Slashdot Mirror


So You Want to Be A Marine Biologist

daviddlewis writes: "Some humorous thoughts from a marine biologist on why you should/shouldn't be one. The "shoulds" apply to all geek professions."

149 comments

  1. ouch by FigBugDeux · · Score: 0

    slashdotted already. mirrors?

    1. Re:ouch by FigBugDeux · · Score: 1

      ok, maybe not, its loading fine now. i just must be too dumb to use a web browser.

    2. Re:ouch by Pathetic+Coward · · Score: 1

      It's down again (8:40 AM 12/30)

  2. #1 reason to be a marine biologist by Anonymous Coward · · Score: 3, Funny

    To pick up chicks. When was the last time you saw a male MB?? So if you want to "taste something fishy", then definantly become a marine biologist.

    1. Re:#1 reason to be a marine biologist by burning_plastic · · Score: 1

      I see far too many male marine biolgists at work every day... although there are definitely a few incredible female ones...

    2. Re:#1 reason to be a marine biologist by Anonymous Coward · · Score: 0

      Yup, I'm a marine biologist. My wife and I have been together for 13 years now (I'm 38) and she is the most beautiful person I know of.

      I fell in love with her when I discovered her staring in a pair of Wild M5 at some four-horn sculpins!

      That she resembles Greta Garbo doesn't hurt either. We have two kids together, so don't get too excited.

  3. Re:wow, 4 posts and the site is already down by BrianGa · · Score: 0

    Geese, it must have been about 1 minute...

  4. Google Cache by Zach+Garner · · Score: 4, Informative

    Check google's cache here

  5. My next door neighbor's son ... by TheViffer · · Score: 1, Funny

    is a marine biologist .... in Nebraska.

    He currently works as a gardener at a local nursery.

    On the up side, I get great prices on trees for my yard.

    --
    -- Knowing too much can get you killed, but knowing who knows too much can make you rich.
  6. Another reason... by oo7tushar · · Score: 2, Interesting

    to be a marine biologist:
    The CTO at a company where I worked (and still do once in a while) was a marine biologist. Like the article said: you get to do what you want. You get the expertise and learn more about the creatures living in the ocean, but if you're bright, you can be the CTO for a successful business.

  7. Site's down already by GnulixRulz · · Score: 1, Informative

    The site is down a few minutes after being posted here. Could be because the site is run on a bitty box running AppleShare.
    Anybody have more info on this web server? Is this one shipped by default with OS X?

    1. Re:Site's down already by Anonymous Coward · · Score: 0
      AppleShare is the default on older Mac servers... It runs on OS9 and lower.


      MacOS X runs Apache, generally.

    2. Re:Site's down already by FigBugDeux · · Score: 0, Offtopic

      maybe he closed the lid on his iBook and it went to sleep.

    3. Re:Site's down already by Anonymous Coward · · Score: 0

      A little webserver called "Apache" is the one shipped with OS X. I've never heard of it, have you?

  8. found out why by discogravy · · Score: 4, Funny

    apparently you shouldn't become a biologist because the first thing you post will get slashdotted beyond belief.

  9. Back up by BrianGa · · Score: 0

    The site has returned (for me, at least...)

  10. Complete text by mduell · · Score: 5, Informative

    Funny that everyone says its slashdotted... I can still get to it (then again, I live about 10 miles from the server...).

    So you want to be a marine biologist? Well sonny, or sonnette, as the case may be, why don't you just sit down and let a real marine biologist give you some damn good advice. And wipe that smirk off your face, sit up straight and for goodness sakes stop fidgeting! You'd think you had lice the way you are carrying on. You do? Oh well, never mind.

    First of all there are three really, really bad reasons to want to be a marine biologist. If you have even an inkling that these are yours, please run away as fast as possible, 'cause neither you nor we will be happy.

    Three Really, Really Bad Reasons to Want to Be a Marine Biologist

    Reason Number One: "I want to be a marine biologist so that I can talk to dolphins."

    Believing this is simply the Kiss of Death. This is the verbal equivalent of reaching down your throat, pulling out your own intestines, wrapping them around your neck and choking yourself. When we hear this our impulse is to thwack you a good one on your keester with the frozen haddock we keep within arm's reach just for this occasion.

    And why is that? It is because, and please listen carefully, while you may want to talk to dolphins, dolphins do not want to talk to you. That's right. Mostly, dolphins want to eat fishes and have sex with other dolphins. And that pretty much cuts you out of the loop, doesn't it? Oh, I know that there are the occasional dolphins that hang around beaches, swim with humans and seem to be chummy, but these are the exceptions. You don't judge the whole human race by the people who attend monster car rallies, do you?

    Just be honest with yourself. If you want to talk to dolphins you don't want to be a biologist. What you really want to do is explore your past lives, get in touch with the Cosmic Oneness and conduct similar-minded individuals on tours to Central America looking for evidence that We Are Not Alone. Our experience is that people who feel this way last about 6.5 minutes in any biology program.

    Reason Number Two: "I want to be a marine biologist because I really like Jacques Cousteau."

    That's nice. We really like Jacques Cousteau, too. But, drinking thousands of gallons of red wine while scuba diving around the world does not make you a marine biologist. It makes you a wonderful and effective spokesperson for the sea, and gives you a liver with the consistency of a chocolate necco wafer, but it does not make you a marine biologist.

    Reason Number Three: "I want to be a marine biologist because I want to make big bucks."

    Okay, here's the bottom line. By Federal law, marine biologists have to take a vow of poverty and chastity. Poverty, because you are not going to make squat-j-doodly in this job. Just how squat is the doodly we are talking about? Well, five years after finishing my PhD I was making slightly less than a beginning manager at McDonalds. Ooh, a 36 year old guy with 13 years of college and 5 years of post-doctoral experience making just about as much as a semi-literate 19 year old with pimples the size of Bolivia, who can speak perhaps 3 words at a time before the term "you know" enters the conversation.

    And chastity because, well, who's going to date a marine biologist? The smell alone tends to dissuade a large proportion of the opposite sex.

    Two Really, Really Good Reasons to Want to Be a Marine Biologist

    Reason Number One: "You can dress and act almost any way you want."

    This is true. Marine biologists are almost entirely free of any of those silly restrictions that blight the professional landscape of our fellow proletarians. This is because no one really cares about what we do or what we say. You want to come to work dressed in scabrous khaki shorts and a torn black Sandman shirt? Fine. You want to grow a scruffy beard, get a tattoo of a gooseneck barnacle on your arm or burp at inopportune moments? No problem, just do good work.

    Reason Number Two: "If you like it, just do it."

    Look, the reality is that you only go around once in life and if, by chance, you do come back, knowing how you have behaved in this life, you will undoubtedly come back as a slime mold. And most slime molds cannot be marine biologists. So just go out there and do what you enjoy. Marine biology is a wonderful profession. You want to find cancer cures by grinding up sponges? How about figuring out why hammerhead sharks always come back to the same seamount? Or where is the missing carbon dioxide that industries are producing; could the ocean be soaking it up? All neat projects. But pay attention here. None of this involves drinking copious quantities of fermented grape juice, while intoning "The ocean, she is strange and wondrous, filled with animals that disturb even a Frenchman."

    The ocean is an exciting, never-dull place that is perfect for piddling away your existence. And just think, you actually get paid to think cool thoughts and do cool things.

    And so what if you will never have sex again?

    1. Re:Complete text by Pope · · Score: 5, Funny
      The smell alone tends to dissuade a large proportion of the opposite sex.

      That doesn't only apply to marine biologists you know :)

      *ducks* and runs out of the room...

      --
      It doesn't mean much now, it's built for the future.
    2. Re:Complete text by Anonymous Coward · · Score: 1, Funny

      And why is that? It is because, and please listen carefully, while you may want to talk to dolphins, dolphins do not want to talk to you. That's right. Mostly, dolphins want to eat fishes and have sex with other dolphins. And that pretty much cuts you out of the loop, doesn't it?

      You obviously haven't been here.

    3. Re:Complete text by ICodeThereforeIAm · · Score: 1

      I will take into consideration you wrote this at 2am but it is still wrong, so wrong.

    4. Re:Complete text by jd · · Score: 2
      And why is that? It is because, and please listen carefully, while you may want to talk to dolphins, dolphins do not want to talk to you. That's right. Mostly, dolphins want to eat fishes and have sex with other dolphins. And that pretty much cuts you out of the loop, doesn't it? Oh, I know that there are the occasional dolphins that hang around beaches, swim with humans and seem to be chummy, but these are the exceptions. You don't judge the whole human race by the people who attend monster car rallies, do you?


      *BEEP* Flawed Assumption Warning! Flawed Assumption Warning! *BEEP*


      The problem here is that the author is making exactly the same assumption that the pro-talkers do, albeit in the exact opposite direction.


      Let's say you are in the middle of a crowded shopping center. Most people want to buy stuff, then get on their way, right? Right. But they're still capable of speech (well, most... ok, some of them, anyway), and are also capable of hearing (though this skill is rarely ever employed by humans).


      From this, should we conclude that talking to people is also a complete waste of time? Hmmmm. Oh dear. Maybe that was a bad example, given that the answer is still "yes".


      Ok, forget all that. Let's start from the basics. "Dolphins like to eat fishes". Correct. And how do they eat said fishes? Well, sometimes by simply catching them. But also sometimes by teamwork. There are two known team strategies that dolphins employ on a regular basis - corral feeding (where they surround the fishes, and take turns swimming through the fishball they create) and strand feeding (only found in South Carolina, and areas with significant sand bars), where dolphins launch a full-frontal assault on the fishes, forcing them to beach. The dolphins then beach themselves, roll back to the water, picking up fish from the improvised buffet table.


      What's all this got to do with talking? Well, you don't suppose group projects might require a bit of, well, discussion? It's all very fine and dandy to line up, and charge at the fish, once the attack signal's been given, but who gives it? These can involve many pods, so just saying "the leader" isn't good enough.


      From this, we can conclude that dolphin communication is essential to dolphin life. (Actually, it turns out that dolphin communication rates are inversely proportional to visibility, which again follows perfectly from the marine biologist's argument, whilst totally splorfiticating the conclusion.)


      So far, so good, so what? (Aside: Would a Megadeth t-short be politically incorrect, in an environmental science?) Well, this means that it becomes almost irrelevent whether dolphins want to talk specifically with you or not. They talk. All this fancy bs with sign-language is just that. BS. It reminds me of all those mountains in the Discworld series named "Your finger, you fool", or "Who is this person who does not know what a mountain is?"


      When a child grows up, it first starts by listening, copying, and associating. It doesn't start by drawing charts and asking the parent which box it is referring to. From a linguistic perspective, if dolphin language is to ever be understood, it must be understood from the mind of a child. Listening, copying and associating.

      --
      It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
  11. Hrm by interiot · · Score: 4, Funny
    The pickings are really slim today, huh?

    Though... this is probably my one chance to get an article submitted.

  12. How about living in exotic locations? by thogard · · Score: 3, Interesting

    You know places like Fiji, Floridia Keys, Tahiti, Red Sea...
    I'm still looking for a nice tech job where I can dive ever other day and will pay for toys.

    Most of the Marine Biologist I've meet seem to have fun like Paddy who gives daily lectures to scuba divers at Reef Teach. If your going diving off the Great Barrier Reef, you should see his show first.

    If anyone cares, I've got a list of places I've been diving here. BTW, I learned to dive in Missouri...

    1. Re:How about living in exotic locations? by sinserve · · Score: 1

      > BTW, I learned to dive in Missouri...

      Last time they had a Mizohran at the beach, it was
      an environmental crisis.

      You guys are responsible for the floating "Mr. Hankey"s, and whales blown up by dynamite.

  13. Huh?? by theoddicy · · Score: 5, Funny

    And so what if you will never have sex again?

    What's he mean, "again"?

    1. Re:Huh?? by Black+Parrot · · Score: 1


      > > "And so what if you will never have sex again?"

      > What's he mean, "again"?

      I suppose that means that The Marine Biologists' Jargon File lacks an entry for "get laid" too.

      --
      Sheesh, evil *and* a jerk. -- Jade
    2. Re:Huh?? by Anonymous Coward · · Score: 0

      Better that you don't know what you're missing.

    3. Re:Huh?? by kwalker · · Score: 1

      He means he went to school for over ten years and felt up a girl once.

      --
      Improvise, adapt, and overcome.
    4. Re:Huh?? by shoshan · · Score: 1

      I can't believe I'm reading comments about my DAD'S SEX LIFE on slashdot.

  14. beverages by The+FooMiester · · Score: 1

    None of this involves drinking copious quantities of fermented grape juice

    and being a geek doesn't mean you have to love coffee, kernel hacker, guiness? What BLASPHEMY!

    Although I am a fan of the stout

    and so what if you never have sex again

    damnit, I was hoping being a geek would get me laid.

    --
    The previous has been a secret message to my comrades.
  15. Nothing Wrong with Marine Biology by calandryll · · Score: 1

    Unfortunately this applies to me. Damn my career choices but hey animals suck. Give me algae any day. At school though there are a lot of good looking women trying to enter the field, so i'd have to disagree with the one about not getting any. Of course going to one of the only schools that has MB as a major is also helpful. University of West Florida or as i've been told the OTHER prestigous school in Florida.

  16. I remember... by Anonymous Coward · · Score: 0

    When I was in grade school, that was the number one profession amongst the female demographic. So many dreamt of being marine biologists simply because they wanted to play with dolphins. Good thing someone finally gave them a dose of reality, because the teachers were never going to.

  17. Dolphins and marine biologists by efgbr · · Score: 1

    Mostly, dolphins want to eat fishes and have sex

    And chastity because, well, who's going to date a marine biologist? The smell alone tends to dissuade a large proportion of the opposite sex.

    But it certainly attracts the dolphins.

  18. Confusion by The+Man · · Score: 1, Redundant
    And so what if you will never have sex again?

    Again?

  19. Meaningless topic by jpmkm · · Score: 1

    Ya know, sometime I'm going to make a webpage on a meaningless topic and submit it to slashdot. I think I'll talk about how a little hot sauce on the eyelids really picks up the chicks, because I know that will be of interest to the slashdot crowd.

  20. Biology by stipe42 · · Score: 1, Troll

    My fiancee is a neurobiologist. Not a marine biologist but close enough for government work. She just dumped me and I have officially turned to vodka for support. I would have first checked out the article but it has apparently been slashdotted. Therefore there is no solution but the alkihall solution. Cheers all, may your luck be better than mine,
    stipe42

    1. Re:Biology by BrianGa · · Score: 0

      If you want the text, it was pasted above...twice.

    2. Re:Biology by stipe42 · · Score: 1
      Wow. I have been with her four years, so this blunt jab actually shifted my perception a bit. The weird thing about losing someone after that long is that you still think of yourself as part of a 'we' even though you are now entirely an 'I'. I feel strangely free yet the freedom is strangely painful.

      stipe42
      www.pcwatch.com

  21. Talking to dolphins? Hah! by Robber+Baron · · Score: 3, Funny

    Most geeks haven't even mastered talking to humans!

    --

    You're using her as bait, Master!

  22. AppleShare IP!? by Anonymous Coward · · Score: 0

    % telnet www.id.ucsb.edu 80

    Trying 128.111.138.11...
    Connected to www.id.ucsb.edu.
    Escape character is '^]'.
    GET / HTTP/1.1
    Host: www.id.ucsb.edu

    HTTP/1.1 500 Internal Server Error
    Mime-Version: 1.0
    Connection: Close
    Date: Sun, 30 Dec 2001 06:32:00 GMT
    Server: AppleShareIP/6.3.0
    Content-type: text/html

    Connection closed by foreign host.curred.</P>BR>IGHT=550> version 3.0-->

    1. Re:AppleShare IP!? by N8F8 · · Score: 1
      --
      "God fights on the side with the best artillery." - Napoleon, Marshal of France - speaking truth to power
  23. Some Basic Marine Biology Terminology by Freneticus · · Score: 1

    Piddly Website == Lenny the Hamster,

    Slashdot == Pack of Roving Pirahna,

    Submitting Piddly Website To Slashdot == *burp*

  24. You do not want to be a zoologist, however. by Alien54 · · Score: 4, Funny
    Just in case you missed this story on another site.
    England's Student Magazine has a article each week telling students about different jobs, so that readers can get an idea about what different jobs are like. The most recently featured job has to be in the running for the Worst Job Ever award. Zoo worker Mohd. Binatang bin Goncang of Singagore certainly wins the "Worst Job in Singapore", for his job as a Zoo Sperm Bank worker. The Wildlife Reserves Singapore (WRS), which runs the Singapore Zoo, has set up a bank of sperm and animal tissue in order to help preserve endangered species. And someone has to collect the samples. Daily.
    Yes this is tasteless.

    Yes, it is educational.

    Because there are some jobs in some fields that you really do not want to have.

    --
    "It is a greater offense to steal men's labor, than their clothes"
    1. Re:You do not want to be a zoologist, however. by Karellen · · Score: 2

      "It's important to have a job that makes a difference boys. That's why I manually masturbate caged animals for artificial insemination." - Clerks.

      --
      Why doesn't the gene pool have a life guard?
    2. Re:You do not want to be a zoologist, however. by ICodeThereforeIAm · · Score: 1

      Dad used to talk about work at the dinner table. I can't imagine what it would be like being this Singapore Zoologist's son.

      Son: How was work today dad?
      Dad: Rhino day.
      Son: Oh, pass the potatoes.

    3. Re:You do not want to be a zoologist, however. by Anonymous Coward · · Score: 0

      My zoologist wife giggled at that one.
      The she said "sounds about right".

      Amused Chemist.

    4. Re:You do not want to be a zoologist, however. by jmichaelg · · Score: 3, Funny
      Yes, this is tasteless.


      That's not what my girlfriend says.

    5. Re:You do not want to be a zoologist, however. by ngaihua · · Score: 1

      Ironically..

      Mohd. "Binatang bin Goncang" literally translates to "Animal Shaker" (masturbate) in Malay. So I doubt if that is a real name (or story for that matter).

    6. Re:You do not want to be a zoologist, however. by Deslack · · Score: 0
      Somehow, I don't think i'd believe this zoo sperm bank crap. Look at the name:
      Mohd. Binatang Bin Goncang
      Mohd. is a common Malay name.
      Binatang and Goncang are not.

      Binatang, in the Malay dialect means Animal, and Goncang means "to shake". Often people use Goncang to illustrate masturbation.

      My point is - it's all made up.

      --
      .sigs are useless; it doesn't protect you from imposters.
  25. line from the list by coaxial · · Score: 5, Funny

    You don't judge the whole human race by the people who attend monster car rallies, do you?

    Well actually I do. :)

  26. Dolphin Sex - On topic??? by TheAJofOZ · · Score: 5, Funny
    Mostly, dolphins want to eat fishes and have sex with other dolphins

    For once that Dolphin sex link the trolls keep posting is actually on-topic.....

  27. Re:WHY DO YOU REJECT MY ARTICLES? by Anonymous Coward · · Score: 1, Insightful

    Ok... now I understand why taco doesn't want an area for rejected submissions and why he doesn't want to bother with telling idiots why they were rejected... People really do suck and apparently ruin it for the rest of us.

  28. Just Say You're One by nexex · · Score: 2, Offtopic

    Why spend years in school to become one. Look at George Costanza from Seinfeld, he is a Marince Biologist, Archictect, Importer-Exporter, and the best damn assistant-to-the traveling secretary the Yankees have ever seen! Just do what he did -- pretend and let other people do all the work. ;)

    --
    Winter 2010: With Glowing Hearts
    1. Re:Just Say You're One by sharkey · · Score: 1, Troll

      Don't forget, George singlehandedly handles all finances, advertising, etc. for the Human Fund.

      --

      --
      "Outlook not so good." That magic 8-ball knows everything! I'll ask about Exchange Server next.
    2. Re:Just Say You're One by 3waygeek · · Score: 1

      And still finds time to be an integral member of the board of the Susan Ross Foundation.

  29. Hell no! by Lan-Z · · Score: 1

    I'm not joining the Marines, not at a time like this. *smirk*

  30. So you want to be a software engineer? by MAXOMENOS · · Score: 5, Funny
    (With apologies to the Love Lab people.)

    Every once in a while, I hear from folks who want to become a software engineer. Good for you, I say, and why is that? The following is a list of good and bad reasons that I've heard.

    I want to be an insanely rich billionaire like Bill Gates. And who wouldn't? The thing is, Bill Gates did not become wealthy through software engineering. Neither did Steve Ballmer, or Larry Ellison, or Scott McNeil. They became billionaires by being brutal, ruthless businesspeople; it just so happens that the business, in their cases, happens to be software.

    I want to re-define and revolutionize the way people do X. That motivates a lot of the best people, for sure. Getting yourself in a position to do this is bloody unlikely. There are hundreds of great operating systems, programming languages, databases, etc, out there. Only a few of them really change the way people do things. And while it is still possible to make a buck in this world off a good idea, there's still a lot of luck and business smarts involved (see above) in taking an idea and turning it into a fortune. I've worked for more than one company based on a good idea that, lacking either luck or leadership, turned sour. Many fortunes are lost on such ventures.

    I want to be a Revolutionary like RMS and stick it to Microsoft. Hey, great. I now pronounce you a Revolutionary. Now: how are you going to stick it to Microsoft? Any schmuck can write free softwarwe. Not every schmuck can write something world-shaking.

    I want to be able to make big bucks. My advice: get a Microsoft certification and milk it. Or better yet, consider another profession, such as auto mechanic. The computer field is subject to many ups and downs; what looked like a steady income yesterday is a quick trip to the unemployment line today, and vice versa. Sure, you can earn the big bucks, but there's no guarantee that it will be a steady income, or that your skills will be in demand three years from now.

    I want to solve interesting problems / I love to code / I find computers endlessly fascinating. Well then, you've probably chosen the right profession. There is nothing better than doing what you love.

    I want to wear whatever I want and have nobody tell me otherwise. Despite stereotypes, this isn't always going to be possible. Remember, as a coder you're a part of a team, usually trying to conduct business. That means that sometimes, you're going to have to dress up, go to meetings, make presenations, and otherwise do some really boring and unpleasant things. Guess what? That's life! And, especially now that there's a glut of qualified coders, employers are going to expect you to dress and act more like a regular professional.

    Did I miss any?

    1. Re:So you want to be a software engineer? by g8oz · · Score: 1

      Not funny

    2. Re:So you want to be a software engineer? by Anonymous Coward · · Score: 0

      You're right, we need a picture of your wang in that reply.

    3. Re:So you want to be a software engineer? by snake_dad · · Score: 1
      I want to re-define and revolutionize the way people do X

      So... go work on Gnome or KDE or something...

      --
      karma capped .sig seeking available Slashdot poster for long-term relationship.
    4. Re:So you want to be a software engineer? by metlin · · Score: 2

      I want to be a Revolutionary like RMS and stick it to Microsoft. Hey, great. I now pronounce you a Revolutionary. Now: how are you going to stick it to Microsoft? Any schmuck can write free softwarwe. Not every schmuck can write something world-shaking.

      Absolutely! M + X + World; C + X + Shake...
      Sheesh, that was easy! ;-)

    5. Re:So you want to be a software engineer? by Anonymous Coward · · Score: 0

      Uh, I think he meant "X" as an unknown quantity, as a way of saying "Fill in the blank". I don't think he meant the GUI-thing called "X".

      Or maybe you're being silly. Ok.

    6. Re:So you want to be a software engineer? by einhverfr · · Score: 1

      I want to re-define and revolutionize the way people do X.

      Sorry, MIT already did that. And XFree86 has also provided some revoluationary aspects of itself.

      If you want to revolutionize the way people do X, why not joing the XF86 project.

      --

      LedgerSMB: Open source Accounting/ERP
  31. The obligatory get Laid comment by nihilist_1137 · · Score: 1

    I want to get laid and have hundred's of women follow me where ever i go We all have dreams. Sitting in a cube for 12 hours a day, with only artificial sunlight won't help. Don't you remeber the last time it happened?

    I was to be part of numerous stereotypes that are geeks everywhere You can be a part of this in any job. It's not software people only.

    I want to be able to use bad grammer and not have to read what i write. Two things.
    1- See above
    2- Welcome to Slashdot

  32. I think every discipline has one of these by xenocide2 · · Score: 1

    It seems that if you look hard enough, you can find this kind of thing for almost any subject. One that instantly springs to mind is Japanese. I sort of wonder why this was posted. Something about news for nerds I obviously missed.

    --
    I Browse at +4 Flamebait

    Open Source Sysadmin

    1. Re:I think every discipline has one of these by Anonymous Coward · · Score: 0

      That Japanese one really burns my ass. It's completely fucking inaccurate! There is no reason that any reasonably competent person cannot learn an Asian language. You need to be dedicated and focuses, however.

    2. Re:I think every discipline has one of these by Anonymous Coward · · Score: 0

      Er, focussed even. :p

    3. Re:I think every discipline has one of these by xenocide2 · · Score: 1
      Its a joke pal. At least I thought it was funny. Especially the Politeness level part.

      Depending on who you are speaking to your politeness level will be very different. Politeness depends on many things, such as age of the speaker, age of the person being spkento, time of day, zodiac sign, blood type, sex, whether they are Grass or Rock Pokemon type, color of pants, and so on.


      And as a former german student, I thought this was pretty funny:

      You are supposed to figure these things out from the "context", which is a German word meaning "you're screwed".

      --
      I Browse at +4 Flamebait

      Open Source Sysadmin

    4. Re:I think every discipline has one of these by primenerd · · Score: 1

      It's a funny little article. A friend sent it to me about three months ago. As a student of Japanese my favorite part is the descriptions about the classmates. I laughed my ass off until I realised that being stuck in a class with *those* people was neither funny nor enjoyable.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  33. Gee by -ryan · · Score: 1

    Slow news day...

  34. no sex? why not? by Anonymous Coward · · Score: 0

    Aren't there any available female marine biologists? Besides, if you get a crew of guys together on a boat for a few months, something is bound to happen.

  35. Want a free car? by Anonymous Coward · · Score: 0

    Our car-manufacturing company has developed a new revolutionary business model for making cars.

    We give away the cars for free and then we sell services for those cars! If you want to we can clean your car, wax it or you can use some of our other services.

    We get cash from a couple of VC's, the rest of them simple don't "get it". If we need more we just call "the suits".

  36. Re:Talking to dolphins? Hah! by Anonymous Coward · · Score: 0

    Some Geeks *want* dolphins, infact, there is an
    article circulating on freenet, about something
    we should only do with mamals of our own specie,
    if you catch my drift.

  37. Sounds like a cool job by N8F8 · · Score: 1

    But I think you have to touch a bunch of yucky things though. Barf.

    --
    "God fights on the side with the best artillery." - Napoleon, Marshal of France - speaking truth to power
  38. logical error by hexxx · · Score: 0, Redundant

    And so what if you will never have sex again?

    What do you mean AGAIN ?

    --
    IVAN Nethack is not the king anymore.
  39. The Grapes are sour, and not ripe as I thought. by mboedick · · Score: 1

    Spending all that time and money in school to become a marine biologist, and then spreading the word that marine biologists never have sex seems like a very inefficient form of denial.

    If you can't afford hookers, there's always alast resort.

  40. Going out to sea by craw · · Score: 1

    I sometimes go out to sea on marine research cruises. Here are some random comments.

    Going out to sea is like being in prison except for the additional danger of drowning.

    Women that would not be rated a 10 (actually a lot lower), somehow become very popular after a few weeks out at sea.

    There is nothing like a breeze and salt spray in your face as you stand at the railing gazing out at a sunset (or sunrise).

    There is nothing like pissing out into the ocean as you stand at the railing.

    Don't piss at the railing when the wind is in your face. It won't be the salt spray.

  41. Re:Talking to dolphins? Hah! by snake_dad · · Score: 2

    Humans? Hmm... that's a bit much. "They" (notice I choose my words carefully :-) ) can talk to, or at least communicate with, fellow geeks. It's talking to, doing things with, and actually touching, the opposite sex where the real problem lies. Talking to a dolphin without blushing and stuttering should not be that much of a challenge. However, understanding the replies is equally difficult in both cases :-)

    --
    karma capped .sig seeking available Slashdot poster for long-term relationship.
  42. I want to talk with dolphins by Isle · · Score: 1

    A:But all they want to do is have sex with eachother and eat fish..

    Q: I even want to talk to girls!
    A: See above!

    Case proven, humans and dolphins are alike.

  43. Re:wow, 4 posts and the site is already down by ICodeThereforeIAm · · Score: 2, Funny

    Do that many of us secretly desire to be marine biologists or is it a slow news day?

  44. Other marine science/tech careers by hey! · · Score: 3, Interesting

    So you love the ocean. There's other ways to make a career as an ocean geek with better job prospects than marine biology. For example ocean engineering, or environmental consulting.

    Exactly how much on the short end of the job prospect lever are marine biologists? My wife has a MS in physical oceanography and beat out over 250 marine biologists for her current position, including many Phds(they already had plenty of marine biologists). Not to denigrate her abilties (physical oceanography is extremely difficult), but it probably wasn't coincidental she was the only physical oceanographer, and the outfit had plenty of marine bioligists and ecologists but nobody with physical oceanography knowledge.

    I also happen to know a number of marine biologists, but they ALL got their current positions through nontraditional (e.g. not tenure track academic). Some came to their jobs from moving between government regulation/research and private industry in mariculture (ocean farming); some moved between working at educational institutions like museums or environmental NGOs and environmental consulting companies. One even got to do research by landing a job as dive master for a university and moving up by being useful.

    --
    Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
    1. Re:Other marine science/tech careers by "Zow" · · Score: 1, Flamebait

      Don't take this the wrong way, but the way your wife got her job was by being the only physical oceanographer to apply, and you're encouraging other people to pursue that career path? Won't that create compitition for your wife?

    2. Re:Other marine science/tech careers by hey! · · Score: 2

      Don't take this the wrong way, but the way your wife got her job was by being the only physical oceanographer to apply, and you're encouraging other people to pursue that career path?

      If you saw the math they deal with, you wouldn't ask that question.

      --
      Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
  45. Girls Of Quality by jimbo · · Score: 5, Funny

    Hmm, being from Europe I have noticed that quite often the VERY attractive girl(s) in the Standard American Low Cost Soap or Cheap Movie is a Marine Biologist.

    From this I deduce that a rather large percentage of the US (and I see a growing tendency in Australia as well) Marine Biologists are incredible beautiful model type young girls, although often with with larger key features (aehmn). They also quite often are very naive and have affairs with men who Only Are Up To No Good.

    Even girls in their late teens (with mid-twenties female features) can be fully professional Marine Biologists over there if they are beautiful enough (and aren't already scientists, a profession with also have many beautiful women or works for a advertisement agency).

    So I want to quit my SW development job and go to the US working as a Marine Biologist, Scientist or Advertisement Something That Doesn't Require Any Education because of all the incredibly beautiful and naive or at least flimsy girls working in these jobs.

    Only downside is ofcourse that they seem to be unable to maintain a long term relationship (say between a week and a few months on the max), but one should not smell only one flower anyway...

    1. Re:Girls Of Quality by eander315 · · Score: 1

      Actually, being from Europe, you don't really need to be in the same field as those women. You've got the sexy European accent, manerisms, clothing, habits, cigarettes, tea, sports teams and odd sayings to get you in the door with any US woman you want. One of my friends is from England. He's absolutely amazing with the opposite sex. My other friends and I make fun of the fact that his usual opening line (dripping with English accent) is "Hello. I'm not from here."

  46. Some Better Advice... by Anonymous Coward · · Score: 0

    If you want to talk to dolphins be a genetisist.
    If you like jaque cousteou (whatever) be an author.
    If you want to make big bucks sue a lot of people.

    We all have our callings.

  47. Career Guide for Engineers and Computer Scientists by djelovic · · Score: 1

    If you found the text from the original post funny you might want to check out the Career Guide for Engineers and Computer Scientists by Philip Greenspun.

    Dejan
    www.jelovic.com

  48. ah, the eternal dolphin question by jearbear · · Score: 2, Interesting

    First off, as a longtime reader and marine biologist, let me express my glee that we finally get something in /. - we're geeks too! heehee.

    Secondly, on the dolphin note.....well, funny y'all should mention this, as recently, a few marine bio friends and i were having a discussion on just this topic...It all started from how saying you were a marine biologist interested in learning the secret language of dolphins could be a great pickup line at a bar... The smell... well, isn't that what colgne is for!

    Hey, my girlfriend didn't my dead rockfish aroma TOO much....at first..

    1. Re:ah, the eternal dolphin question by burning_plastic · · Score: 1

      You've got to admit that odour de rotting herring is much worse than that of rockfish... And that the best way of discouraging someone from becoming a marine biologist is to tell them about all the plankton they'll have to learn about ;->

      But the marine biologist line definitely works as an ice breaker (but only if she asks what you do first...)

    2. Re:ah, the eternal dolphin question by spacy · · Score: 1

      I have to say that the odor of rotting marine mammals is far worse than any fish odor. Really ripe dophin is gag-inducing from half a mile away. I had a summer internship where among other things I had to catalogue dead stuff that washed on shore...dolphins included.

  49. Whoa! by Kingpin · · Score: 1


    When I studied engineering we used to pretend that we studied marine biology - saving whales, dolphins and shit. The chicks loved it. I think the guy must be too serious whenever he talks about marine biology to females, don't mention seaweed and rotten fish - go for the juicy baywatch like stuff :)

    --
    Unable to read configuration file '/bigassraid/htdig//conf/14229.conf'
    Geocrawler error message.
  50. rockfish v. herring, eh? by jearbear · · Score: 1

    That's a tough one... I think it depends on how long the fish has been rotting. 3 hours in hot water to defrost.......that'll do ye. hehe.

    Then again, you could be working with 3mm worms. Now THAT'S sexy.

  51. good thing....... by Anonymous Coward · · Score: 0

    good thing you people didnt bomb the main ucsb server, i kinda still need to register for my classes next quarter and check my email

  52. exploding whale by Anonymous Coward · · Score: 0

    I think the most interesting thing to come out of this article is the burried link to the exploding whale videos. Good times.

  53. There are similar reasons not to study Japanese! by heiberg · · Score: 1
    I ran across this yesterday. Pretty similar and damn funny!

    Why not to study Japanese.

  54. low pay - for what? by MarkMac · · Score: 1
    There is actually a wonderful recently published book entitled "The Tapir's Morning Bath" (by Elizabeth Royte) that is related this topic. The journalist author spent a year at a tropical rain-forest research facility in Panama trying to understand the scientists (most of whom are grad or post-grad students) and the purpose of their research. So what if you've counted how many types of beetles cluster in certain kinds of trees or determined which insects a bat species prefers to eat in a particular season?

    The answer the author provides isn't that such information will necessarily save the world (may be it will) but rather that what drives these scientists is the sheer fun/excitment of looking and discovering things. Quoting the authors of another book "Tropical Nature", 'Complexity excites the mind and the discovery of patterns rewards it." Who needs art - or "Star Wars" movies for that matter? Well, the same answer applies to basic science - "it's good for us" ...

  55. My dad is a marine biologist... by markmoss · · Score: 3, Funny

    so that part about never having sex again is not entirely true.

    1. Re:My dad is a marine biologist... by Anonymous Coward · · Score: 0

      I hate to tell you this, but your adopted. Your original parents are commerce graduates, who we all know have sex like bunnies. Go commerce!!

  56. Marine Biology Career in Uniform by Anonymous Coward · · Score: 0

    One of the better career paths for Marine Biologists can be to wear a military uniform. In the US, this can be with the US Navy, Coast Guard, or NOAA (National Oceanic and Atmospheric Administration). Of course, the jobs can range from training dolphins to retrieve torpedos to investigating / marketing new great lakes seafoods (a task a friend of mine, a NOAA officer, once had!).

  57. no i want to be a marine ! by Anonymous Coward · · Score: 0

    no i want to be a marine !