care or didn't notice, or that she didn't get shocked, since she continued chewing on cords subsequently. Wrapping the cables in split looming that had been sprayed with cayenne pepper did discourage them.

    Even weirder, I had a squirrel nest in my workshop wall, and when I realized it and evicted them, I tore off the siding to see what damage they'd done. They'd stripped all the outer insulation off the romex in the walls, eaten all the paper that lines the bare ground wire, and eaten all the insulation off the white return line, but the black live line only had a few nicks in the insulation, so either the black vinyl doesn't taste good or squirrels are smarter than rabbits. Of course, they had to live in physical contact with the wires, while the rabbits were just chewing on them occasionally. But with that said, I'm betting squirrels are smarter than rabbits.

    As for the article itself, it's not just the DIA parking lot. My girlfriend's work car, a PT Cruiser, had most of the engine wiring eaten by rats while sitting overnight at her workplace in downtown Denver, while they completely ignored her (pre-2002) Subaru. It was startlingly expensive to get that car rewired, and apparently it was by no means just the spark plug wiring.

  24. Re:got spyware? on Careful What You Post, the FBI Has More of These · · Score: 1

    While I haven't been able to Google it, I recall one instance where a homeowner shot two police officers who were in his garage. The court ruled in favor of the homeowner.

    And while I'm at it, here's a whole list of people killed in no-knock search warrant raids, and you might notice that every time a homeowner has shot or shot at police, even those who didn't identify themselves and were easily mistaken for robbers, the homeowner has ended up either dead or with a conviction for murder and a life sentence in federal prison.

    As such, I'd be very interested in hearing about the case you cite, because it looks to me like it almost always goes the other way for the homeowner, even if it means the police have to plant marijuana in the house of an 88 year old woman to justify shooting her in her own home in a mistaken raid.

  25. Re:got spyware? on Careful What You Post, the FBI Has More of These · · Score: 1

    While I haven't been able to Google it, I recall one instance where a homeowner shot two police officers who were in his garage. The court ruled in favor of the homeowner.

    And in the opposite corner, serving a life sentence for murder, Cory Maye, who was sitting in his apartment when a bunch of police officers executing a no-knock search warrant on the wrong apartment broke into his house and he shot one. He was convicted of murder and sentenced to death, although the death penalty was later changed to life in prison.