Slashdot Mirror


User: Dirtside

Dirtside's activity in the archive.

Stories
0
Comments
2,909
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 2,909

  1. At least one bug in Crossover on CrossOver Plugin 1.0 Demo Version · · Score: 2

    I installed the demo on my Linux box (Mandrake 7.2 using IceWM as my window manager). Crossover added itself to my IceWM menu file, except instead of simply *adding* itself to my menu file, it copied the default menu file *over* my menu file and then added itself to *that*. Basically, all of my custom changes to the default menu file were lost when I installed Crossover.

    Aside from that, it works great (although Apple seems to have found a way to make the Quicktime 5 plugin never cache a downloaded movie on your local machine, which is annoying as fuck -- I want to view it whenever I want, without having to re-download it every time. Can you say "waste of bandwidth"?). I don't know if I'd use the Crossover plugin enough to justify paying for it, but we'll see.

  2. Re:Workaround.... on MSN Blocks Mozilla, Other Browsers [updated] · · Score: 1, Flamebait

    Nope. The First Amendment still says that "Congress shall make no law... abridging the freedom of speech". You may not like my statement, but you know what? It's protected speech under the first amendment. So is the next sentence: Fuck off, you coward.

  3. Re:Workaround.... on MSN Blocks Mozilla, Other Browsers [updated] · · Score: 2

    Running Mozilla 0.95beta (build ID 2001101202) on Mandrake 7.2. This workaround works fine, though you have to restart Mozilla for it to take effect (since it only reads user.js on startup, apparently).

    Not that I really NEED to go to MSN, but it's nice to give Microsoft the finger.

  4. Why do not all links have the brackets? on Slashdot Updates · · Score: 2
    Recently, /. was modified so that anytime someone posts a hyperlink, like this one to some FREE PORN!!!, it will show the ACTUAL URL in the link in brackets after the URL. (As you can probably see, that link does not have free porn, but rather, sadly, goes to Microsoft.)

    However, I've seen a number of sigs on /. (such as the one linked here http://slashdot.org/comments.pl?sid=22890&cid=2463 195) that do NOT show the brackets. Why not?

  5. Re:Reality: Love it or Hate it.... on Slashdot Updates · · Score: 2

    Hear, hear. Slashdot, for all its faults, is still a wonderful site that I check virtually every day. Kudos to the /. team for keeping it going all this time, and for (so far) not (really) selling out. Hooray !

  6. Re:Some contradiction here? on Slashdot Updates · · Score: 2

    I'd just like to point out that you claim that the people who say that, to paraphrase, "advocate retaining their privacy and personal information", are the *SAME* people who "want the Anonymous Cowards modded down". While I'll admit that both views are common enough on Slashdot, do you have any evidence that it really is the same subset of people who are demanding both things? How much overlap between the group of privacy advocates and the group of anti-ACs is there?

    I often see posts of this nature on Slashdot -- in an article about intellectual property in the Linux world, you'll see comments like, "You people are the same ones who said that IP is evil, and now you want Linux's IP protected!!" without ever proving that fact.

    I really wish people would stop claiming stuff like this. You're not trolling, you're just making an assumption without any data to back it up. (Not that I'm saying no such data exists; merely that you didn't collect it. For all we know, you're right -- it IS the same people, but no one's bothered to collate the data. You might suggest that *I* should do it, but then again, YOU'RE the one who made the positive assertion that the two groups coincide...)

  7. Hey, FBI: FUCK YOU. on FBI Wants to Tap The Net · · Score: 2, Interesting

    Why the fuck does the FBI think this is necessary? What in the name of Eris are they trying to accomplish with this? Who are the assholes at the FBI, the individual men, who think this is a good idea?

    When you think about the FBI wanting to tap the entire internet, think about it this way: Would you be okay with the FBI wiretapping EVERY PHONE IN THE COUNTRY without getting a warrant for each one first? Because that's essentially what they are doing.

    And they want to CENTRALIZE DATA as well! Yep, nevermind the whole idea of a distributed network (not that the backbone providers give a shit about that anyway), let's just put all the data on one server so that the FBI can easily listen in to every conversation in the country!

    What a bunch of fucking bullshit. </rant>

  8. Re:Quote of the Day (scary!) on Microsoft: The Gatekeeper of the Internet · · Score: 2

    I always preferred "My First Windows" or "Windows for Dummies" (though the latter is redundant).

  9. What's next? on Citizen/IBM To Make A Linux Watch · · Score: 3, Funny

    Geez, what's next? The SaniPad, a Linux-powered tampon/personal organizer that monitors your menstrual blood flow and tells you when it's time for your next pill?

  10. Re:It's pronounced... on IP Theft in the Linux Kernel · · Score: 4, Funny

    Wait a minute! Are you saying that these header files were written by Sauron? Because that's what came out of my mouth when I pronounced it the way you describe. One license to rule them all, eh?

  11. Please read the paper before posting. It's short. on Microsoft's Vision For Future Operating Systems · · Score: 4, Insightful

    I really do hope that people read the entire paper before posting their thoughts about it. I hate Microsoft with a passion -- my first thought upon hearing about the WTC attack was, "Those poor people! I sure hope Bill Gates was in there." -- but the points they've raised here are valid ones and deserve analysis. The topic is an important one and I hope people will not malign it because of the source, namely, Microsoft.

    That said, I'll comment on the paper itself. They have a point, somewhat understated, which is basically, "Yeah, this may be crazy, but it's worth looking into, isn't it?" One obvious response is that it sure seems to be What Microsoft Wants in terms of a homogenized global system that Microsoft controls. Though such a thing is never specifically said, it is called the "Millennium" system, and the ME in Windows ME stands for "Millennium Edition" (side note, it just occurred to me that "Windows ME" could be said with the same tone, inflection, and connotation as "Fuck me!" as an expression of dismay -- "Go Windows yourself!").

    Well, who knows, but their idea of a transparent large-scale network that is self-managing as they've described is an interesting one, and there are some things that would be appropriate in such a system. That said, here's several reasons why I think such a system will not happen in the near future:

    1. Too much resistance. This *is* a crazy idea, and even if it could be made to work, most people are used to the idea of "my" computer, "my" data, and everything happening physically *here*, inside this little box under my desk. This will take a long time to get over. Perhaps a gentle transition would help, with more and more things gradually shifting to the Big Network.

    2. Games. Games require zero latency - nobody enjoys playing Quake with network lag, let alone system lag. All computations for games and other time-sensitive applications would have to be done pretty much within the physical computer you are using, otherwise the latencies are too great and the game would be unplayable and chunky. Imagine if your 50ms ping time also figured into the video processing!

    3. Security. It seems silly to assume people would *want* to walk up to a random machine somewhere and have all their documents streamed to it over the Big Network. For one thing, who knows whether the terminal is secure, or if it's got secret programs installed in it to capture your keystrokes? Using a publicly accessible terminal to get to your private data is a bad idea. Also, critical machines (computers that run public infrastructure, banking systems, military systems, etc.) should obviously not be any part of this kind of transparent system, for the obvious security reasons.

    4. Where we work. Telecommuting is, for all the cheerleading, not very common at all. When people do regular business-like work (i.e. office workers writing reports, having meetings, doing whatever) they will want to have everything in the same place, and do it in big chunks at a time. Face-to-face communication with people is also very important to the way business is usually done, though this may change as people get more used to the idea of telecommunicating for business. Being able to "walk up to a computer anywhere" and do work is pointless, because the vast majority of people are not going to WANT to be walking through the mall, window shopping, and decide they need to do some work, so go sit down at a public terminal and start doing work. (Nevermind the security issues, mentioned above.)

    5. Monoculture. If we think a Windows monoculture is bad now (and we do -- at least, I do), imagine what happens when every computer in the world is now running this system! On the other hand, if such a system was designed so that anyone could implement their own version of it, then you avoid some monoculture issues, but because you have to have interoperability between the systems, you essentially end up with what we have now -- the Internet, made of multiple differing systems that can still communicate using a common protocol, except the protocol would extend beyond data transfer and into things like distributed processing.

    If you've managed to read this far, congratulations! I can recommend a decent novel that incidentally covers this topic (it is not the main focus of the plot, but does figure into it): Permutation City, by Greg Egan. A very good novel with lots of interesting ideas, but it does feature a worldwide network in which you can basically bid on processing power to draw from the global network, so your programs might be running anywhere in the world, but are running securely so that a computer doesn't really know what it's doing, it just executes commands. It doesn't go into much technical detail (like how they manage to have computers execute encrypted code without decrypting it), but it's relevant nonetheless.

  12. Re:We lose liberty, we lose America on Stallman: Thousands Dead, Millions Deprived of Liberties · · Score: 2

    A much better solution is that if you lose, you have to pay your opponent's court costs only up to some percentage of your OWN court costs. The problem with "loser pays winner's costs" solution is that if some little guy gets injured by a huge company's product, and takes them to court and loses because he can only afford to spend $5,000 on his case but the company can spend $5 million (thus ensuring the case is a complicated, obfuscated mess), then he's $5 million in the hole and is essentialyl fucked. As a result, no little guys will ever sue a big guy, and big corporations will get to run roughshod over individuals even more than they do now.

    If you only have to pay for the winner's costs up to the amount you spent, it's much more fair because it helps ensure that little guys don't get abused by big guys. This is how they do it in, I believe, Finland.

  13. Re:Cowards on More News And Links On Yesterday's Terrorist Attack · · Score: 2

    Re the "status quo"... there was a mini-headline on The Onion a few months ago:

    "Mideast Conflict Redefined As Mideast Culture"

  14. Pedantic Man: The plural of virus is NOT virii on Virus Cost Estimate For 2001 Tops $10 Billion · · Score: 2
    I repeat, the plural of virus is NOT virii.

    This page explains in great detail why not:

    http://language.perl.com/misc/virus.html

    Additional support:

    http://www.dictionary.com/cgi-bin/dict.pl?term=vir us

    A search on Google for "viruses" turns up 1,480,000 hits.
    A search on Google for "virii" turns up 38,200 hits.

    Any technical literature written by professionals will NEVER EVER USE THE WORD VIRII! IT'S NOT A REAL WORD! The plural of "virus" is "viruses"!

    http://www.mcafee.com - on the FRONT PAGE the word "viruses" is printed several times. "Virii" is not.

    http://www.centralcommand.com - same deal.

    I'm going to keep posting this on every virus story that comes up until everyone gets the damn hint!

  15. Re:[Flash Quiz!] Ladies and Gentlemen... on Rent A Downloadable Movie · · Score: 2

    The problem is that the things the DMCA causes people to stop doing are the things that they can be easily caught for. It's unlikely that anyone is going to publish a properly-researched scholarly paper that violates the DMCA, because in order to do so without being sued into oblivion, they'd have to release it anonymously, and that (historically) just does not happen. (Though maybe it will start happening due to the DMCA...)

    The DMCA, however, also proscribes people from *writing software that circumvents technological protection measures*, but the DMCA does not actually stop anyone from doing this, because it can be done anonymously and safely (assuming you are not an idiot).

    I'm generally in agreement that the mere existence of a law (along with threat of punishment) will never completely prohibit any kind of behavior. And we do have to weigh the costs to society a law causes, against the benefits to society it provides. I think that this ratio, with respect to the DMCA, is grossly overbalanced toward costs (and I don't just mean straight dollar costs, I mean costs in freedom to do these specific things, costs in indirect changes due to media conglomerates gaining more power and money because of the law, etc.).

  16. No, we are not doomed to gray goo on The Law And Nanotechnology · · Score: 2
    Read this article (long and technically complex, but fairly easy to read nonetheless):

    http://www.foresight.org/NanoRev/Ecophagy.html

    ...to find out why the gray goo problem is not an insurmountable one, or (in my opinion) nearly as threatening as global thermonuclear war. I used to worry about gray goo (accidental nanobots-eat-world scenario) and black goo (deliberately engineered nanobots-eat-world scenario), but the above article largely put my worries to rest. Here's the abstract:

    The maximum rate of global ecophagy by biovorous self-replicating nanorobots is fundamentally restricted by the replicative strategy employed; by the maximum dispersal velocity of mobile replicators; by operational energy and chemical element requirements; by the homeostatic resistance of biological ecologies to ecophagy; by ecophagic thermal pollution limits (ETPL); and most importantly by our determination and readiness to stop them. Assuming current and foreseeable energy-dissipative designs requiring ~100 MJ/kg for chemical transformations (most likely for biovorous systems), ecophagy that proceeds slowly enough to add ~4C to global warming (near the current threshold for immediate climatological detection) will require ~20 months to run to completion; faster ecophagic devices run hotter, allowing quicker detection by policing authorities. All ecophagic scenarios examined appear to permit early detection by vigilant monitoring, thus enabling rapid deployment of effective defensive instrumentalities.
  17. Re:"Viruses" can be funny... on Death To Virus Writers · · Score: 2

    You're incorrect. The plural of virus is not "viri", even though that would be the correct pluralization if "virus" used Latin pluralization. But it does not. Every dictionary I've looked in that has a plural listed for "virus", listed "viruses" as that plural. Not one listed "virii".

    This page explains, again, all about the plural of "virus", telling us (among other things) that in Latin, "viri" was NOT a proper plural of "virus":

    http://language.perl.com/misc/virus.html

    So, next time you feel like pulling something out of your ass, how about making sure it's shit and not linguistics?

  18. The best of both worlds on IBM Research Enables Flat-Panel CRTs · · Score: 3

    This is the kind of thing I think we've all been waiting for: a monitor technology that combines the form factor and weight-savings of an LCD (thin = light = easier to carry around = less desk space taken up) with (hopefully, if their tech is any good) the quality of a CRT monitor. The biggest problem with LCDs is that of fixed resolutions. An LCD screen has a fixed number of pixels, so adjusting the screen resolution is difficult at best and hideously ugly at worst (you end up with big unused areas on the screen, or it does a kind of interpolation to stretch a 640x480 image to 1024x768).

    But a CRT can adjust to almost any resolution within a huge range, 320x200 all the way up to, I dunno, a lot :) (2048x1280, anyone?) If this tech is for real, and useful, then we (namely, gamers) may have what we've always wanted: a nice, big, flat, lightweight, thin, good-looking monitor with fast refresh, vibrant colors, and adjustable resolutions!

    Sorry, this is more or less just a bit of happy-fun-cheering, no real useful content here, move along, move along kind of post.

  19. Re:"Viruses" can be funny... on Death To Virus Writers · · Score: 2
    I think virii (I insist that's the plural...)

    Why do you insist that? The plural of "virus" is, and has always been, "viruses". Check any (respectable :)) dictionary or pathology papers that discuss viruses. People think that the plural of "virus" is "virii" only because some clever 12-year old asshole fifteen years ago went, "Hey, radius becomes radii, therefore virus becomes virii!"

    Neglecting, of course, the fact that English is a fucked-up language and we do not always use Latin pluralization for words. Even IF the plural of "virus" was Latinized, it would be "viri", as follows:

    Singular: radi-US
    Plural: radi-I, hence radii

    Singular: vir-US
    plural: vir-I, hence viri

    The "us" becomes an "i", not "ii". However this is irrelevant because the plural of "virus" is "viruses". Claiming that any word that ends in "us" pluralizes to "i" (or "ii" for those who missed my previous point) is disingenuous. "Bus" does not become "bi" or "bii" (it's "buses"); the plurals of "plus" and "minus" are not "pli" or "plii" or "mini" or "minii" (they're "pluses" and "minuses").

    I'm sick to death of people perpetuating this stupid fallacy of language. And don't give me that "common usage" bullshit; the only people who say "virii" are undereducated computer neophytes. </RANT>

  20. Re:Movies suck now. on Fleeing Jurassic Park III · · Score: 2

    It's the Nostalgia Effect.

    1. SELECTIVE MEMORY. People tend to remember the good stuff and forget the bad stuff. If you take any particular year, say, 1972, there were just as many pieces of shit that came out in 1972 as there were pieces of shit that came out this year, or five years ago, or fifty. But it's been 29 years since 1972, and the bad movies have mostly vanished into history. What are people going to bother to remember, "The Godfather" or "Invincible Super Chan"?

    2. GETTING OLD AND CRUSTY. It's an almost invariable truth that as people get older, they become less flexible, less open to new ideas, and less interested in variety. Some people manage to avoid this entirely, but it's rare -- virtually everyone suffers from this to one degree or another.

    There are other, smaller factors, too: As time goes on, there are more and more people in the world, so there are a greater number of people making movies, and thus more movies are released; even if the proportion of crap movies stays constant, the total number of them increase. And other things.

    This happens with all media, and virtually all other things. Music, books, video games, movies...

  21. Re:Just a reminder on 3D MAX To Laser Light · · Score: 2

    No, no:

    It's all fun and games until someone loses an eye.

    Then, it's just a game: Find the Eye.

  22. Re:'Genes' vs. 'Instructions' on Researchers Revamp Human Gene Count Estimates · · Score: 2

    No, no, the introns are *source comments*:

    ACGTCATCTGAGCGTCGCGGCAGTAGTCTGCGTATGCTGAGTCGAGC

    /* Pinky finger - this should be the right size to fit comfortably into the hole in a CD */

    GTCGTGTCAGTTGCATGCGTAGTCATCTGACGTAGTCTGACTGATGCT GT AGCTAGTCAGTCGTACGTAGTCG

    /* Appendix - I don't remember what this is for, but let's leave it in anyway */

    And so on.

  23. Re:Jokers complaining about 'cross country' - read on Cross Country Solar Race · · Score: 2

    Um, no, ya see, YOU said that "cross country" simply means "moving across any part of a country", WHICH IS NOT WHAT IT MEANS. I pointed out that the term "cross country" is not a simple combination of the words "cross" and "country" and has its own separate meaning -- which is to move across part of a country WITHOUT USING ROADS OR TRACKS! That is a DIFFERENT MEANING. Your "definition" implies that "cross country" means simply moving across any part of a country, regardless of the method or whether you use roads or tracks. I pointed out that you were wrong. How does me pointing out that you're wrong, prove that you're right? Have you been taking logic classes at the University of Maximegalon or something?

  24. Re:Jokers complaining about 'cross country' - read on Cross Country Solar Race · · Score: 2

    Hi, ass, "cross country" is a completely separate term which does NOT mean "to move across some part of a country" just because you feel like redefining it. Convenient that you didn't bother to look up "cross country":

    cross-country (krôs kuntre) Abbr. XC or X-C
    adj.

    1. Moving or directed across open country rather than following tracks, roads, or runs: a cross-country race.

    So why don't YOU give it a rest?

  25. Irrefutable point? on Microsoft "Bans" Use Of GPL Code · · Score: 1

    Modern comfortable western human life costs money.

    Notice that no lifeform besides humans uses currency. Nor did humans (or our ancestors) more than several thousand years ago. Consider the point refuted.