Slashdot Mirror


NASA Eyes Shuttle Replacements

jonerik writes "According to this article at Space.com, NASA yesterday released a status report on the first year of NASA's Space Launch Initiative; the search for a space shuttle replacement, currently planned to begin operating ten years from now. The competing contractors - Boeing, Lockheed Martin, and a team consisting of Northrop Grumman and Orbital Sciences Corp. - have their work cut out for them. NASA is looking for both a ten-fold improvement in per-pound launch costs (from $10,000 per pound to $1,000) and massive improvements in crew survivability." In related news, Rubyflame writes: "Aviation Now has a story about four new kerosene-fueled rocket engines being developed by Aerojet, Pratt & Whitney, Rocketdyne, and TRW. These are engines that will produce a million pounds of thrust, intended to outdo Russian designs in reliability and launch cost, and one of them may power a new reusable launch vehicle. Kerosene has the advantage that it's denser than hydrogen, so the fuel tanks can be smaller."

314 comments

  1. OH MY FUCKING JESUS by Anonymous Coward · · Score: -1, Troll

    I shit you not dude, that is the most craptacular thing i have seen since... well, ever.

    1. Re:OH MY FUCKING JESUS by Anonymous Coward · · Score: -1, Troll

      i'm gonna cruise this unmoderated ac fp motherbitch as long as i can. DAMN DOG THIS SHIT IS FLY.

  2. about time.... by smashr · · Score: 0

    about time.... i mean since the end of the cold war we really havent had any good push to do things in space.... at least now we can do silly, safe experiments at 1/10th the cost...

    1. Re:about time.... by Caltheos · · Score: 1

      The only reason we haven't seen a shuttle replacement already is the fact that 1,000's of jobs depend on the clunky and labor intensive prep and launch of the existing space shuttle program. I believe the plans and protoype for a spaceplane that could take off from an airport and reach LEO already exist. I guess they just need to find a way to make it a bit more expensive before they finish the project. BTW Stephen Baxter has some great hard sci-fi reading about alternate near futures...Titan is a great one about the collapse of NASA and a very technical description of a pieced together trip to Saturn's moon Titan, great read.

      --
      We've secretely replaced the Enterprise's dilithium crystals with Folgers crystals. Lets see if they notice.
    2. Re:about time.... by spike+hay · · Score: 3, Interesting

      NASA needs to trim some of it's bureacratic fat.

      Case in point:

      Both the University of Queensland in Australia and NASA are developing SCRAMJET engines, or Super Sonic Combustion Ramjet. These are capable of doing extreme hypersonic speeds, up to escape velocity.

      NASA has spent $500 million on it's program. It has only produced one failed attempt at SCRAMJET flight.

      In contrast, spending only $500,000, the UoQ has already produced a successfull SCRAMJET flight.

      NASA takes lots of money and doesn't get anything done. They funnel all their money into the worthless shuttle and space station programs. We don't need to spend money to send people into LEO. It's a cold or hot vacuum a few hundred miles out. Whoop-de-shit.

      Before NASA worries about the space station, they should buckle down and actually get a spaceplane. Cancel the shuttle program. It's worthless.

      When they have a low-cost spaceplane, they can breed all the rats in space they want, and plus a mission to Mars might become feasable.

      Here, about 45 years after Sputnik, we still haven't gotten rid of our horribly expensive rockets.

      --
      If you don't understand any of my sayings, come to me in private and I shall take you in my German mouth.
    3. Re:about time.... by SteveAstro · · Score: 1

      BTW Stephen Baxter has some great hard sci-fi reading about alternate near futures...Titan is a great one about the collapse of NASA and a very technical description of a pieced together trip to Saturn's moon Titan, great read.

      Most depressing Sci-fi story I've ever read...

      Steve

    4. Re:about time.... by shadowbearer · · Score: 0

      " NASA needs to trim some of it's bureacratic fat."

      Absolutely. Regular readers of Pournelle's site will realize that NASA has always had all the funding it needed. Then there's the DC-X, the development of which NASA took over and subsequently killed dead thru mismanagement.

      I've been seeing articles about the "next gen shuttle" for 15 years...and I'm still wondering where it is. If the Aussies (kudos!) can fly Scramjet engines on minimal budget, we need to take a really hard look at exactly where the money at NASA is being spent (hint: the best engineers can earn more money elsewhere).

      One might also mention laser launchers, which show great promise but have received little or no real attention from the government or NASA.

      IMO NASA should concentrate on science and R&D and leave commercial sat launches and manned flight to the private sector. Unfortunately until the larger corp's in the private sector wake up to the potential profits (and get some decent legislation from the gov) the US's private sector space flight programs will remain small.

      Of course then there's people like John Carmack http://www.armadilloaerospace.com

      Go Carmack!

      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
  3. Carthago delendo esset! by Anonymous Coward · · Score: -1, Offtopic

    Carthago delendo esset!

  4. safe by Anonymous Coward · · Score: -1, Offtopic

    massive improvements in crew survivability

    uhhhhhhhhhhhhhhhh

  5. first druken post? by Anonymous Coward · · Score: -1, Troll

    kenyon rules.black haus rules.

  6. Haiku by MrHat · · Score: 4, Funny

    Nasa space shuttle
    Takes off like a pile of bricks
    Lighter craft required

    1. Re:Haiku by NoMoreNicksLeft · · Score: 0, Offtopic

      Oh my god, what kind of monster have I created?

      I've opened the haiku box, and now, there's no way to stuff the verse back inside...

      Oh, the humanity!!!

    2. Re:Haiku by MrHat · · Score: 0, Offtopic

      There once was a posting to Slashdot
      By a man wielding plus two who dare not
      Make plus one the score
      Of his posting, a door
      Away from his boredom and skull-rot

    3. Re:Haiku by Enonu · · Score: 1

      Needs refinement. The 2nd and 3rd lines convey the same image, and "Nasa space shuttle" is redundant in the Haiku sense.

    4. Re:Haiku by MrHat · · Score: 1

      Stupid haiku verse
      "Needs some refinement", he says
      All is GPL

    5. Re:Haiku by Anonymous Coward · · Score: 0

      Sheesh .. tough crowd ..

    6. Re:Haiku by Anonymous Coward · · Score: 0

      Needs work, the last line has 6 syllables.

    7. Re:Haiku by MrHat · · Score: 1

      Nah, you just have to pronounce it like you're giving a southern baptist sermon.

  7. BDB is the answer. by Tyler+Eaves · · Score: 1

    BDB = Big Dumb Booster.

    We did the Saturn 5 in the mid '60's with slide rules. Surely we can do much better than that these days?

    Reuseable is a joke for the main compnent. The shuttle is practically rebuilt anyways.

    --
    TODO: Something witty here...
    1. Re:BDB is the answer. by Latent+Heat · · Score: 5, Insightful
      The Saturn 5 was no Big Dumb (i.e. low-cost expendable) Booster -- I figure maybe a cool billion a shot compared to half that for a Shuttle launch.

      Problem was the Saturn 5 was already paid for (million pound thrust kerosene engine -- didn't they call than the F-1?) while the Shuttle that replaced it required billions in development cost. Also, the Saturn could put 4 times the payload in LEO, making it half as expensive as the Shuttle per pound, and it could send stuff to the Moon.

      Instead of punching around with the Shuttle in LEO and this Space Station which is the overpriced whatever, we could have kept Apollo going and evolving, and with the same money we have spent, we could have had a permanent human presence on the Moon by now.

      What would that gain? Well, we could have a much more thorough evaluation of lunar resources (possible polar ice) and more thoroughly evaluated O'Neil's ideas of using the Moon as a source of construction materials for space-solar beamed power systems in geosynchronous or L-whatever orbits. Instead we are dinking around in LEO learning nothing.

      The Big Dumb Booster by the way, was an idea to scale up the Lunar Module descent engine (had to be a KISS design to bring the astronouts down in one piece) -- they gave the job of building a prototype motor to some general construction contractors who didn't know the first thing about rockets, and they test-fired a successful motor. The thing would have been the size of a Saturn but much more cheaply (heavily) build -- payload would have been more in the Shuttle category, but the idea is that boiler and bridge makers could slap them together. Of course the Shuttle killed the idea.

    2. Re:BDB is the answer. by Anonymous Coward · · Score: 0

      You're right. It's nice that after 15 years of troubleshooting and who knows how many $$$ of maintenance after each launch, a shuttle orbiter with mediocre cargo space can be reused repeatedly over a 20 year period. But I don't see how anyone right now could come up with a better alternative than a BDB. If they can, chances are they're not working for NASA.

    3. Re:BDB is the answer. by EvilBuu · · Score: 1

      ...was an idea to scale up the Lunar Module descent engine (had to be a KISS design to bring the astronouts down in one piece)....

      You mean a big flashing 2000-bulb NASA logo, pyrotechnics and a laser-light show? Six-inch tounges and circus makeup? Platform boots so tall you could economically launch spacecraft off of?

      Sorry, just wondering: what's a KISS design? (I don't even like KISS)

      --

      Green-voting, republican-registered, socialist-libertarian.
    4. Re:BDB is the answer. by PyroMosh · · Score: 1

      While you post does evoke rather... interesting visuals. KISS is generaly understood to stand for "Keep It Simple, Stupid".

    5. Re:BDB is the answer. by steveha · · Score: 3, Interesting

      It is hard to tell how much a Shuttle launch costs. The numbers are so embarassingly large that NASA cooks the books to try to make them look better.

      Almost all of the costs for the Shuttle are salaries for the huge army of people NASA employs. According to Henry Spencer, the Shuttle program's costs are nearly constant: they stay pretty much the same, no matter how many or few launches happen in a year. (So you might as well launch stuff.)

      You are absolutely correct: NASA should have taken the working Apollo designs and incrementally improved them. If they had kept up a good improve/test/fly schedule, we would probably have several cool 2001-ish space stations and a moon base by now. But for whatever reason, NASA developed the Shuttle in a massive paper design exercise, to be a giant leap forward in spacecraft. No need to build X vehicles and test them! Just build the Shuttle, perfect the first time!

      Maybe BDB is the answer. Maybe SSTO (single stage to orbit, a completely re-usable spacecraft) is the answer. I don't know. But I do know that NASA is past its useful life, and the answer simply will not come out of NASA.

      What the government should do is promise to buy X launches at Y tons of payload per launch, perhaps with special tax credits or other bonuses. Then wait for launch vehicles to appear. The money will never be spent if working vehicles don't appear, and if they do appear they will be cheaper than anything the modern NASA can create.

      steveha

      --
      lf(1): it's like ls(1) but sorts filenames by extension, tersely
    6. Re:BDB is the answer. by Anonymous Coward · · Score: 0

      Lets just not go building stuff with the moon's resources.

      Moon's mass == Earths tides (and our own for that matter)

    7. Re:BDB is the answer. by JimPooley · · Score: 2

      Keep
      It
      Simple
      Stupid!
      That's what KISS stands for in this context.

      --

      "Information wants to be paid"
    8. Re:BDB is the answer. by pythas · · Score: 1

      In order to keep with the times, maybe it's time to revise KISS to : Keep It Simple Shitfucker.

    9. Re:BDB is the answer. by royalblue_tom · · Score: 1

      It's building stuff with the moon's resources for use on the moon. The total mass of the moon would not change significantly (since the stuff used is staying there).

      So how much stuff do we have to ship to the moon to increase tidal movement? Sounds like something NASA needs to spend a billion or two researching ...

    10. Re:BDB is the answer. by digitalunity · · Score: 2

      Yeah, get over it. Don't wanna read my .sig, adjust your prefs.

      Be nice, or else...

      --
      You can't legislate goodness. Let each to his own destiny, by will of his freely made choices.
  8. Yes but... by Anonymous Coward · · Score: 0

    will it run Linux?

    1. Re:Yes but... by Roto-Rooter+Man · · Score: 0

      Target launch date in 2012. Nothing will be running Linux in 2012.

      --

      The goatse guy for president. Win one for the gaper!
    2. Re:Yes but... by MaxVlast · · Score: 2

      20 years later most people are still using some form of DOS.

      --
      There should be a moratorium on the use of the apostrophe.
      Max V.
      NeXTMail/MIME Mail welcome
    3. Re:Yes but... by Anonymous Coward · · Score: 0

      So you're saying that as evidenced by people continuing to use a crappy rip-off clone today, that 20 years from now the situation will be the same. Looks like Linux will be around!

    4. Re:Yes but... by MaxVlast · · Score: 2

      Yep. You pretty much hit the nail on the head.

      --
      There should be a moratorium on the use of the apostrophe.
      Max V.
      NeXTMail/MIME Mail welcome
  9. SCI-FI by gerf · · Score: 0

    we've takin ideas from them before... how about the magnetic slingshot built on the side of a mountain to "throw" materials into space? of course, with something like 100 Gs, humans would have to use another method...

    1. Re:SCI-FI by Anonymous Coward · · Score: 0

      Agreed, this would be by far the cheapest way of getting stuff into space on a per launch basis. I guess the intial costs would be huge along with the envirinmental impact of blowing the shit out of some mountain to build the thing (NORAD turned out OK in the end, but some of the Greenies out there would still complain!!)

  10. I thought... by Anonymous Coward · · Score: 0

    I thought the point of having a space shuttle was to make replacing it unnecessary...

  11. Sligshot by Anonymous Coward · · Score: -1, Offtopic

    they need like a big ass slingshot and stuph to shot ppls up into space and crap cuz that woul dbe 1337 or sumthin..heheh why am i replying? i dunoo.....blwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    hehe

  12. Mice are the key! by Phosphor3k · · Score: 1

    A good shuttle will include mice for the scientific development of the pleasure center.

    Hooray for Mice! Bring on the electrodes!

    1. Re:Mice are the key! by Anonymous Coward · · Score: 0

      Mice are never good on space flights -- they just end up wanting to slice up your brain to find the Question...

    2. Re:Mice are the key! by zeno_2 · · Score: 2

      Haha, that is so true! =)

  13. Just another NASA bait'n'switch by AJWM · · Score: 2, Interesting

    This is just another money-grubbing scheme, same as the X-33, same as countless others before it. The last thing they want is to really lower the cost of space launch and let the riff-raff in.

    They just want gobs of money to spend on technology development programs (read "new toys"). The ultimate goal of upper NASA management these days is to reach retirement without having any disasters (like Apollo 1 or Challenger) on their watch -- the easiest way to avoid that is to launch things as infrequently as possible.

    (Note, there are probably a few naive engineers and rocket scientists still at NASA who believe the PR and have honorable intentions. But they're not the decision makers.)

    --
    -- Alastair
    1. Re:Just another NASA bait'n'switch by Schlemphfer · · Score: 3, Funny

      Note, there are probably a few naive engineers and rocket scientists.

      Funny, I always thought the terms "naive" and "rocket scientists" were antithetical.

      --
      I'm generally "Interesting," "Insightful," and even "Funny" here. What the hell happens to me at parties?
    2. Re:Just another NASA bait'n'switch by sean23007 · · Score: 3, Insightful

      Being naive does not make one an idiot. Naivete is the opposite of wisdom, not intelligence.

      --

      Lack of eloquence does not denote lack of intelligence, though they often coincide.
    3. Re:Just another NASA bait'n'switch by LightForce3 · · Score: 1

      As a firm believer in NASA and the space program, I ask you to back up your statements with some evidence that they are true.

      Also, are you saying that NASA and the space program are useless?

    4. Re:Just another NASA bait'n'switch by Anonymous Coward · · Score: 0

      mod that up. the poster is wise.

    5. Re:Just another NASA bait'n'switch by bbay · · Score: 1

      No, naivete is the opposite of experience. The opposite of wisdom would be foolishness.

    6. Re:Just another NASA bait'n'switch by abraxas · · Score: 1

      This is just another money-grubbing scheme, same as the X-33, same as countless others before it. The last thing they want is to really lower the cost of space launch and let the riff-raff in.
      I assume you have some facts to back up your jaundiced opinions. If not then stfu.

      The shuttle platform is an old design with an aging fleet that will continue to cost more for each flight with higher attendant risks. For some tasks, it is the only tool available today and needs to be kept in service to perform those functions. Also, there is a minimum number of flights per year that can be taken before attrition sets in.

      The last point that you are so painfully oblivious to is engineering attrition. Those technology development programs (read "new toys") you speak of are needed to keep engineering talent fruitfully occupied and ready to tackle the real challenges ahead. Like any other technology staff, there is a minimum point at which people start to walk away in droves and in this single employer industry segment, you can't hire them back from the other companies they've gone to since once they leave NASA many of them will convert to other industries.

      Your points are so obviously indefensible and purely opinion that I can't for the life of me see why anyone modded your comment up.

    7. Re:Just another NASA bait'n'switch by Anonymous Coward · · Score: 0

      Look at Von Braun. Or did he just not give a shit what his creations were used for?

    8. Re:Just another NASA bait'n'switch by MADCOWbeserk · · Score: 1

      This thread is getting "stupid" the opposite of "Intelligent"

    9. Re:Just another NASA bait'n'switch by Anonymous Coward · · Score: 0

      And I imagine you would have gone to the concentration camps instead of working on the studies you love.

    10. Re:Just another NASA bait'n'switch by Anonymous Coward · · Score: 0

      Holy shit man, you are STILL bitter about not winning the science fair in grade 4 or what?

    11. Re:Just another NASA bait'n'switch by Anonymous Coward · · Score: 0

      Talk to some tenured professors about politics some time.

  14. about time by EricBoyd · · Score: 3, Insightful

    I sure hope NASA sticks to their guns this time. Shuttle technology is like 30 years old now, and it's seriously *embarassing* because of that. I mean, the gains that they are expecting are reasonable - which shows you how out of date the Shuttle is.

    Websurfing done right! StumbleUpon

    --
    augment your senses: http://sensebridge.net/
    1. Re:about time by Jubedgy · · Score: 2, Informative

      Well, I wouldn't call it embarassing since:

      There's been only one major accident (challenger) in those 30 years

      No one else has a reusable launch vehicle (that I know of...I don't think russia does, pretty sure no one else does either

      --Jubedgy

      --
      Si hoc legere scis nimium eruditionis hebes
    2. Re:about time by Anonymous Coward · · Score: 0

      "and it's seriously *embarassing* because of that"

      What's SERIOUSLY embarassing is that no other country has the power to match our 30 year old tech.

      Embarassing for them, not us.

      Still, your point is well recieved. We should be have something much more advanced in the field by now.

    3. Re:about time by scotch · · Score: 2
      .I don't think russia does, pretty sure no one else does either

      Russia used to have a shuttle called the Buran or some such. Buran means Snow Storm, IIRC. I doubt if they fly it anymore, some enterprising Russian Engineer probably carved it up and traded the scrap metal for vodka.

      One feature it was supposed to have that the US shuttle doesn't is some power on landing, allowing a wider margin of safety in landings.

      I'm sure somebody has more info, or check google for "buran shuttle"

      --
      XML causes global warming.
    4. Re:about time by fliptw · · Score: 0

      Remember, challenger was cause by a very small mistake.

    5. Re:about time by Anonymous Coward · · Score: 0

      Well, cost wise it's embarrassing. Considering it you can buy a full trip + training from the Russians for $20 million, while it takes something like $200 million to recover and refuel the solid rockets and build the new (non reusable) hydrogen/oxygen tank.

      I don't see the point of a reusable spacecraft if it doesn't either reduce costs (the shuttle clearly doesn't) or reduce the amount of waste burned up (the huge tank still burns up, so no major improvement over a standard rocket there).

    6. Re:about time by Waffle+Iron · · Score: 2
      Shuttle technology is like 30 years old now, and it's seriously *embarassing* because of that.

      What seems more embarassing to me is that the Russians have a much more appropriate and cost effective system to launch humans into space -- and it uses 45 year old technology.

    7. Re:about time by Anonymous Coward · · Score: 0

      There was something about this in an old Slashdot article. Apparently one of the prototypes is a tourist attraction in Moscow, and the rest are scrap or something. IIRC it only made one flight, and that was via remote control. It didn't get out of the testing stage before the Soviet Union fell and took most of their funding with it.

    8. Re:about time by Jubedgy · · Score: 1

      ahh, thanks for the info, I hadn't even heard of that thing...too bad it's late here or I'd do some research on it...sounds like a project for tomorrow!

      --Jubedgy

      --
      Si hoc legere scis nimium eruditionis hebes
    9. Re:about time by Moofie · · Score: 2

      Reusability is an absolute crock of shit. Just because it happens that the air (space?) frame is the same, doesn't make it cheaper to operate. The Shuttle is practically disassembled and reassembled each time it's launched. Cost per pound of payload for the Shuttle is large relative to other alternatives, like the boring ol' rockets.

      You're right about the safety record...it's enviably good. But just because the rocket is reusable doesn't mean it's cheap.

      --
      Why yes, I AM a rocket scientist!
    10. Re:about time by MaxVlast · · Score: 2

      That just doesn't matter. In fact, your message alone is very irritating.

      Any mistake that causes the whole system to explode and kill people is a _major_ mistake. No matter how seemingly trivial it was, it ceased being trivial when the whole damn thing blew up.

      --
      There should be a moratorium on the use of the apostrophe.
      Max V.
      NeXTMail/MIME Mail welcome
    11. Re:about time by Anonymous Coward · · Score: 0

      You must keep in mind that the shuttle technology is being upgraded. Everything in the aerospace industry is at least 5 to 10 years old. Even the newest fighters(F-18) are twenty years old. Why? Time to impliment & cost.

      The only way to keep things within 20 years of technology would require a budget on the order of Apollo. Ouch.... However I do agree, NASA should pursue more commerical technology to improve technology and cost.

      --Bob Manning

    12. Re:about time by PyroMosh · · Score: 2

      You seem to be forgetting. The shuttle isn't expensive on a per pound basis because it's reusable. It's expensive on a per pound basis because it needs to guarantee a certain level of SAFTEY. It needs to do that because it's manned.

      You don't need these guarantees with unmanned payloads. Mostly because it's not economic.

      Let's say you have a $50 Million Satellite you want to launch.

      If you can build a disposable rocket with a 99.999% chance of success per launch, but it will cost you a cool $2 Billion per launch, why would you do that if you can build a rocket with a low 95% chance of success per launch for say, $200 Million?

      Even if you loose the rocket and the payload on the pad, you're still ahead money-wise of the 99.999% launch vehicle buy building and launching the dangerous rocket *seven times*!

      On the other hand, though, would you willingly get into a craft that you knew had a projected 1 in 20 failure rate?

      *THAT* is why the shuttle is so expensive. The closer to 100% safe you get, it's an exponential curve in cost. The current effort to create a second generation reusable craft won't eliminate the curve, but it will (hopefully) lower it because of the lower costs of newer technologies.

      As for reusability being a crock, that's not really true either. Although the shuttle is horrifically expensive (and I hope I just illustrated why) a disposable craft with similar capabilities would be even more costly. Not only that, but how do you create a craft that can retrieve satellites from orbit to the earth without replicating something like the shuttle? Once you've got something large enough to do that coming back to the earth as the crew return vehicle, it becomes more economical to refit that and relaunch it than it does to throw it away.

    13. Re:about time by AJWM · · Score: 2

      If you didn't have to practically rebuild the whole fucking Shuttle after every flight, you could get reliability the same way you do with aeroplanes. I.e., if it worked on the last flight, it'll probably work on the next (otherwise known as "if it ain't broke, don't fix it").

      Problem is that Shuttle is practically designed to break on every flight. (SRBs, ET, etc). Then the whole thing is decertified for flight as soon as it lands.

      Air travel would be expensive too if the plane had to be reinspected for a new Certificate of Airworthiness between every flight, let a lone doing a full overhaul on the engines.

      --
      -- Alastair
    14. Re:about time by Moofie · · Score: 2

      One of the major expenses is the heat-shield system. Every tile is indiviually shaped, and has to be inspected by hand and many many of them need to be replaced. I think that modern materials can do a much better job, and that would go a long way on reducing cycle cost.

      The other big advantage would be to make the thing smaller. Use a small spaceplane to get crew up and back, but shoot your heavy payloads on a BDB.

      --
      Why yes, I AM a rocket scientist!
    15. Re:about time by jafac · · Score: 2

      Embarrassing? Compared to what? Yemen's reusable space launch vehicle?

      --

      These are my friends, See how they glisten. See this one shine, how he smiles in the light.
  15. I'm really getting bored of Slashdot... by MrHat · · Score: 1, Funny

    There once was a man from Nantucket
    Built a ship so light that he could chuck it
    At c into the air
    Not like Nasa did care
    They poured more in to Boeing and said 'Fuck it'

    1. Re:I'm really getting bored of Slashdot... by Linuxthess · · Score: 0, Offtopic

      Mod this guy up, He sure knows his shit, Oh do it, God Damn It!!!

      --

      I sig, therefore I was.
    2. Re:I'm really getting bored of Slashdot... by MrHat · · Score: 1

      Linuxthess made a decree
      To moderate up above three
      The post parent to his
      A limerick it is
      A good one (save the part about c)

  16. Crew survivability? by Cutriss · · Score: 2, Interesting

    "...and massive improvements in crew survivability."

    No, I didn't read the article, but, assuming this poster is reasonably accurate with his description text, why is this necessary? Aside from Challenger, have we had any significant (or even insignificant?) problems with shuttle crews surviving the trip?

    --
    "Mod, mod, mod...and another troll bites the dust."
    1. Re:Crew survivability? by Jubedgy · · Score: 1

      IIRC, Challenger is the only one. I think the problem is that there are so many things that CAN go wrong...that's why the survivability thing is important. I imagine the new thing'll have more redundancies, be more resistant to certain accidents, or other things to that effect, which will raise that number.

      --Jubedgy

      --
      Si hoc legere scis nimium eruditionis hebes
    2. Re:Crew survivability? by Chairboy · · Score: 5, Interesting

      Aside from Challenger?

      Please note that during the first 2.5 minutes of every shuttle launch, there are NO abort modes that are survivable. If there are any problems with the SRBs, they cannot be turned off. If there are any catastrophic problems with the ET, it doesn't matter, you must continue your launch profile until the SRBs have stopped.

      Three engine shutdown during SRB burn? Shuttle disintegration.

      ET rupture? Shuttle disintegration.

      Pretty much anything, dead astronauts.

      The russians use 40 year old technology, but at least they have survivable aborts throughout the entire flight profile.

    3. Re:Crew survivability? by ugliness · · Score: 1

      Maybe you should have (read the artivcle), it quotes the figure as being between 1 in 250 and 500.

      Wanna go for a ride? :-)

      --
      "...but destined to take the place of the mud shark in your mythology..." - FZ
    4. Re:Crew survivability? by Bios_Hakr · · Score: 3, Informative

      You also forgot to mention the fact that before every launch, an explosive demolition team arms a large satchel of c4 in the nose of the SRBs. Gee, I'd hate to be the one to press that big red button when the shuttle deviates from its flight plan.

      --
      I'd rather you do it wrong, than for me to have to do it at all.
    5. Re:Crew survivability? by Llywelyn · · Score: 2, Insightful

      The trick is anticipating problems before they occur. As another posted out, there is nothing that allows for an abort in the launch sequence and there are a long list of things that--should any of them go wrong--repair and getting the shuttle back to Earth with a living crew is going to be *nontrivial*.

      The probability of any of them going wrong is actually fairly low (as our record as indicated with 10 deaths, and only 7 in the shuttle) and our ability to recoup is actually pretty good, but I think NASA wants a system in which *if* something does go wrong, they won't loose an astronaut.

      --
      Integrate Keynote and LaTeX
    6. Re:Crew survivability? by Anonymous Coward · · Score: 0

      One thing you can't deny is that all of the serious accidents that have plagued manned missions (and most unmanned ones) have been due to design/manufacturing f___ups and mismanagement, not old technology.

    7. Re:Crew survivability? by Anonymous Coward · · Score: 0

      Couldn't the SRB's be separated from the shuttle prematurely, assuming that was functioning in the event of a situation with the orbiter engines?

    8. Re:Crew survivability? by geoswan · · Score: 2
      "...and massive improvements in crew survivability."

      why is this necessary?

      The Soviet Buran, which was not a knockoff of the American Shuttles, had ejection seats for a certain number of crew members. Were the lives of Soviet Cosmonauts more valuable than those of American Astronauts?

    9. Re:Crew survivability? by Temkin · · Score: 1

      The Soviet Buran, which was not a knockoff of the American Shuttles, had ejection seats for a certain number of crew members. Were the lives of Soviet Cosmonauts more valuable than those of American Astronauts?



      The Columbia had ejection seats for the first 4 missions. They were removed once the shuttle made operational status to save weight. They were only for the pilot and co-pilot, and would not have helped the Challenger crew. Surviving high altitude ejections at supersonic, let alone hypersonic, speeds is not a trivial engineering task. Riding a seat up the rails and into the slipstream at mach 3 will kill you. You need a protective capsule.

      Temkin

    10. Re:Crew survivability? by Temkin · · Score: 1

      And you're only pecking at the surface. It's my understanding NASA had to lower the allowable crosswind aloft numbers because they kept getting close to the shear strength for the nose attachment on the orbiter. The rocket engines swivel to compensate and keep the shuttle on track. But they can generate enough force to shear away from the tank. Too windy... shuttle disintegrates... and there are hundereds of such scenarios.

      Temkin

    11. Re:Crew survivability? by steveha · · Score: 2

      Couldn't the SRB's be separated from the shuttle prematurely, assuming that was functioning in the event of a situation with the orbiter engines?

      No. The problem with solid rockets is they don't have an "off" switch; you must wait for them to finish burning (run out of the solid fuel) before you can separate from them. The connection between the SRB and the Shuttle is under a lot of stress while the SRBs are firing, and it is very nontrivial to cleanly break that connection under load; and then you have the problem that the exhaust coming from the SRB's will probably destroy the Shuttle (the external tank is sort of like a big bomb).

      Liquid boosters would have been a lot safer, and should have done the job well. I don't remember why NASA went with the solid boosters. It may have had something to do with which Congressional district the SRBs are built in.

      steveha

      --
      lf(1): it's like ls(1) but sorts filenames by extension, tersely
    12. Re:Crew survivability? by Qrlx · · Score: 1

      Re: during the first 2.5 minutes of every shuttle launch, there are NO abort modes that are survivable

      Respectfully, it is my opinion that the facts do not support your conclusion. The Challenger crew very likely survived the initial explosion and died when the crew compartment hit the Atlantic Ocean, 2:45 minutes later. You can, and should read the Kerwin Report here.

      A few juicy bits from the report:
      Four PEAP's were recovered, and there is evidence that three had been activated...
      The estimated breakup forces would not in themselves have broken the windows...

      My take is that had there been a big ass parachute which somehow survived Challenger's energetic disassembly and rapid oxidation, that they might all be alive today, major downrange malfunction notwithstanding.

    13. Re:Crew survivability? by Markus+Landgren · · Score: 1

      I don't remember why NASA went with the solid boosters.

      Solid boosters are generally considered more reliable (fewer moving parts). Supposedly NASA determined that the lower risk of power loss with a solid booster would outweigh the additional abort flexibility of a liquid booster.

      Of course, we know today that this particular solid booster design has caused more trouble than the liquid main engines, but taking all NASA programs into account we find that liquid engines have had their fair share of failures.

    14. Re:Crew survivability? by Anonymous Coward · · Score: 0

      I see you have +3 informative. Can you provide a *reference* to the source of this "information"? Or should I assume that this is just a by-product of cold-war-era propaganda?

    15. Re:Crew survivability? by zeno_2 · · Score: 2

      What do you mean the Buran was not a knockoff of the American Shuttle. They had used its design when making it, but they had changed some things (left some features out, adding others like an ejection system that could be used at mach 4+).

      How else can you explain that the Buran looks pretty much *exactly* like the U.S. Shuttle?

      This site has more then enough info about the Buran (http://k26.com/buran/)

  17. Build a goddamn S�nger-type launcher! by flowerp · · Score: 3, Interesting


    A German concept, AFAIK. Way more reusable than anything NASA has come up with ... 8-)

    The days of vertical launches are over.

    --
    --- Eat my sig.
    1. Re:Build a goddamn S�nger-type launcher! by Anonymous Coward · · Score: 0

      And how do you propose NASA gets over their chronic case of NIH syndrome?

    2. Re:Build a goddamn S�nger-type launcher! by Decimal · · Score: 2

      A German concept, AFAIK. Way more reusable than anything NASA has come up with ... 8-)

      Nah. I say we just make a giant slingshot.

      --

      Remember "Bring 'em on"? *sigh
  18. Multi-stage Launch by jchawk · · Score: 5, Informative

    This article is light on details but does mention that all of these systems that they are working on are two-staged.

    At first you may think that two-staged launches are a waste of money, but some of it does at least look promising.

    The design from Boeing is an interesting one. It looks like a smaller shuttle attached to a jumbo jet. It's then flown near the limits of space where the top ship would then come apart and finish it's journey into space on it's own.

    The jumbo jet would then return to the launch site.

    I must admit that I would love to see a 1 stage space craft. :-)

    1. Re:Multi-stage Launch by paganizer · · Score: 1

      Ahh, Clipper Graham, how I miss yee... I may be getting a bit cynical, but I just don't believe NASA will ever assist in the devlopment of something that will make them obsolete, like a truly inexpensive, safe 1-stage reusable spacecraft. Common, Mr. Gates! actually do something for mankind! put the resources of your evil empire behind this problem! Just PLEASE don't run the flight control computers with XP.

      --
      Why, yes, I AM a Pagan Libertarian.
    2. Re:Multi-stage Launch by Anonymous Coward · · Score: 0

      There's a book that was put out about a decade or so ago with about 20 some years worth of alternate shuttle designs from General Dynamics, Boeing, McDonald Douglas, etc. that were considered, but never implemented.

      Lots of cool diagrams, from catamaran-style winged boosters to a Shuttle-C variant without a crew compartment, designed solely for launching cargo. I can't remember the name, but if you do a search on the shuttle you should be able to find it.

    3. Re:Multi-stage Launch by Moofie · · Score: 1

      Reusable single-stage launchers will not be cheap unless and until we get an order-of-magnitude increase in the efficiency of the engines. I would wager that with chemical rockets, this will not be feasible.

      Cheap, one-shot boosters, designed for low cost rather than reusability, are the best way to do heavy-lift into space.

      --
      Why yes, I AM a rocket scientist!
    4. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 4, Insightful

      Unfortunately given our current level of rocket propulsion technology a single-stage-to-orbit (SSTO) isn't terribly practical. They made some prototypes and actually flew a scaled down prototype in the desert, but ultimately they had tremendous problems with the extremely high performance rocket engine they had to use, couple with the experimental composite cryogenic fuel tanks.

      I honestly don't think we'll ever get SSTO going with conventional chemical propellants. You simple have to carry too much weight in fuel, which means you need a bigger rocket, which means more fuel, then a bigger rocket...you get the idea. What we need is a way to extract more energy from whatever fuel we use. One way to do that is to go nuclear.

      Nuclear rockets have been proposed in the past and always shot down by the enviro-Nazi, anti-nuke crowd. Seems you can't split an atom these days without attracting a lot of attention from this fringe crowd that cringes at the very word "neutron". Yes, nuclear technology CAN be dangerous. So can a lot of other things. NASA has an enviably safety record given the hazardous work they do, and I have no doubt that if the nuclear engine project were ever to become reality it would be a paragon of safety.

      Of course, there could always be something flying out of left field here like some sort of teleportation technology or anti-gravity, but I doubt it in my lifetime.

      And if we ever get REALLY serious about getting off this planet, the ONLY way to fly would be a space elevator. A monumental engineering task to be sure, but once in place it'd be the cheapest ride into low Earth orbit that we could come up with.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    5. Re:Multi-stage Launch by rgmoore · · Score: 4, Insightful
      Nuclear rockets have been proposed in the past and always shot down by the enviro-Nazi, anti-nuke crowd.

      You do realize that opposition to nuclear propulsion comes from rational concerns about its safety as well as irrational hatred of everything nuclear, don't you? I don't have particular problems with nuclear energy in general, but I have serious reservations about any flying nuclear system. A nuclear powered spacecraft is not like the radiothermal generators that have been used in spacecraft so far. It would require a large amount of quite hot material, so any accident could spread a lot of radiactive contamination over a very wide area. I'd want to be damn sure that there were adequate safeguards against that before signing off on such a thing.

      --

      There's no point in questioning authority if you aren't going to listen to the answers.

    6. Re:Multi-stage Launch by AJWM · · Score: 4, Informative

      If you really are a rocket scientist, as your sig states, then you should know that "efficiency of the engines" (I assume you mean Isp) has damn near bugger all to do with it.

      Ion engines are wonderfully efficient in converting mass to thrust, but they won't get you off the ground. The key issue for launch vehicles is the ratio of total impulse (ie, thrust x time) to system weight, where the system weight is not just the propellant mass but also that of the tanks to hold the propellant (this is where LH2 loses out, too bulky), the engines, thermal shielding, etc.

      At least you qualified with reusable single-stage launchers. Several simple thought experiments using existing technology provide examples of workable (but not necessarily reusable) SSTO vehicles. E.g. a Shuttle External Tank with six SSMEs. Or a Saturn-II stage (with the bulkhead moved for the different mix ratio) with the 5 J2's replaced with an SSME.

      Of course those are both LH2/LOX examples -- high Isp on the engine but crappy structural weights because of the size of the hydrogen tanks. Convert the engines to something like a LCH4/LOX (liquid methane/lox) cycle (easily do-able with RL-10s, probably require a massive redesign of something like SSME) and you lose some seconds of Isp but gain back because the CH4 is so much denser than LH2 that the tankage is much smaller.

      Cheap, one-shot boosters, designed for low cost rather than reusability

      This sounds good, but the problem is that, unless they are way overengineered (ie heavy) or you're willing to accept a few blow-ups, "cheap" and "one-shot" are mutually contradictory since a one-shot is inherently untestable, therefore you have to inspect quality in.

      Max Hunter (rocket scientist, designer of the Delta's daddy, Thor) beat all this to death years ago, didn't anybody listen to him?

      --
      -- Alastair
    7. Re:Multi-stage Launch by gad_zuki! · · Score: 2

      Nuclear rockets have been proposed in the past and always shot down by the enviro-Nazi, anti-nuke crowd.

      Launch fail rates are at what now? 1 in 20? 1 in 30? Contamination isn't just a knee-jerk reaction its a real statistical risk with the liability outweighing the benefits.

      What's wrong with multiple stages anyways? If the next shuttle is going to ride on the wing of a high altitude plane and lauched like a missile then so be it. Aesthetics can wait.

    8. Re:Multi-stage Launch by mpe · · Score: 2

      The design from Boeing is an interesting one. It looks like a smaller shuttle attached to a jumbo jet. It's then flown near the limits of space where the top ship would then come apart and finish it's journey into space on it's own.

      Which is very much like the original design NASA didn't go with in the 1970's.
      Doubt the "Jumbo" would look exactly like a 747 though. Since it would need to be capable of supersonic high altitude flight.

    9. Re:Multi-stage Launch by DarenN · · Score: 1



      Of course you can't go splitting the atom. It'd make the place untidy.

      my apologies to Terry Pratchett, and a big thank you for all those great books.

      --
      Rational thought is the only true freedom
    10. Re:Multi-stage Launch by Anonymous Coward · · Score: 0

      Well, considering that a 747 cruises at >Mach 0.9 today @ 33.000 ft, it's not too far from the goal...

    11. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 4, Interesting

      > Unfortunately given our current level of rocket
      > propulsion technology a single-stage-to-orbit
      > (SSTO) isn't terribly practical. They made some
      > prototypes and actually flew a scaled down
      > prototype in the desert, but ultimately they had
      >tremendous problems with the extremely high
      >performance rocket engine they had to use, couple
      >with the experimental composite cryogenic fuel
      >tanks.

      No. This isn't the case; I was talking to some engineers that worked on the Roton just last weekend. They indicated that they knew of no problem that would have precluded the design from working. The composite cryogenic fuel tank THEY used (as opposed to the X33 debacle) - it worked fine in all testing; including something like 50 pressure cycles IRC.

      >I honestly don't think we'll ever get SSTO going
      >with conventional chemical propellants. You simple
      >have to carry too much weight in fuel, which means
      >you need a bigger rocket, which means more fuel,
      >then a bigger rocket...you get the idea.

      No, the simulations converge- SSTO is definitely possible. I've seen atleast 2 hard and fast designs for SSTO vehicles- the Roton and Mockingbird. The Roton would have carried 3 tonnes to LEO; the Mockingbird design didn't have a payload of any note, but was really tiny (1.5 tonnes), and cheap. I've studied both concepts extensively; they both appear workable.

      The biggest argument against SSTO is that it may be more expensive. TSTO may be cheaper. Still, the argument isn't totally watertight. There's a lot of ground processing for TSTO that SSTO doesn't require and that's going to cost something. Although SSTO designs use more fuel- fuel is cheapest bit of the whole rocket by far.

      >What we need is a way to extract more energy from
      >whatever fuel we use.

      Another thing I saw on the weekend- I was at a presentation by a guy talking about a laser powered launch system. The idea is you take a large bank of lasers and point it at a hydrogen powered launch vehicle, which has a heat exchanger it uses to heat the hydrogen. The ISP is about 600 seconds, which is plenty for reaching orbit. The laser bank was priced at about $1 billion but its dropping at about 30% a year currently- only cheap semiconductor lasers are needed, and they're getting cheaper and cheaper.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    12. Re:Multi-stage Launch by ErikZ · · Score: 1
      Nuclear rockets have been proposed in the past and always shot down by the enviro-Nazi, anti-nuke crowd.


      I'm not one of those people, but I still cringe when I think of a nuclear rocket being managed by a government agency.

      --
      Democrats or Republicans. They are both taking us to the same place and they are not afraid of us anymore.
    13. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 3, Informative

      >performance rocket engine they had to use, couple
      >with the experimental composite cryogenic fuel
      >tanks.

      No. This isn't the case; I was talking to some engineers that worked on the Roton just last weekend. They indicated that they knew of no problem that would have precluded the design from working. The composite cryogenic fuel tank THEY used (as opposed to the X33 debacle) - it worked fine in all testing; including something like 50 pressure cycles IRC.


      It's good to hear that someone's worked on the problem a bit. Still, I'm sure it's quite expensive.


      >you need a bigger rocket, which means more fuel,
      >then a bigger rocket...you get the idea.

      No, the simulations converge- SSTO is definitely possible. I've seen atleast 2 hard and fast designs for SSTO vehicles- the Roton and Mockingbird. The Roton would have carried 3 tonnes to LEO; the Mockingbird design didn't have a payload of any note, but was really tiny (1.5 tonnes), and cheap. I've studied both concepts extensively; they both appear workable.


      I will point out that the payload capacity you're speaking of is about a tenth of what one Saturn V can hurl into LEO. It's like comparing an old big-block V8 with a 4 barrel carb versus a high-winding multicam, turbocharged, intercooled 4 cylinder engine. Both will make gobs of horsepower, but the latter is going to be much more expensive than the former AND generally more prone to failure. The Shuttle main engines are a case in point with their trouble-prone turbopumps. The J5 engines on the Saturn only had to work once, thus were much cheaper AND more reliable.


      >What we need is a way to extract more energy from
      >whatever fuel we use.

      Another thing I saw on the weekend- I was at a presentation by a guy talking about a laser powered launch system. The idea is you take a large bank of lasers and point it at a hydrogen powered launch vehicle, which has a heat exchanger it uses to heat the hydrogen. The ISP is about 600 seconds, which is plenty for reaching orbit. The laser bank was priced at about $1 billion but its dropping at about 30% a year currently- only cheap semiconductor lasers are needed, and they're getting cheaper and cheaper.


      I've seen this concept demonstrated with computer simulations, but I'm still skeptical of it. Ground based lasers will always be subject to thermal blooming due to atmospheric attenuation. By the time you're 50 miles up, that's got to be a tremendous power loss, meaning you'd have to have incredibly powerful lasers chewing up gobs of power. You'd need a nuclear power plant on site just to power the darn thing most likely.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    14. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      It can be a knee-jerk response when you consider it's possible to design a nuclear engine that is (a) extremely safe to operate and (b) very damage resistant. Take a look at the types of containers they use to ship spent fuel rods from nuke plants to storage areas. They burn them, soak them, hit them with trains and planes, and even detonate explosives next to them. They survive.

      Ever been on a nuclear submarine? The pressure vessel is incredibly strong. Torpedo hits, mines, implosion, seawater corrosion...the pressure vessel is designed to withstand all that. Sure, that makes it heavier and more expensive, but a nuclear rocket engine would have to take this into consideration. The specific impluse of such an engine would be of so much greater power and efficiency than any chemical rocket that the weight gains would be made negligible.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    15. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      Rational concerns of nuclear safety can be addressed by rational safety measures. Where the irrational come into play is those that will not be placated by any safety measure, no matter how comprehensive or effective. Those are the people I was referring to. There aren't that many of them, but those few are incredibly vocal.

      Yes, the engines would be quite different from the nuclear thermoelectric devices we've already orbitted, but the safety measures would not be. The casks containing the hot material are subjected to absolutely insane tests (burned, blown up, impacted, submerged, simulated re-entry) to prove that they won't spill material, and to date none of them have despite a wide range of circumstances.

      I believe that it is possible to design an engine such that all possible rational safety measures are taken. I just think that the knee-jerk crowd will NEVER be satisfied as long as the word "nuclear" is mentioned. People have been too conditioned to be afraid of that word. More's the pity.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    16. Re:Multi-stage Launch by Moofie · · Score: 3, Informative

      You're absolutely right, I was using some verbal shorthand right there. I was really considering the specific thrust, the thrust per unit mass. Lighter engines which require less reaction mass are more "efficient" in the context I was using it. Aerospike engines might be incrementally more "efficient" than SSME's, but I don't think they're better enough to give really inexpensive SSTO travel.

      There are two contentions that I'm making.

      1) SSTO doesn't make sense, because you have to schlep a lot of dead weight into orbit with you. Once the fuel tank is empty, it's just drag and extra mass. Pitch it.

      2) Reusable hasn't yet made sense, because it's almost less expensive to build a new one than to re-certify one for flight (where "one" is "whatever launch system we're discussing"). It may be that in the future, we'll have engineering technology such that we can re-certify the spacecraft with less intrusive inspections, but I don't think that the expense of that process is warranted, particularly for a system that's just for throwing big stuff into orbit.

      Your point is well taken. Manned vs. unmanned shots require very different engineering constraints. I think it's unfortunate that NASA seems to be totally hell-bent on making one system that does both things well. And you're right, a large payload return module would be a useful thing to have in the inventory. But there's no reason to take it up there every time you launch.

      --
      Why yes, I AM a rocket scientist!
    17. Re:Multi-stage Launch by royalblue_tom · · Score: 1

      Is their sub-contractor Drax Industries ;)

    18. Re:Multi-stage Launch by angel'o'sphere · · Score: 2


      Nuclear rockets have been proposed in the past and always shot down by the enviro-Nazi, anti-nuke crowd. Seems you can't split an atom these days without attracting a lot of attention from this fringe crowd that cringes at the very word "neutron". Yes, nuclear technology CAN be dangerous. So can a lot of other things. NASA has an enviably safety record given the hazardous work they do, and I have no doubt that if the nuclear engine project were ever to become reality it would be a paragon of safety.


      Well, I'm just a poor german and probably should shut up. (Nazi, far away from USA, European btw ... and such)

      IIRC, the Challanger desaster was in Florida?
      The sunny state of the US. A lot of retired people spend the evening of their lives there, right?

      What do you think what it would cost to clean up after a lifter with nuclear power crashed in a state like Florida?

      What would you think what it even costs if there is no such crash but the people there just dislike the propability of a crash and move away?

      Probably you should first do your homework and check how a nuclear rocket engine is supposed to work.

      It works by piping the fuel through the nuclear reactor core. Heating it up. Contaminating it. Ejecting it yielding thrust.

      Something you definitly do not want to do on a lauch pad.

      Probably for space crafts send to other planets, but for that we allready have ion drives (for probes) and plasma drives(for manned missions).

      Both are more reliable, cheaper and use less fuel. And have a furhter benefit: they can nearly accelerate over the whole journey.

      So, as you can not use it on a launch pad, you need a furhter chemical stage.

      The chemical stage should lauch a nuclear reactor core, and a vehicel into a height of lets say 20,000 to 30,000 feet. There you split stages and use a nuclear powered stage to go .... how far?

      LEO? You carry a full nuclear power plant into LEO using a chemical booster to lauch? Sounds ratehr expensive.

      I asume you like to have a returnable vehicle in LEO, so you like to shelter the nuclear core on a way that it survives a reentrance crash?

      Ok, so you do not use nuclear power for a LEO trip, but for what trip you then use it?

      Regards,
      angel'o'sphere

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
    19. Re:Multi-stage Launch by angel'o'sphere · · Score: 2

      Well,

      posted that allready some lines up:

      Take a look at the types of containers they use to ship spent fuel rods from nuke plants to storage areas. They burn them, soak them, hit them with trains and planes, and even detonate explosives next to them. They survive.

      A nuclear powered engine workes like this:

      a) make an ordinary fission core
      b) this one you can make as secure as you state above ...
      c) drill a small hole into it at the top
      d) connect that hole to teh fuel tank
      e) drill a BIG hole at the end into the reactor
      f) connect that big hole to the thrusters

      So?

      You get it now?

      How do you apply your idea of save(burn them, soak them, hit them with trains .... etc.) to a thing wich is BY DESIGN open at both ends?

      BTW: your statement about nuclear submarines is wrong.
      A mine hit or topedo hit and the nuclear power plant is open. Sea water corrosion is only tight for 30 years (wishfull). However the crew will have differnt problems and the owner of the sub also, if it get hit by a mine/torpedo.

      but a nuclear rocket engine would have to take this into consideration.

      Well, as I pointed out in a) to f), it CAN'T.

      Regards,
      angel'o'sphere

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
    20. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2

      >I will point out that the payload capacity you're speaking of is about a tenth of what one Saturn V
      >can hurl into LEO.

      Yeah. So? The cost per kg is 1/10 of the Space Shuttle. Cost per kg is a pretty reasonable metric. So you go there and back 10x and assemble on orbit.

      >Ground based lasers will always be subject to thermal blooming due to atmospheric attenuation.

      Interesting. Is this caused by the lasers or just natural artifacts of the atmosphere? Incidentally power is the cheap bit in the equation, and you need less of it delivered at altitude due to g-limiting anyway; so it may not matter.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    21. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2

      >It's good to hear that someone's worked on the problem a bit. Still, I'm sure it's quite expensive.

      A little. Actually the X33 architects blew this one. The hypothetical story I heard goes:

      We want a lightweight cryo tank!

      Ok, no problem! We've got these aluminum tanks. It's gonna cost a little.

      No, we need it to be composite!

      Ok, you must like pain! It'll cost more! So it's axially symmetric of course?

      No, its a funny kidney shape!

      Ok, you must *really* like pain. It's gonna really really cost you!

      (The Roton tank was axially symmetric of course.)

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    22. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2

      >1) SSTO doesn't make sense, because you have to schlep a lot of dead weight into orbit with you.
      >Once the fuel tank is empty, it's just drag and extra mass. Pitch it.

      True if the vehicle isn't reusable. Otherwise, you a) need another tank b) you need to pay a wrench monkey to slap a new one back on c) the detach mechanism can go wrong (then what?) d) the extra mass mostly just costs you fuel- but fuel is dirt cheap compared to the tank. (The space shuttle main tank costs what? $100 million?) These may well be carbon fiber wound tanks... they aren't cheap.

      >2) Reusable hasn't yet made sense, because it's almost less expensive to build a new one than to
      >re-certify one for flight

      Yes. Although a datapoint of one (skipping over Buran, since it wasn't reused) isn't enough to draw a graph, so we don't know whether this is generally true of reusable launcher designs.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    23. Re:Multi-stage Launch by Moofie · · Score: 1

      Fuel is dirt cheap, but handling the fuel and storing the fuel and using the fuel to launch the fuel to launch the fuel to launch the fuel is not cheap.

      The extra mass does not cost you fuel. The extra mass costs you PAYLOAD.

      And the fact that there's only one datapoint is the reason I made the qualifier "hasn't yet made sense". I look forward to being proved wrong, but I've got a nickel that says it won't happen soon.

      --
      Why yes, I AM a rocket scientist!
    24. Re:Multi-stage Launch by Christopher+Thomas · · Score: 2

      Yes, the engines would be quite different from the nuclear thermoelectric devices we've already orbitted, but the safety measures would not be. The casks containing the hot material are subjected to absolutely insane tests (burned, blown up, impacted, submerged, simulated re-entry) to prove that they won't spill material, and to date none of them have despite a wide range of circumstances.

      You do realize that any NERVA-style engine that can get enough thrust to carry a craft from surface to orbit works by passing exhaust over bare fuel grains, right? (You increase weight and slow down heat transfer too much by putting a thick barrier in between - see Newton's laws of heating and cooling.)

      How exactly do you propose to prevent a) fuel grains from being eroded, sending radioactive material into the exhaust stream (as was a known side effect of the only beast of this type that flew), or containment failure in event of a crash, given that there *have* to be open ports for your exhaust to flow in and out of?

      RTEGs have the wonderful advantage of being able to completely enclose the radioactive materials. Groud-to-orbit nuclear rockets can't.

    25. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2

      > Fuel is dirt cheap, but handling the fuel and storing the fuel and using the fuel to launch the
      >fuel to launch the fuel to launch the fuel is not cheap.

      There's some truth to this- but for dense fuels such as kerosine/lox or kerosine/HTP the handling issues are not too great; and the higher thrust levels allow you to lose the fuel lower down, which minimises the gravity losses.

      >The extra mass does not cost you fuel. The extra mass costs you PAYLOAD.

      Well, if you keep the same vehicle mass but if you don't it's much more debatable; and why would different vehicle designs have the same mass? Does it cost you payload for the same price?

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    26. Re:Multi-stage Launch by Moofie · · Score: 2

      I believe that incremental improvements in chemical rockets are not going to yield sufficient improvements. We need to work hard on alternatives. First: Aerospike engines. Second: Laser and/or mag-lev assistance. Third: Skyhooks.

      There's a theoretical minimum weight and size that a fuel tank must have in order to safely contain the unused fuel, and then to support the thrust of the engines when empty. If you drop those tanks, you can better optimize your acceleration profile.

      I'm tired of jacking around in LEO, and that's all we'll do until we start thinking hard about advancing our technological threshhold. Unfortunately, NASA has a vested interest in making sure that doesn't happen.

      --
      Why yes, I AM a rocket scientist!
    27. Re:Multi-stage Launch by juhaz · · Score: 1

      Well, cheap orbital vehicles might make NASA obsolote for near earth operations, but if they could then put all their resources into deep space stuff, they would be far from obsolote overall, and maybe even get something real DONE instead of playing delivery boys for satellites, which is a job that should be left for private companies.

    28. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 3, Interesting

      Yeah. So? The cost per kg is 1/10 of the Space Shuttle. Cost per kg is a pretty reasonable metric. So you go there and back 10x and assemble on orbit.


      Yeah. So? The S-V cost per kg was 1/10 that of the shuttle to begin with! The shuttle is NOT cheaper than the 60's era moon rockets -- not by a LONG shot. All that throwaway booster work was actually easier to deal with than the constant launch-inspect-refit-launch cycle that the shuttle goes through. Go look up NASA's data on the subject. It's all there.


      >Ground based lasers will always be subject to thermal blooming due to atmospheric attenuation.

      Interesting. Is this caused by the lasers or just natural artifacts of the atmosphere? Incidentally power is the cheap bit in the equation, and you need less of it delivered at altitude due to g-limiting anyway; so it may not matter.


      It's a natural effect of firing a laser through something other than a vacuum. The air molecules, water molecules, and even airborne dust all absorb and/or scatter the beam. Add to that the fact that a spacecraft isn't going to go straight up into orbit, it's going to follow a slanting path that could have a laser firing through 100-200 miles of atmosphere before it even touches the spacecraft, and THEN it actually has to still have enough energy to propell the craft. This is a HUGE problem that simply cannot be gotten around by anything other than brute forcing the laser output. Even adaptive optics will only get you so far. The power requirements would be orders of magnitude beyond anything even on the drawing board today, and the cost would be appropriately astronomical.

      And let's not forget that if you had a ground based laser that powerful, it'd make a nifty weapon for zapping LEO satellites and space stations. I'm sure there's some hyper-concerned pacifists out there that would have an absolute conniption fit over such a thing.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    29. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      Who said anything about using NERVA-style rockets for atmospheric flight? I certainly didn't.

      Obviously a NERVA-style rocket would be totally implausible for the reasons you describe. There are other ways, of course. One example had the fuel grains encased in a ceramic materials that was very heat efficient but constrained any radioactive debris from escaping the reaction chamber. There's also the possibility of using some sort of gas or liquid sodium heat exchange system to heat an inert propellant to use as thrust. There are a lot of possibilities beyond what has already been suggested, which is why I brought the point up in the first place. Scientists need to be thinking about this type of propulsion, not sidestepping it because of some absurd nuclear stigma.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    30. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2


      but a nuclear rocket engine would have to take this into consideration.

      Well, as I pointed out in a) to f), it CAN'T.

      Regards,
      angel'o'sphere


      Which points out little other than your ignorance of the subject. As I described in a post elsewhere on this subject, there are alternative means of using nuclear energy to propell a spacecraft other than the open chamber you suggest.

      If you'd bother to do a little research you'd discover that ideas have surfaced about encasing the fission elements in ceramic to keep any radioactive debris in the reaction chamber. There is also the possibility of using a heat exchange loop to transfer heat from the fission core into an inert propellant that can be used for thrust. In both cases the radioactivity is contained within the system, not expelled And these are just two examples -- there are more, and all take environmental contamination into acount. Yes, they sacrifice a great deal of efficiency and weight advantage, but it's a necessity if it's ever to be used in the atmosphere.

      And you're wrong about the sub reactors, by the way. You're talking to someone who's actually spent time in the military around these things, so I doubt your viewpoint is as clear as mine on this. The pressure vessel is designed to withstand the complete and total destruction of the submarine by any known or projected weapon system, and THEN they add a margin onto that. Short of an internal meltdown, there's nothing out there likely to rupture the pressure vessel.

      So, to coin your little phrase, "You get it now?". Try being a little less condescending when you obviously don't know as much about the subject as you claim.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    31. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      While I have no great love for government management, they do have one advantage that no private company could ever have: gov't agencies never have to show a profit. If safety costs are ridiculous, there are no stockholders to answer to, no bankers, no anything. They just sign the check. It's horrifically wasteful, and it's my damn tax dollars, but I'd rather SAFETY money be spent by an organization that has few reasons to pinch pennies.

      Of course, there are ethical and honorable corps. out there that would not be inclined to scrimp on something like, oh, say, O-rings, but they never seem to get the big contracts.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    32. Re:Multi-stage Launch by X43B · · Score: 1

      "instead of playing delivery boys for satellites, which is a job that should be left for private companies" ------ The Space Shuttle hasn't been used to carry "satellites" for commercial use since the Challenger explosion. I put satellites in quotes because it is true than anything that doesn't leave earth orbit can be considered a satellite. Therefore,although scientific missions such as Hubble are satellites, these are not simple, straight out the box commercial satellites. Given the fact that nearly every mission involves projects that have never been done before, it is not too much to ask to require in orbit human intervention. If you think the Shuttle is expensive, how much it would cost to fix the Hubble telescope autonomously?

    33. Re:Multi-stage Launch by Christopher+Thomas · · Score: 2

      Obviously a NERVA-style rocket would be totally implausible for the reasons you describe. There are other ways, of course. One example had the fuel grains encased in a ceramic materials that was very heat efficient but constrained any radioactive debris from escaping the reaction chamber. There's also the possibility of using some sort of gas or liquid sodium heat exchange system to heat an inert propellant to use as thrust.

      The problem is that both of these methods decrease heat conduction and increase weight enough to make the usefulness of a nuclear drive very questionable. This was touched on in my previous post.

    34. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2
      It's a natural effect of firing a laser through something other than a vacuum. The air molecules, water molecules, and even airborne dust all absorb and/or scatter the beam.

      Sure. So you need more power.

      Add to that the fact that a spacecraft isn't going to go straight up into orbit, it's going to follow a slanting path that could have a laser firing through 100-200 miles of atmosphere before it even touches the spacecraft, and THEN it actually has to still have enough energy to propell the craft. This is a HUGE problem that simply cannot be gotten around by anything other than brute forcing the laser output.

      Sure so add more power.

      Even adaptive optics will only get you so far. The power requirements would be orders of magnitude beyond anything even on the drawing board today, and the cost would be appropriately astronomical.

      Nah. Semiconductor lasers cost about $10/w right now, and dropping about 30% a day. The optics aren't, but you can get quite a few lasers per optics, so I think the lasers dominate. That means for 100 Mw you are talking about $1 billion. But this compares not unfavourably with the cost of 2 space shuttles; and the actual vehicles can have few moving parts.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    35. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2

      "dropping about 30% a day" - better make that 30% a year... ;-)

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    36. Re:Multi-stage Launch by thogard · · Score: 1

      Mach 1.0 is a long way away from mach .9

    37. Re:Multi-stage Launch by angel'o'sphere · · Score: 2


      If you'd bother to do a little research you'd discover that ideas have surfaced about encasing the fission elements in ceramic to keep any radioactive debris in the reaction chamber. There is also the possibility of using a heat exchange loop to transfer heat from the fission core into an inert propellant that can be used for thrust. In both cases the radioactivity is contained within the system, not expelled And these are just two examples -- there are more, and all take environmental contamination into acount. Yes, they sacrifice a great deal of efficiency and weight advantage, but it's a necessity if it's ever to be used in the atmosphere.


      As far as I know that design is not useable for launching from from the surface as the efficiency is far to low.

      You can use it in space, but for that alternatives, exist.


      And you're wrong about the sub reactors, by the way. You're talking to someone who's actually spent time in the military around these things, so I doubt your viewpoint is as clear as mine on this. The pressure vessel is designed to withstand the complete and total destruction of the submarine by any known or projected weapon system, and THEN they add a margin onto that. Short of an internal meltdown, there's nothing out there likely to rupture the pressure vessel.


      Sorry. I dissagree.

      Most torpedos used on naval combat, agains a sub especialy or a carrier fleet are: nuked torpedos.

      You little sub does no longer exist after a full hit and its flattend like a piece of paper if its in a 10km range of the torpedos ignition. (yes I know this is an unfair point, but you said: *nothing* can break it)

      I realy doubt that a navy sub reactor containment can stand a rocket torpedo like that one which sunk the Kursk.

      I doubt it can stand a simple ice berg. After all it is only metal isn't it? Supose you slice your side on an ice berg, I could imagine it just cuts through the containment.

      I also doubt that a standard anti carrier torpedo, which could be used against a sub if it is not diving, will leave anything intact.

      Such a torp would lift a sub aproximately 50 meters into the air through its blast. Its just a question where it hits and your reactor is open.

      Finaly: in the north atlantic is a sunken navy sub. Its regulary visited by Norway scientists. That sub leakes plutonium. So much to your claim.

      Regards,
      angel'o'sphere

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
    38. Re:Multi-stage Launch by gorilla · · Score: 2

      There is a difference between "it's possible" and "it's possible for a top down bureaucracy where the top level bureacrats have no idea of the engineering and more interested in their political careers"

    39. Re:Multi-stage Launch by juhaz · · Score: 1

      And who the hell has been talking about doing anything autonomoysly? Give the shuttle, or preferably something like the thousand times cheaper alternative being developed, which is what this article is about, to the private companies, let _THEM_ do all Earth orbit work, be it scientific or commercial and redirect all the money that is poured into that now into solar system exploration.

      Yeah, it's not going to happen today, or tomorrow, but it should be a long term goal. Should've been years ago.

    40. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2


      Sorry. I dissagree.

      Most torpedos used on naval combat, agains a sub especialy or a carrier fleet are: nuked torpedos.


      Sorry, I disagree. No navy currently fields sub-launched nuclear torpedos. Nuclear mines, nuclear depth charges perhaps, but not nuclear torpedos. Semantics, yes, but we wish to be accurate here.


      You little sub does no longer exist after a full hit and its flattend like a piece of paper if its in a 10km range of the torpedos ignition. (yes I know this is an unfair point, but you said: *nothing* can break it)


      Granted, I should've said no conventional weapon can destroy it, but I was expecting a little rationality and reality from you on this point, not quibbling. Of course a nuclear weapon would rupture it. Bravo! You've proven that absurd extremes make almost anything true or false. The point was this: nothing that is likely to happen is going to pierce a nuclear reactor pressure vessel, and a nuclear rocket designed to the same specs will be, for all practical purposes, just as indestructible.


      I realy doubt that a navy sub reactor containment can stand a rocket torpedo like that one which sunk the Kursk.

      Yes, it could, precisely because the rocket torpedos don't NEED that much power to destroy a submarine. Gross overkill is just that -- gross. All a torpedo (or mine, or depth charge for that matter) has to do is open the hull somehow. That will most likely sink the sub, accomplishing the mission of the weapon. Going the extra mile and trying to destroy the pressure vessel would be silly, useless, and result in a weapon that is too large, too expensive, and too dangerous to use near other friendly forces. Nuclear weapons used underwater are used for area destruction via the water hammer effect. The end result is the steel (or titanium in some cases) hull is collapsed by the pressure wave. In all simulations where the submarine was outside the fireball of the nuclear weapon, the pressure vessel remained intact even though the hull was effectively pancaked.


      I doubt it can stand a simple ice berg. After all it is only metal isn't it? Supose you slice your side on an ice berg, I could imagine it just cuts through the containment.


      Ah! Now your total ignorance of underwater nuclear propulsion comes to the fore! Sure did take you long enough. No, it is NOT merely metal. Pressure vessels are complex layers of many different metals, composites, and other solids (in some cases, even concrete). Ramming into an iceberg would pose no threat to the reactor (especially since a sub would have to ram one SIDEWAYS to even get a berg NEAR the reactor compartment). Ramming into another ship would not breach it. Sinking to the bottom of the deepest ocean trench would not crush it. You must remember that the vessel is designed to contain a nuclear reaction, no small feat. They are designed to be strong to begin with, and militarizing them only makes them stronger.



      I also doubt that a standard anti carrier torpedo, which could be used against a sub if it is not diving, will leave anything intact.

      I hate to break it to you but you're wrong. Go look up Janes Fighting Ships and you'll see.


      Such a torp would lift a sub aproximately 50 meters into the air through its blast. Its just a question where it hits and your reactor is open.

      50 meters? My, what a precise figure. You came to that conclusion after carefully considering the warhead yield, the depth of our hypothetical sub, the weight of the sub, it's speed and course, and about a thousand other variables that would influence such a statement...right? Oh, you didn't, did you? If you had, you'd have realized that your statement is not only wrong, it's stupid. Lifting a submarine 50 meters "into the air" as you say is not practical or possible with conventional antisub munitions. Nor is it necessary, due to the overkill described above.


      Finaly: in the north atlantic is a sunken navy sub. Its regulary visited by Norway scientists. That sub leakes plutonium. So much to your claim.


      So much for your argument, logic, or even sense. The sub is NOT leaking plutonium as you state, it is leaking radiation, something totally different. Plutonium is phyrophoric. Since you're obviously mentally deficient, I'll explain that pyrophoric means the substance spontaneously ignites outside of a containment vessel. If it were leaking plutonium it would be exploding. That would kind of make your Norwegian scientists a bit short lived, wouldn't you think? Oh, I forget, you aren't into that whole "thinking" thing.

      No, it is leaking radiation. Reactors are complex devices and many, many parts of them contain radiation -- the cooling loops, for example. Extreme damage to the reactor compartment would no doubt shred all interconnects and penetrations of the reactor vessel (but NOT the vessel itself) allowing "hot" coolant to seep out. If the reactor had been subject to a meltdown then PERHAPS radioactive debris could be flushed from the vessel, but the vessel itself would STILL be intact.

      It's been mildly entertaining to educate you out of your self-imposed ignorance, but poking idiots with a stick can only hold my attention for so long. Do both of us a favor and don't bother replying until you've actually done a little reading on the engineering of nuclear reactor pressure vessels. You'll come of sounding less like some illiterate child and it'll be actually mentally engaging for me, for a change.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    41. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      Oh, the humanity. Please, please PLEASE do a little research before embarking on a debate about a subject which you don't seem all that informed about. Semiconductor lasers are not in the same class of power production as what would be needed for a laser-based propulsion system. A semiconductor laser might be great for a laser pointer or a DVD-ROM reader, but pushing megawatts or gigawatts of power is NOT what they do well. You need something more akin to a chemical reaction laser to generate this kind of power. Do a lookup on the EXCIMER laser to see what you'd need in order to make this project a reality.

      And while we're on the subject, your little "so, just add more power" neatly sidesteps any logic or economic common sense. Power costs MONEY, and with the type of power you'd need, it may well outrun the cost of the hardware. This cost would be repeated FOR EVERY LAUNCH. And somehow I get the feeling that you are simply ignorant of just how much power would be needed here (hint: 100MW is off by at least an order of magnitude). Your comparison to shuttle costs ignores the fact that even though a shuttle costs $1bn, upkeep of the shuttle costs more than that.

      Take some time, cool down, and try to research a subject before jumping to conclusions and making outrageous, silly statements. You're coming across as someone who's doing a lot of talking and very little thinking.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    42. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2
      Oh boy! Fresh meat ;-)

      Where to begin the flaying ;-)

      Oh, the humanity. Please, please PLEASE do a little research before embarking on a debate about a subject which you don't seem all that informed about. Semiconductor lasers are not in the same class of power production as what would be needed for a laser-based propulsion system. A semiconductor laser might be great for a laser pointer or a DVD-ROM reader, but pushing megawatts or gigawatts of power is NOT what they do well. You need something more akin to a chemical reaction laser to generate this kind of power. Do a lookup on the EXCIMER laser to see what you'd need in order to make this project a reality.

      Really? No. That's what you need if you want one big laser beam. We don't want that. In fact the atmospheric effects would be very detrimental- the beam would scatter horribly.

      This concept is thousands of semiconductors all pointing in parallel through a single telescope at the vehicle; and then having, say a thousand of these telescopes. (You can play with the numbers, but that's the concept).

      If you do the maths, its gonna come comfortably under a billion.

      Power costs MONEY, and with the type of power you'd need, it may well outrun the cost of the hardware. This cost would be repeated FOR EVERY LAUNCH.

      Gasp! Hadn't thought of that! I feel truly chastened. No truly. Let's see:

      100Mw for 15 minutes. That's 400,000 kwh. 1 Kwh costs $0.01-0.05. That makes: $4000-$20,000 of electricity for ~100kg. This compares favourably with ~$2500+/kg (Russian Proton) that it currently costs to go into space, and very favourably indeed with the Space Shuttle costs. Of course this is only part of the costs, but still.

      hint: 100MW is off by at least an order of magnitude

      The figure I have seen quoted is about 1MW/kg, but it depends a bit on the system you're looking at. Do you have a source for your figure? Still, even if we were out by an order of magnitude on the power (and I don't agree we are; in fact I wonder what you're smoking), then the price would still come in comfortably under $1000/kg depending on the source of power chosen, and the cost of the other components. That's cheaper than all current launchers, and as I tried to explain in other postings; the system scales.

      You're coming across as someone who's doing a lot of talking and very little thinking.

      Do you think so? Oh dear. How sad; still atleast I don't come across sounding all negative.

      p.s. come back when you've investigated the cost per watt of semiconductor lasers power. ($10-50/W- dropping at ~30% per year).

      p.p.s. I work with semiconductor lasers as part of my day job; I understand optics.

      p.p.p.s. this wasn't my idea (I wish), it came from a professional rocket scientist... you know, somebody who actually designs them for a living, for money, for the US government. It is entirely possible there's some flaw; but if so I don't think you've spotted it.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    43. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2
      100Mw for 15 minutes. That's 400,000 kwh. 1 Kwh costs $0.01-0.05. That makes: $4000-$20,000 of electricity for ~100kg.

      Doh! I've multiplied where I should be dividing!

      That's actually $250-1250 for 100kg! Now that's more like it! Feel free to add an extra 0 if you want, if you think it needs 1GW. All it does is raise the initial costs; the per-launch costs are pretty much unaffected as far as I can see; apart from amortising the laser cost.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    44. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      (sigh) this is getting tiring.


      Really? No. That's what you need if you want one big laser beam. We don't want that. In fact the atmospheric effects would be very detrimental- the beam would scatter horribly.


      As I pointed out, this can be corrected with adaptive optics the same way that you can collimate the beam of a few billion laser pointers. The only thing is it's easier to do with fewer lasers (to a point) than billions of them.



      This concept is thousands of semiconductors all pointing in parallel through a single telescope at the vehicle; and then having, say a thousand of these telescopes. (You can play with the numbers, but that's the concept).

      If you do the maths, its gonna come comfortably under a billion.


      So you're just going to mint a couple of billion souped up laser pointers and expect it to propel a spacecraft? Funny how none of the existing researchers are pursuing this. Perhaps it's because it's not feasible. First off, there's the difficulting of collimating a beam created in such a manner, but that can be somewhat compensated for by adaptive optics. Still, you haven't overcome the fact that you'd need obscene numbers of these to generate a beam working in parallel. I would point out the obvious cooling and control difficulties, but I'm sure you've given that LOTS of thought, eh?

      Your idea, while technically possible, is impractical when you can take larger lasers to begin with. While the cost per laser is higher than semiconductor lasers the engineering difficulties are lower. You could shine a few quadrillion flashlights at the bottom of a spacecraft and get some propulsive effect, but again it's not worth it.


      The figure I have seen quoted is about 1MW/kg, but it depends a bit on the system you're looking at. Do you have a source for your figure?


      LLNL has a nice section, and Space.com has a bit on it as well. 150KW propells something that weighs the same as an empty coke can to the edge of the atmosphere, but that's straight up. Anything that intends to stay in orbit for long will have to achieve orbital velocity, which means slant range, which means the laser will be plowing through 4-5 times the amount of atmosphere as a straight shot. You claim to know lasers and optics, so why don't you save me the trouble of debunking this and do the math and see how that would affect beam power. You're going to quintuple your range AND you've got to achieve about 18,000mph while taking atmospheric friction into account (you DID consider all this, right? Nope, doesn't apear so) Huge, isn't it? How many "laser pointers" were you planning to glue together? Keep in mind that your average semi-laser is rated in milliwatts.


      100Mw for 15 minutes. That's 400,000 kwh. 1 Kwh costs $0.01-0.05. That makes: $4000-$20,000 of electricity for ~100kg


      100kg? First off, it seems that you're only counting boosting a payload. Last I heard, satellites don't just fly themselves through the atmosphere, they need a launch vehicle, one sturdy enough to withstand atmospheric flight on the way to orbital velocity. Your total launch weight is going to be much, much higher. And don't forget that USEFUL stuff being lofted is often weighed in tons, not kilos. You wanna loft a cocker spaniel wrapped in aluminum foil, be my guest. Most folks want to loft satellites and space stations. Again, please think about the total solution before jumping to a conclusion.


      Do you think so? Oh dear. How sad; still atleast I don't come across sounding all negative.


      No, you come across as someone who is hopelessly optimistic or ridiculously idealistic. Either way, that's good for dreaming, but we're talking about practical application here and now. It may be possible, but it isn't practical. I'm not being negative here, I'm simply pointing out the flaws in your argument.


      p.s. come back when you've investigated the cost per watt of semiconductor lasers power. ($10-50/W- dropping at ~30% per year).

      Again, the cost of the semi-laser is not the issue. Big lasers cost big money but don't need all the fancy adaptive optics that a multi-billion laser array would need. Then there's power, which you've woefully underestimated by (a) not taking a realistic flight path mission profile into account and (b) not considering a worthwhile payload mass in conjunction with launch vehicle mass. Right now they're using 150KW to launch something that weighs ounces straight up. We need to launch tons, at an angle, at orbital velocities. Your math simply isn't in the same league as this.


      p.p.s. I work with semiconductor lasers as part of my day job; I understand optics.

      From your bent I'd have to guess that you work with semi-lasers on CD-ROM/DVD or some other consumer/professional electronic product. Those are just fine for small scale, short range applications, but massively parallel is an engineering challenge that no one has demonstrated an ability to cost effectively develop. And while you say you understand optics, you have consistently neglected to factor in a variety of optical phenomena that would affect such a laser propulsion system. Either you know a lot but aren't using your knowledge, or you know a little and are stretching beyond your means. If it's the former then you need to apply yourself, not blather. If it's the latter then I'm wasting my time anyway.


      p.p.p.s. this wasn't my idea (I wish), it came from a professional rocket scientist... you know, somebody who actually designs them for a living, for money, for the US government. It is entirely possible there's some flaw; but if so I don't think you've spotted it.


      The flaws are pointed out in stark detail above. Feel free to debunk them, but please take some time and put some thought into it. Shooting down poorly made arguments is easy but time consuming. I'd prefer to spend my time debating with someone who thinks something through before posting it.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    45. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      And since you're so interested in sources, quotes, and figures, try this one on for size, taken from SPACE.COM:


      "Funds are minuscule. They are extremely meager," adds John Cole, NASA's manager of the space transportation research project office at Marshall Space Flight Center.

      "Beamed energy is one of the avenues we've got if we're ever going to get the cost of access to space down," Cole said.

      Cole sees a 21st century where passenger-carrying space vehicles might be powered upward on laser light. That laser would churn out 100 gigawatts of power, he admits.

      "That's 10,000 times bigger than any laser that's been built. But, hey, I'll take whatever works," Cole said.


      Keep in mind that's 100 Gigawatts of power, AND that lasers are not 100% efficient. I've done some cursory web surfing and I've seen efficiency figures in the 30%-50% range for semi-lasers (these could be out of date, but I found about 20 references to figures in this range from a variety of sources). So, to be optimistic, we'd need at least 200GW input to the laser(s). Then we'd have to take into account that whatever's transmitting the power to the laser system has resistive losses, not to mention any step-up or step-down transformer inefficiencies, and then there's the actual efficiency of whatever's actually generating all these gigawatts. I would feel comfortable, even magnanimous, giving a 500GW figure. Per launch. For ease of comparison, let's call that 500,000,000 kilowatts, and assume that it takes 1 hour to completely loft our hypothetical vehicle, from warming things up all the way until turning them off post launch. That's half a billion kilowatt hours.

      Annual electrical production of every nuclear power plant in the United States is around 700 billion KW/hrs for the entire year according to the DoE. That means daily production is about 1.9 billion KW/hrs per day.

      Your proposed laser propulsion system would consume the electrical output of every nuclear reactor in the United States operating at full power for 6 hours.

      For comparison, note (from Boeing's website) that the five F-1 engines equaled 160,000,000 horsepower, about double the amount of potential hydroelectric power that would be available at any given moment if all the moving waters of North America were channeled through turbines. Granted they were lifting an awful lot of fuel with that horsepower (although a lightship would require fuel to manuver in space), but it's a staggering display of the power required to get into orbit. And that was just the first stage of the rocket.

      NOW is it starting to dawn on you how far off the mark you are/were?

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    46. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2
      As I pointed out, this can be corrected with adaptive optics the same way that you can collimate the beam of a few billion laser pointers. The only thing is it's easier to do with fewer lasers (to a point) than billions of them.

      With multiple lasers the heating effects are smaller near to the ground, so it needs less correction, the semiconductor lasers are cheaper and probably more efficient. I also disagree with your characterisation of semiconductor lasers as 'laser pointers'. As you very well know laser pointers are in the 10mw range. These lasers would be nearer to a watt.

      I would point out the obvious cooling and control difficulties

      Yes. So? Having multiple disparate lasers means the power density is lower in fact, and if anything easier to cool.

      150KW propells something that weighs the same as an empty coke can to the edge of the atmosphere, but that's straight up.

      Let's assume that's true (it sounds plausible). That's a coke can which is really light. Air drag losses per kg are inversely proportional to vehicle mass for a given shape. Normally it's reckoned you need 7% of the energy to get to orbital altitude, and the other 93% to get to orbit. I can easily believe that 1Mw/Kg is enough to get you there for reasonable masses.

      Again, the cost of the semi-laser is not the issue. Big lasers cost big money but don't need all the fancy adaptive optics that a multi-billion laser array would need.

      You need 'fancy optics' (whatever that means exactly) whatever you do. I think hundreds of separate lasers are easier than a few big ones- they disturb the air less; but still optics to point at the target vehicle are going to be very necessary; of course!

      Then there's power, which you've not my system! woefully underestimated by (a) not taking a realistic flight path mission profile into account actually I understand there's a special trajectory required- it goes up a long way up to avoid losing the payload over the horizon/losing too much in atmospherics and (b) not considering a worthwhile payload mass in conjunction with launch vehicle mass. Actually the figures I was given were ~500kg vehicle mass, 140kg payload, ~100 MW, hydrogen fuel, ISP 600, with throwaway tanks. There's a heat exchanger in it, and apparently it uses water rather than hydrogen at low altitude to give it enough thrust to actually take off. There probably ARE lots of loose ends, but you've found exactly none of them so far. I betcha (although the presenter never mentioned it) that he used a software simulation including atmospherics and trajectory optimisation features, so those figures are gonna work. I wish I was working on it actually, it sounds really, really interesting.

      From your bent I'd have to guess that you work with semi-lasers on CD-ROM/DVD No. We sell nothing to consumers. Actually, some of our laser equipment blows the ends off connectors; try giving that to consumers. I work in long distance fiber optic telecomms, multiwavelength stuff; people on site are semiconductor laser designers; I have a degree in physics and electronics, and yes I have studied lasers, and orbital mechanics.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    47. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2
      Your proposed laser propulsion system would consume the electrical output of every nuclear reactor in the United States operating at full power for 6 hours.

      Oh, right. So you're taking a quoted figure from somebody else. Where they refer to a completely different system. Which launches a completely different sized payload, with hugely bigger lasers. Then multiplied it by 5 for no sensible reason. And then claimed that I said this, that it applies to the system I outlined???

      You're a total, total asshole, you know that? A real smeghead.

      NOW is it starting to dawn on you how far off the mark you are/were?

      Right. 25MWh is the entire North American output of energy for 6 hours. Yes, its all clear now, you are totally incapable of understanding what you are writing about.

      What colour is the sky in your world? Do you ever visit earth? Are you on drugs? If not, they can't hurt you now, you are seriously demented. You have lost the plot, gone gah-gah, flipped.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    48. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 1

      You're a total, total asshole, you know that? A real smeghead.


      Those who lack the intelligence to reason or debate inevitably choose to attack. I note that you didn't bother to challenge my figures. One is taken to wondering why until you realize that you have no way to challenge these figures -- they are real, come from verifiable sources, and follow sound logical reasoning. If you think they're incorrect then simply point out where. Oh, wait, you can't do that, you're too busy thinking up keen new names to call me.

      When you grow up and feel you can carry on an intelligent discussion without devolving into idiocy then perhaps we can go at this again. In the meantime, use this experience to understand how to lose an argument to your betters. You obviously haven't learned anything else.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
    49. Re:Multi-stage Launch by WolfWithoutAClause · · Score: 2
      In the meantime, use this experience to understand how to lose an argument to your betters.

      You've set a fine example on how to do that.

      You obviously haven't learned anything else.

      It would be good if you actually understood more than the person you are trying to 'teach'...

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    50. Re:Multi-stage Launch by prisoner-of-enigma · · Score: 2

      Again, I'm going to point out that instead of engaging my statistics and figures from public, reputable sources, you're trying to attack me. While I'm sure that's more fun for you (and more rewarding since you've made no progress whatsoever in nullifying my argument), it proves that your incapable of meeting a reasoned, logical debate with anything other than the mental attitude of a 5 year old who's had his feelings hurt. Grow up or get out.

      --
      In the end they will lay their freedom at our feet and say to us, Make us your slaves, but feed us. - Fyodor Dostoyevsky
  19. the usual suspects...defense contractors by Sir+Elton+John · · Score: 5, Interesting
    The companies listed as possible contractors for the new project aren't incredibly surprising. When I met with Lockheed Martin executives a while back as part of a consulting gig that didn't pan out, I asked them a few questions about the industry.

    Now, I am coming from a background where I am not incredibly familiar with either U.S. capitalism or with issues of defense. Basically, there are a handful of these companies that compete for every government contract. To maintain "competition," the government will try to spread the love around, going with different companies for succesive contracts.

    But each individual contract is too big for a single company to fulfill on its own, so whomever ends up winning the contract will turn around and outsource some of the work to...the same "competitors" whose bids they beat out!

    As a retired rocketman, I am the first to support expansion and improvement of any nation's space program. I just wanted to point out that the notion of "who will build the next generation shuttle" should be taken with a grain of salt.

    --
    "I'm a rocket man / Rocket man burning out his fuse up here alone." - Sir Elton John
    1. Re:the usual suspects...defense contractors by CAIMLAS · · Score: 2

      My understanding is that this is not so much to see who will build it, but who will design it. Outsourcing workload is not only commonplace in all industry nowadays, it's expected.

      --
      ~/ssh slashdot.org ssh: connect to host slashdot.org port 22: too many beers
    2. Re:the usual suspects...defense contractors by Arrgh · · Score: 2

      If you truly were Himself, wouldn't you spell it "defence?"

  20. It's about time by Anonymous Coward · · Score: 2, Interesting

    Shouldn't they have been looking into this years ago? The fact that the shuttle is massively expensive compared to rockets isn't very new.

    I find it kinda ironic how they're doing this only a year or two after canceling practically every alternative-launch-system project NASA had (X-33, X-34, and a few others that I can't remember). I'd think it would be cheaper to just finish a few programs at once rather than stop and restart them constantly, as NASA seems to be doing lately.

    1. Re:It's about time by Kris_J · · Score: 2

      I'm a big fan of the X-33 (I have a model on my desk at work and it's my Winamp skin) and I thought GWB was more or less responsible for the cancellation of the X-33, not NASA. Either way, it's a damn shame.

    2. Re:It's about time by Anonymous Coward · · Score: 0

      since when have government contracts been issued with the intention of being cheaper! it's news to me..

    3. Re:It's about time by Anonymous Coward · · Score: 0

      Hmm. It very well could have been Bush. I haven't been paying very close attention to it. All I know is that it got canceled, and I wish it hadn't.

  21. Reminds me of this: by SkyLeach · · Score: 5, Funny

    "Rockhound: You know we're sitting on four million pounds of fuel, one nuclear weapon and a thing that has 270,000 moving parts built by the lowest bidder. Makes you feel good, doesn't it?"

    hehe...

    Fore more quotes from that movie go here

    --
    My $0.02 will always be worth more than your â0.02, so :-p
    1. Re:Reminds me of this: by SkyLeach · · Score: 0, Offtopic

      I had to post the moderations on this:

      Moderation Totals: Offtopic=1, Funny=3, Overrated=1, Underrated=2, Total=7.

      And yet, my Karma went up... 2 points.

      "Math? I don't need no stinkin' math!." - /. coder #218

      --
      My $0.02 will always be worth more than your â0.02, so :-p
    2. Re:Reminds me of this: by Anonymous Coward · · Score: 0

      Under/Over rated don't count toward karma.

  22. I saw by Morgahastu · · Score: 1

    the head of the canadian space agency looking for a space shuttle too. Yeah I seem him often there at "Jim Scean's Used RVs and Trailers"

  23. Druish by Anonymous Coward · · Score: 0

    They should talk to my cousin Murray, down in the Valley. He'll give you a very good deal...

  24. George Bush calls on NASA to put a man on the Sun by Caractacus+Potts · · Score: 3, Funny


    With everything that's been going on lately, you might have missed this important piece of 'news'.
    Anyway, here's the link.

  25. I am still waiting by Morgahastu · · Score: 1

    for NASA to pour all its funds into an over-hyped dot com and then have them go bankrupt so I can buy myself a space shuttle at their bankruptcy auction.

  26. Pics by Anonymous Coward · · Score: 1, Informative

    More pics here. Dig the one with 6 jet engines.

    1. Re:Pics by PMM · · Score: 1, Interesting

      this one?

      yeah its pretty cool looking in a bloated insect kind of way

  27. timothy SUCKS BALLS by Shaklee3 · · Score: -1, Flamebait

    timothy you should realize that NO ONE FUCKING CARES you stupid cocksucker faggot

  28. Kerosene? by Devil's+BSD · · Score: 1

    I understand the space savings advantages of kerosene, but how does the thrust produced per unit weight compare to that of the current SRB/LRB compare? Having to (hypothetically) double the fuel weight to double the thrust seems like a waste of money to me.

    --
    I'm the Devil the Windows users warned you about.
    1. Re:Kerosene? by Waffle+Iron · · Score: 5, Informative
      I understand the space savings advantages of kerosene, but how does the thrust produced per unit weight compare to that of the current SRB/LRB compare? Having to (hypothetically) double the fuel weight to double the thrust seems like a waste of money to me.

      On another article a few weeks back, someone posted an answer that cleared this up for me. (I'm too lazy to track down the posting now.)

      Bottom line is: hydrogen is like a high-horsepower, high-RPM turbo racing engine; it's best for driving light vehicles at high speeds (upper stages). Kerosene is like a high-torque diesel truck engine, good for getting a lot of weight moving from a dead stop.

      The difference has to do with the physics of exhaust density, speed, momentum, etc.

    2. Re:Kerosene? by Anonymous Coward · · Score: 0

      You're probably refering to this post which I enjoyed reading as well.

      Basically those who think they can sort every rocket engine on a thrust/weight scale are naive. There are other issues. This *is* rocket science after all.

    3. Re:Kerosene? by Kalabajoui · · Score: 2

      After what the gas and electric utility companies did last year, I don't blame NASA for sticking it to them by choosing kerosene to heat the shuttle.
      They'll just have to be sure to light it outside so it doesn't stink up the cockpit.

    4. Re:Kerosene? by WolfWithoutAClause · · Score: 2

      > I understand the space savings advantages of kerosene, but how does the thrust produced per unit
      >weight compare to that of the current SRB/LRB compare?

      Atleast one kerosene engine has a thrust to weight ratio of upto 130:1, and all I'm aware of are atleast 100:1. The SSMEs have a thrust to weight ratio of only 70:1. Space Shuttle loses big time ;-) [In fact that's partly why you need the SRBs otherwise it couldn't physically take off- it's too heavy].

      The reason is that hydrogen is seriously not very dense. So all the plumbing in the engine needs to be much bigger diameter to be able to carry the propellent flow to give the thrust. Also the tank gets huge. The extra weight is significant to the vehicle performance- you carry that engine and tank basically all the way to orbit, and it costs... This is partly offset by the greater ISP of the hydrogen, but it's at best neck and neck with hydrogen.

      >Having to (hypothetically) double the fuel weight to double the thrust seems like a waste of money to me.

      Fuel is irrelevant right now. Tanks and engine mass and costs are where its at. Kerosene has a lower ISP and that translates to more mass. But the greater density and the greater thrust means that the gravity losses are less (you don't carry the fuel as high before burning it) means that kerosene/LOX is excellent for a first stage. Saturn V worked this way for a reason. And if you SSTO, then you don't need hydrogen at all.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
  29. Here's an idea... by NewtonsLaw · · Score: 2

    Why not just wait until all those brave entrants in the X-Prize contest have had a go.

    Who knows, mybe that crazy Englishman with his "Thunderbird" rocket made from plywood will astound us all.

    Or not.

  30. NASA's justification for existing by sweatyboatman · · Score: 5, Insightful

    They just want gobs of money to spend on technology development programs (read "new toys").

    American tax dollars are working to make these "new toys". The primary justification for NASA's funding is that the technologies that come out of these "technology development programs" push the cutting edge of modern tech.

    It's been a long time since Congress has thought about the values of "exploring space". That's just an side-effect of research spending.

    It's like those robot-construction competitions where they have to get all the balls into the goal. The contest isn't to designed to solve the great "yellow ball problem", it's to build and explore ideas in technology.

    Congress views funding NASA the same way; by funding NASA they're advancing America's technical know-how. Not to mention that NASA contracts go to high-tech american industries.

    There's not some sort of conspiracy to keep regular people out of space here. NASA's just doing its job.

    Sweat

    --
    It breaks my pluginses, my precious!
    1. Re:NASA's justification for existing by Anonymous Coward · · Score: 0

      the aerospace industry has a strong interest in keeping space launch prohibitively expensive. they win contracts with small gains in efficiency, but the research into radically new drives and vehicles is almost entirely academic. the original poster knows what's up.

    2. Re:NASA's justification for existing by AJWM · · Score: 2

      technologies that come out of these "technology development programs" push the cutting edge of modern tech.

      That may have been true in the Apollo era, and even for a little while after, but it hasn't been the case for years -- at least, not in the launch vehicle category. (I agree that some of the Centers do useful research, but that's a small fraction NASA's budget compared to what gets eaten by Houston, the Cape, etc.)

      If you want "spin off technologies", you get a much better pay off by focusing on those, not on wasting the money pretending you're spending it on innovative launch vehicle design. (The X-33 project is a classic example, with that thoroughly stupid oddly shaped composite propellant tank that couldn't stand up to internal pressures (because of the odd shape) without reinforcing it so much that it was heavier than a metal tank would have been. Among other design stupidities, like VTOHL, which means you have to design for perpendicular load paths, and have no safe abort mode immediately after launch.)

      As for "not some sort of conspiracy to keep regular people out of space" -- they tried pretty damn hard to keep Tito out of the International Space Station when he bought a ride on a Russian vehicle.

      --
      -- Alastair
  31. One big name missing? by Devil's+BSD · · Score: 1

    Venturestar seems mysteriously out of the picture here...

    --
    I'm the Devil the Windows users warned you about.
    1. Re:One big name missing? by Anonymous Coward · · Score: 0

      They couldn't fix the leaky composite LH tank so the whole thing was scrapped. The Pentagon may resurrect a scaled-down version.

    2. Re:One big name missing? by AJWM · · Score: 2

      Venturestar was Lockheed's vehicle that the X-33 project was supposed to be a prototype for.

      When X-33 went a billion or so dollars over budget (really stupid design to start with) and was cancelled, Lockheed didn't have the guts to put its own money where its mouth was.

      --
      -- Alastair
  32. A sonnet for your bonnet by Anonymous Coward · · Score: -1, Offtopic

    On Slashdot you'll find it is read
    quite rarely amidst the trolls
    a well thought out piece regarding article said.
    Much more likely the goat man's bowels.

    In Your Rights Online we puport to discuss
    matters of such great importance
    like stealing from musicians and mocking their fuss
    and offering piddling forms of recompense.

    One thing that we argued was fees
    "Not to save us!" they claimed, but were lying
    The topics of late have been generally sleaze.
    Let's face it. Slashdot is dying.

  33. Well Done! by vchoy · · Score: 1

    improvement in per-pound launch costs (from $10,000 per pound to $1,000) and massive improvements in crew survivability."

    Given the current time and effort put into safety aspects of today's space shuttle programs, the plan of "massively" improving this demonstrates NASA's "it can always be improved" attitude and forward thinking ability.

    Well done!

    1. Re:Well Done! by Anonymous Coward · · Score: 0

      Actually I'm getting SERIOUS deja-vu from all this. I'm pretty sure we heard it ALL before with X33. They said exactly the same things then. I wouldn't be surprised if they just dug up some old press releases for X33 sed'd the X33's out.

  34. Crew and Cargo Seperate by Cerrian · · Score: 2, Interesting

    "Furthermore, a second-generation reusable launch system is being sought that lowers the cost-per-pound to orbit from $10,000 to just $1,000 a pound. The second-generation launcher would be capable of lofting crew and cargo separately" Finally!! I was wondering how much longer NASA/Aerospace industry planned on trying to keep crew and cargo on the same payload. Yes, it's not as efficient, but it's more economic and it's the economics that's the space industry's main obstacale. It never made sense to me as to why you would launch a billion dollar payload on a risky rocket transporation system and then on top, make a crew part of the payload. As if there wasn't enough risk and cost to the whole operation.

  35. Need For Shuttle? by ONOIML8 · · Score: 3, Interesting

    Not that I'm an expert by any means but...

    I would hope that they start by questioning the need for a shuttle to begin with. Manned orbital flight is pretty well handled with the ISS and the Russians have a cheaper, time proven method of transport to/from ISS that is pretty hard to beat.

    As far as repair of orbitals, has that proven to be worth the expense? Maybe it is, especially if they use such a vehicle to do trash collection. Again, I'm no expert but I hope those who are will be considering these things.

    It would seem to me that some of the would be costs of new shuttles would be better spent on upgrading the design of Soyez/Progress and making them even more efficient. The rest of the money could be better spent on other projects including unmanned deep space research or manned missions to other planets (assuming those make sense).

    --
    . Quit playing Monopoly with Bill. Switch to one of many non-Microsoft products today.
    1. Re:Need For Shuttle? by amabbi · · Score: 1

      In about five years or so, there are plans to bring the Hubble Space Telescope back to Earth. I think it's more for nostalgia than anything else, but how do you expect to do this without the shuttle? Soyez is a fine vehicle for transporting astro/cosmonauts into space, but what if you want to do more than that? Repair a satellite? Launch a probe? Those require specialized equipment, something that you would rather not just use once, like a robotic arm, and you need something other than a manned capsule.

    2. Re:Need For Shuttle? by ONOIML8 · · Score: 2

      That is my point, Soyez/Progress are fine for transporting and that's most of what needs to be done. What else is being done that really needs to be manned or done in a shuttle. I would think that the ISS could handle most of the experiments.

      The arm is remote controlled, not robotic. As such it does need human control, but they are doing that from inside the spacecraft, could just as easily be done from a control room in Nebraska. I would think it would be cheaper to develop a remote piloted vehicle for repair and launch maneuvers. It certainly would improve crew safety a whole hell of a lot.

      --
      . Quit playing Monopoly with Bill. Switch to one of many non-Microsoft products today.
    3. Re:Need For Shuttle? by amabbi · · Score: 1

      I think you're very wrong about this. Say you need to service the Hubble. How do you do that without the shuttle? The movements that need to be made are too delicate to be made with a robotic arm, and the ISS, with its big fancy arm, is relatively immobile in terms of its orbit. How do you propose the ISS would have been built without the shuttle? Sure the Canadarm I is remotely controlled from within the shuttle itself, but then you have spacewalk after spacewalk to do the actual connecting of the components. And you still haven't told me how you propose to return satellites, modules, or experiments to Earth without the shuttle.

    4. Re:Need For Shuttle? by ONOIML8 · · Score: 2

      Like I said, I'm no expert and that's why I'm asking.

      For the sake of tossing ideas around tho, here is what I would assume to be more cost effective:

      For in space service of things like Hubble it would seem far cheaper to dispatch a space only orbital craft from ISS. Such a craft would be far less expensive to build and operate since it would not be designed for multiple re-entry into the atmosphere, nor would it require large engines. Again, I'm no rocket science expert so it's just an assumption.

      I do know, from recent NASA press releases that they have installed an airlock on the ISS which allows the ISS crew to do their own spacewalks. The do not have to rely on a shuttle for this any longer.

      As for return of items to earth, the shuttle is not the only means of doing this. Soyez returns live crew to earth on a regular basis. Apollo, Genesis, and Mercury programs all used similar methods of capsule based re-entry. I've also read somewhere about baloon type technology that would work for some items but not for live crew.

      Again, I plead ignorance but just assume based upon what little I know that the shuttle's method of launch and recovery is not the most efficient. From the figures I've seen on the costs of shuttle operation vs. Soyez operation it seems that single use craft are far less expensive to operate. With the possible exception of very large payload recovery, I don't understand why the things you have mentioned require the use of the shuttle instead of single use craft.

      --
      . Quit playing Monopoly with Bill. Switch to one of many non-Microsoft products today.
  36. Another favorite: by Anonymous Coward · · Score: 0

    Lev Andropov: American components, Russian components, all made in Taiwan!

  37. good link, mod parent up. by primenerd · · Score: 0

    It's a real link, not some link to goatland or something.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  38. Yes Russia does by Edmund+Blackadder · · Score: 2

    Russia has the Buran. It looks like the american shuttle but it is larger and carries more cargo.

    I think it has only flown once. After that they parked it on a runway and it has been there ever since AFAIK. I think one of the fuselage models used for testing is a tourist attraction in moscow.

    The Russians dont use it because it is much cheaper to use their rockets.

  39. Embarassing compared to WHAT? by Ars-Fartsica · · Score: 2
    I hear these gripes all of the time...but who is the US in a race with? The Russians can barely afford to pay for anything on the ground let alone in space. The Chinese are at least fifteen years off of anything serious in the way of manned spaceflight. The Euros? The Japanese?

    So please tell me why the shuttles are an embarassment. As far as I can see they're still the only space craft that lands on wheels.

    1. Re:Embarassing compared to WHAT? by Moofie · · Score: 1

      I believe that we are in a race against our own self-destruction. Humans thrive on exploration and frontiers, and space is the only one big enough.

      I'm not even that worried about extinction-level events. I'm worried about getting stir-crazy on this ball of rock, and killing each other.

      --
      Why yes, I AM a rocket scientist!
    2. Re:Embarassing compared to WHAT? by AJWM · · Score: 2

      So please tell me why the shuttles are an embarassment. As far as I can see they're _still_ the only space craft that lands on wheels.

      Well, that's one reason right there. What the heck is the point of wheels on a spaceship? It doesn't take off using those wheels, or the wings either for that matter. Total dead weight, useful only for landing -- and then only after you've got high enough and light enough that the wings will lift and the gear won't collapse.

      Fscking stupid way to design a vehicle. Hell, how many helicopters have wheels? (not counting the tiny ones to make it easy to drag the thing around on the tarmac).

      --
      -- Alastair
    3. Re:Embarassing compared to WHAT? by DarenN · · Score: 1



      why does it have to be a race for things to be well designed and cost effective?

      In fact, the very reason that it's NOT cost effective is that NASA WERE in a race when the shuttle was originally designed, and HAD to be ready before the Russians landed on the moon, for political reasons.

      I'm pretty sure, however, that if this Russian space module was so great that NASA would've bought the plans when the rouble collapsed for a few shiny dollars :)

      Has anyone looked at NASA's Alternative Propulsion Labs recently? there's some très funky stuff going on there. Not all of it is sensible, but most of it is cool. For a one view, and some links, see

      http://www.altenergy.org/3/new_energy/magnetics_ an d_gravitics/nasa_propulsion/nasa_propulsion.html

      --
      Rational thought is the only true freedom
  40. Buran sits in a parking lot among weeds. by Ars-Fartsica · · Score: 1

    You are totally ill-informed re Buran. The Russians never made meaningful use of this design and there was only one semi-functional prototype built. You can now tour it for a few dollars outside of Moscow, but hurry up, its falling apart quickly and even the carival hucksters who own it are getting tired of it.

    1. Re:Buran sits in a parking lot among weeds. by AJWM · · Score: 2

      You should do your homework before calling others ill-informed.

      The Russians built several Buran-class shuttles (another one was named something like Ptichka, "bird"). There was a structural model, that's the one sitting in the park, equivalent to the Pathfinder now sitting in Alabama. There was a manned flight test vehicle that flew numerous approach and landings (like the Enterprise) but unlike the US Shuttles, it had jet engine pods so it could take off on its own and do self-ferrying. And of course the Buran itself which flew in space and did a hands-off fully automated landing (something the US Shuttle has never done).

      --
      -- Alastair
    2. Re:Buran sits in a parking lot among weeds. by Anonymous Coward · · Score: 0

      Of the 3 basic Buran components, when I was in Baikonour & Moscow a couple of years ago..

      1) Structural test article in Gorky in Moscow being used as a cafe. Bad food. (I've since heard it's gone out of business -- no confirmation except from my Rolaids).

      2) Jet-engine powered landing test vehicle was sitting at the side of the runway. Uncovered, no environmental control on it. Engines had been removed, with dangling wires out of the end pods. Probably pretty bad shape. (Didn't get closer than about 100 meters)

      3) Flight vehicle. When I was there it was inside, inside an environmentally controlled hanger. However, they were modifying the hanger for space station work, and doing a lot of jackhammering the floor, cutting concrete, putting in new walls and structure. Yep -- the entire vehicle was covered with white concrete dust and little flecks of ceiling and floor material. I walked up to it and inspected the surface. Since then I heard they pulled it out and put it on the last Energia booster which was out in another hanger bay. Sort of a sad historic display of what had been.. I'd consider the full Buran/Energia in pretty poor shape, although with enough money you could possibly restore them to flight readiness -- for about as much as it would cost to design and build another vehicle.

  41. You mean Tthey "had" a "shuttle-like" prototype by Ars-Fartsica · · Score: 2
    The Russian Buran program was based on what the Russians thought the US space shuttle was. They were unable to duplicate the effort and Buran was never practically employed.

    It now sits as an amusement park exhibit that you can walk through, and as for it "not flying anymore"...well, it never really flew in the first place in a practical sense.

    I don't know why people constantly bring up Buran. There is no comparison between this pseudo-prototype craft that was never practically used, and the shuttle, which has over two decades of nearly perfect mission records.

    1. Re:You mean Tthey "had" a "shuttle-like" prototype by scotch · · Score: 5, Funny
      I don't know why people constantly bring up Buran.

      Because we like to torment you. It obviously bothers you.

      I also heard that France was working on a shuttle. Portugal has been flying their shuttle for years, though it's not widely publicized. Mexico scrapped their shuttle project in favor of their rail-gun / light-sail combination system with which they've manage to supply migrant workers for the asparagus farming on Venus.

      --
      XML causes global warming.
    2. Re:You mean Tthey "had" a "shuttle-like" prototype by Anonymous Coward · · Score: 0

      If all posts here had this kind of wit
      there would be no need for medicinal marijuana o make it bearable.

    3. Re:You mean Tthey "had" a "shuttle-like" prototype by Bitsy+Boffin · · Score: 2
      This is a misnomer. The russian shuttle program actually partially built several shuttles, Buran is the name of the first of them.

      One shuttle was completed, but never actively used - it performed an unmanned orbit and return, admirably.

      There is a flight test prototype currently on display in Sydney I believe (that's where it was when I last looked anyway), but was never space capable.

      There is at one other almost complete space capable shuttle in storage (named Ptichka (Little Bird)) along with the one that orbited - Buran. Three more (unnamed) were under construction when the program finished.

      They were obviously externally designed in the same way as the american shuttles with one major difference. They don't have engines. Instead to launch they are strapped to the back of one VERY powerful rocket system - an Engergia.

      Anyway, this site is the best place for all your Buran needs.

      --
      NZ Electronics Enthusiasts: Check out my Trade Me Listings
    4. Re:You mean Tthey "had" a "shuttle-like" prototype by geoswan · · Score: 2
      I don't know why people constantly bring up Buran.

      Because the Buran program is interesting? Yes, Buran does come up ever six months or so here. I learned quite a few things during those discussions.

      I didn't know that the Burans had considerably larger payloads than the American shuttles. I didn't know that the Buran crew had ejection seats.

      I hadn't really realized that the main reason the Buran program was stalled was that the Soviet Union totally ran out of rubles.

      Here are some of those previous slashdot threads.

      Russia Revives Buran Space Shuttle

      Own Your Own Russian Space Shuttle

  42. I tend to agree with you by Edmund+Blackadder · · Score: 2

    With the ammount of money poured into NASA (especially the shuttle program) you'd think that the US would have found a cheap way to put things into space.

    Instead the Russians still do things cheaper (and so far quite reliably) with their Energia rockets.

    It is really hard to believe that those contractors are actually trying to make things cheaper.

    1. Re:I tend to agree with you by tftp · · Score: 2
      Instead the Russians still do things cheaper (and so far quite reliably) with their Energia rockets.

      Most of launches in last 10 years are Soyuz and Proton. These are relatively cheap rockets.

      Energiya flew only couple of times, taking Buran into orbit in one of those flights. But it became obvious that Buran would be a financial black hole (exactly as Shuttle is), and the Buran program was stopped (with no ill effects, as we see today). Energiya rocket was mostly developed to launch Buran, and therefore it got shelved too.

  43. Aren't both Boeing stages identical? by Ars-Fartsica · · Score: 4, Informative
    From what I could see from the photos, tthe Boeing stages appear to be identical (?), which would be a huge cost-savings in terms of parts reuse, interchangeability, etc.

    Its true though that all of the designs share some characteristics...one stage to get you off the gorund, one to get you into orbit. Obviously this isn't by accident...the physics of the problem and materials/fuel presently available must dictate this design.

  44. "advancing american know how" by Edmund+Blackadder · · Score: 2

    If congress really wanted to advance american know how they would put the money into universities, that would make all their discoveries and developments available to the public.

    Currently the money goes to a couple of aerospace companies that keep all of their important developments in secret.

    And all those advances in know how are so esoteric they are quite useless for most Americans.

    The primary justafication for NASA's funding is to feed powerufl contractors. Luckily we can get some important science done as a byproduct of that.

  45. You seem a little naive for a retired rocketman by Ars-Fartsica · · Score: 2
    Really, you must realize that the range of companies who can bid on this type of project is very limited, and that obviously the government wishes to spread the mindshare for this project over mutliple vendors if possible.

    Large scale aerospace and military projects have operated as such for decades. This really isn't news.

  46. Medium Transports by user32.ExitWindowsEx · · Score: 1

    Where is Gallofree Yards Inc. when we need it? A couple of those transports from the Battle of Hoth and we could haul stuff into orbit for the same price per pound that FedEx charges to haul packages across the USA.

    --
    "Evil will always triumph because good is dumb." -- Dark Helmet
  47. if you think the space station is overpriced by Edmund+Blackadder · · Score: 2

    A moon station would cost many times what a space station does.

    1. Re:if you think the space station is overpriced by spike+hay · · Score: 2

      A moon station would cost many times what a space station does

      At least they would have worthwhile things to study on a moon base.

      --
      If you don't understand any of my sayings, come to me in private and I shall take you in my German mouth.
    2. Re:if you think the space station is overpriced by sunspot42 · · Score: 2, Interesting

      Would it? There are resources on the moon. There's silicon and oxygen, solar energy and metals. It's probable there is ice on the moon, which could be used to produce water, or hydrogen for rocket fuel. There's probably also carbon on the moon - just look for where carbon rich rocks may have smacked into the surface over the past 4 billion years. Not only can you support people with those resources, you can use them to build more habitat and more infrastructure to support still more people.

      In low earth orbit, the only resource you have is solar energy. Everything else has to be trucked up from earth, at something like $10,000 a pound. It costs 2,500 bucks to shoot a Quarter Pounder into orbit. Astronauts eat the equivalent of 3 of those every day. Add to that the cost of air and water, and pretty soon a moonbase starts to look pretty good in comparison, especially given the stated lifespan of the ISS (at least a decade).

      Would a moonbase cost more? Sure, in the short term. But over the long run, a moonbase would become essentially self sufficient - something the ISS could never do - and could then go on to pay for itself. Because lunar gravity is 1/6th that of earth, and it has no atmosphere, it would be much, much cheaper to launch payloads into earth orbit from the moon than it is to launch them from the earth. Using a moonbase to launch probes to the other planets, or giant communications satellites to orbit the earth, could save NASA and analogous space agencies around the globe hundreds of billions of dollars.

      Ah, but they're going to lower launch costs with these new rockets, right? Well, that's the same line of bull Congress bought when they authorized the construction of the space shuttle back in the 1970's. The shuttle would be this reusable wonder that would drastically slash the cost of getting into orbit. Yeah, right. It costs more to launch payloads on the shuttle than it does on any other system currently in operation (and all of them are disposable). So if you truly believe this latest attempt to design a reusable booster will slash launch costs tenfold, I have a bridge I wanna sell you.

      The ISS is a $100 billion boondoggle, a black hole that's sucking up NASA's budget and giving back nothing in return. It's like watching Columbus anchor his fleet just outside of the harbor at Palos and burn Isabela's money to keep warm, instead of sailing to the Indies. It's a pointless waste. Developing yet another generation of overpriced "reusable" rockets in order to support such misadventures is pure folly.

    3. Re:if you think the space station is overpriced by Edmund+Blackadder · · Score: 2

      Ok you are talking science fiction here. You will have to lift a ton of machinery to be able to produce industrial quality metal from moon ore.

      As far as getting food from the moon even if moon farming is possible i am sure it will require many tons of machinery.

      Launching satelites from the moon? Do you know how much a mosfet factory wighs? Making a satelite requires the best of earth industry, you want it to be made from the moon with localy found minerals.

      Everything you are talking about is long ways off.

      And the 100 billion ISS boondogle is nothing compared to what a moonbase would cost.

      I agree that NASA is very unlikely to make a cheaper vehicle though.

    4. Re:if you think the space station is overpriced by sunspot42 · · Score: 1

      We're already lifting many tons of machinery - and food - and water - and air - into LEO so that three astronauts can sit up there and keep the ISS from falling apart at the seams. Why not skip the consumables and spend all of the money to launch machines that can MANUFACTURE the consumables on-site?

      Would building a moonbase require new technologies? Sure. So did building the ISS, but you aren't calling that "science fiction". Unlike the ISS though, the technologies used for building a moonbase would have vital, practical applications going forward. ISS is a boondoggle - none of the tech being developed to "boldly sit where no man has sat before" will do a thing to further human advancement into the solar system. We aren't really even building anything in LEO. We're just hauling up a 100 billion dollar high-tech human Habitrail and putting the pieces together.

      Yeah, I know how much a mosfet factory weighs. And I know I wouldn't launch one into orbit at $10,000 (or even $1,000) a pound - I'd build one on site using materials gathered on site. When the first European settlers came to America, did they carve off a chunk of London or Madrid and sail it out into the middle of the Atlantic on a barge, and then just sit there, at enormous expense? No. Did they import all of their food, water, air and clothing to the "New World"? No. They came with tools and built the infrastructure they needed to survive on site, using the materials at hand. We should be spending the hundreds of billions we're currently wasting on the ISS and on these unworkable "reusable" launch vehicles on developing the tools to make ourselves self-sufficient on other worlds.

      Would a moonbase cost more than the ISS? Dunno. Depends upon how many trillion NASA throws at developing this "next-generation" reusable launcher in order to supply and support the ISS over the next 20 years. Because you can bet the defense contractors will keep the International Pork Station alive as long as they can in order milk it for additional hundreds of billions of dollars in taxpayer money.

    5. Re:if you think the space station is overpriced by ErikZ · · Score: 2
      It's probable there is ice on the moon, which could be used to produce water, or hydrogen for rocket fuel.


      Does it bother anyone else that we don't know if the moon, the closest celestial body, has water on it? People keep on talking about Mars, but our track record with the moon is pretty shabby.

      --
      Democrats or Republicans. They are both taking us to the same place and they are not afraid of us anymore.
    6. Re:if you think the space station is overpriced by angel'o'sphere · · Score: 2


      Does it bother anyone else that we don't know if the moon, the closest celestial body, has water on it?


      Hu?

      We KNOW, THAT the moon has water, more precisly ICE on it.

      In the craters at the poles allreay water ice was found and also Helium 3 ...

      Enter "moon ice" into yahoo.com and you get hundrets of links, e.g. this one:
      http://nssdc.gsfc.nasa.gov/planetary/ice/ice _moon. html

      Regards,
      angel'o'sphere

      --
      Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.
    7. Re:if you think the space station is overpriced by ErikZ · · Score: 2

      I've already read all that stuff. I'm a proponent for colonies on the moon. However, all they really detected was Hydrogen.

      Yes, it's an indicator that there should be water on the moon. But would you bet your life on it?

      I wouldn't.

      --
      Democrats or Republicans. They are both taking us to the same place and they are not afraid of us anymore.
    8. Re:if you think the space station is overpriced by Anonymous Coward · · Score: 0

      well you wouldn't be betting your live. You send up a probe first to see if there is water.

      Besides, moon rocks have oxygen so if there is also hydrogen you can make water.

    9. Re:if you think the space station is overpriced by ErikZ · · Score: 2

      Yes, I understand the probe thing. But my original point was that we don't know if there is water on the moon. And it's sitting RIGHT THERE.

      And the mining of moon rocks for Oxygen to mix with Hydrogen (probably H3)...has anyone tried this? Or is this just a theory?

      --
      Democrats or Republicans. They are both taking us to the same place and they are not afraid of us anymore.
  48. -1, Naive by Ars-Fartsica · · Score: 2
    Manned orbital flight is pretty well handled with the ISS and the Russians have a cheaper, time proven method of transport to/from ISS that is pretty hard to beat.

    First off, how is the ISS a solution to manned orbital flight??? Secondly, giving up manned spaceflight to the Russians is idiotic on many levels.

    They aren't dependable.

    They don't have the funding to pursue future programs.

    They have nuclear weapons pointed at us.

    1. Re:-1, Naive by MrHat · · Score: 1

      On slashdot the posters fixate
      There aren't enough words on their plate
      If one doesn't believe
      He'll call one naive
      Then thousands of slashbots tailgate

    2. Re:-1, Naive by ONOIML8 · · Score: 2

      ISS is manned and orbital. Again, I'm not an expert in these matters but I would assume that most, if not all, experiments that require the shuttle for zero or low gravity could be performed on ISS.

      I don't believe that I mentioned anything about giving manned spaceflight up to the Russians. I simply suggested that Soyez/Progress is a cheap and proven transportation platform that we could continue to use. They use it both in manned and unmanned flight.

      By contracting with the Russians to provide transportation we would provide those people with jobs and income they need to survive. Because it would be contracted they wouldn't have the funding worries about continuing Soyez launches, it could be done on a cost plus basis. The Russian space program has been very dependable in recent decades as far as I am aware, at least as dependable as our own if not more.

      If not then maybe we could buy that technology from them or license the use of it. We could then improve it ourselves and still have transportation to/from ISS and earth orbit for less than the shuttle.

      My suggestion/idea/comment was that by doing this we might not need the shuttle and the cost savings from that program could be put into other areas. If manned spaceflight is needed then the money could be put into that. I just question the need for manned spaceflight in earth orbit using expensive systems.

      Oh, about the nukes. I won't get into that political arguement except to say that the Soviet Union is gone and if we're going to learn to live TOGETHER on this planet it must be with cooperation. So in matters like this you just don't worry about the nukes so much and press on as if you are friends, or at least business partners.

      And it's not as if we don't have many more megatons pointed in their direction.

      As a former cold warrier I would have to insist that in the matter of the nukes, you are the one who is naive here.

      --
      . Quit playing Monopoly with Bill. Switch to one of many non-Microsoft products today.
  49. Just a thought..... by browser_war_pow · · Score: 2

    Why not get rid of NASA and encourage private companies to take over? What has NASA accomplished in the past two decades that really justify its budget? I know it's a bit idealistic right now to hope that we could get the government to cut back on its spending, pay off the national debt and create a sustained tax cut, but that's IMO the only way to spur innovation here.

    Let's face it, if there were very few to no regulatory hurdles to creating private space travel, colonies, etc coupled with low enough taxes for the venture capital to be there, we could accomplish NASA's "goals" in about half the time. Telling corporate America, "you see that big, beautiful, mineral-rich asteroid worth 2 trillion USD? Well if you can get to it, you can mine it for free!" would spur space R&D faster than NASA ever could.

    No generation of Americans has ever had simultaneously the kind of economy we have and the scientific know-how. The only thing keeping us back is the government. The national debt's interest alone consumes 13% of the budget! If we got rid of it, filed the charters of 70% of the federal agencies in file 13, booted the majority of people off social security and medicare (keep only those that even if they stuck only to survival, could not pay for medical care) and cut the taxes to something minimal who knows what we could accomplish. There would be so much money availible for private research grants that it would be mind boggling.

    1. Re:Just a thought..... by goldid · · Score: 1

      Somehow I don't thing we're far enough along to either mine space rocks or to prove a profit from space. Remember, for private companies to want to duke it out over something, there has to be some possibility of profit (despite what the 90's showed us).

    2. Re:Just a thought..... by DarenN · · Score: 1



      Ummm, corporate America is bad enough, but corporate Solar System? Corporate Milky Way?

      No thanks

      --
      Rational thought is the only true freedom
    3. Re:Just a thought..... by Peter+Trepan · · Score: 1

      Here's a little inspiration for private efforts at spaceflight.

      It's definitely cheap. I'm still holding my breath on the "crew survivability" issue.

      --

      Step into a huge movement. Don't Tread In Me.

  50. Check out those concept animations. by ilumits · · Score: 2, Funny

    Freud would be proud.

    1. Re:Check out those concept animations. by Moofie · · Score: 1

      You go ahead and design a launch system that doesn't look like a penis.

      There's a reason that rockets are basically long and cylindrical. It's called aerodynamics, and it's not negotiable.

      --
      Why yes, I AM a rocket scientist!
    2. Re:Check out those concept animations. by Anonymous Coward · · Score: -1, Offtopic

      Just look at submarines - long, hard, and full of seamen.

  51. What about the XB54? by rdelsambuco · · Score: 2, Interesting
    This may be a bait and switch, but I have to say that it looks promising. I worked on the NASA/Boeing XB54 back in the day, and we had similar ciriticisms. But really; we had a delivery vehicle that took of f and landed on convential runways, delivered c argo at $75/lb (back in the day) and ran on clean burning methanol hybrids. Too bad it never was funded fully

    Give NASA a chance!

    --
    I comment occasionally so that I can mod others -1 overrated or -1 offtopic.
    1. Re:What about the XB54? by spike+hay · · Score: 2

      rdelsambuco, tell me if i'm wrong, but I think NASA won't be getting SCRAMJETs anytime soon.

      There is some research right now on using plasma to reduce drag on aircraft. Evidently the Russians are using it for their next generation of MIG's (they are using it mostly for stealth, since the plasma absorbs radar).

      Anyway, they've done windtunnel tests with welder's torches, and they have found that it reduces drag by up to 30%.

      Ramjets can only get up to about mach 5. What if you attached one of these plasma generators onto a ramjet? It might be able to get to Mach 7.

      It seems like with such a setup you could use the ramjet to get up to Mach 7, and then use a kerosene rocket to get to orbital velocity.

      I figured with a kerosene/LOX fueled rocket motor at 350 seconds, you should be able to reach orbital velocity with about an 8/1 fuel to payload ratio.

      --
      If you don't understand any of my sayings, come to me in private and I shall take you in my German mouth.
    2. Re:What about the XB54? by AJWM · · Score: 2

      Give NASA a chance!

      They've had their fucking chance. More than once. Space launch costs more now than it did in the sixties -- completely counter to all other technology trends.

      Give somebody else a chance.

      --
      -- Alastair
    3. Re:What about the XB54? by Anonymous Coward · · Score: 0

      wow youre an asshole too arent you ? are you a friend of Ars-Fartsica?

    4. Re:What about the XB54? by zeno_2 · · Score: 2
      Ramjets can only get up to about mach 5. What if you attached one of these plasma generators onto a ramjet? It might be able to get to Mach 7

      It sounds like a scramjet could probably do about mach 7.6 without any fancy plasma generators. By the way do you have any links about this plasma stuff, I don't quite get how its supposed to work. Anyway, the info below came from: Cnn.com Even though its a theoretical speed, id trust the figure to be accurate.

      The HyShot scramjet is designed to combust at Mach 7.6, nearly eight times the speed of sound. The speed of sound is about 1,200 km (750 miles) per hour.

    5. Re:What about the XB54? by spike+hay · · Score: 2

      Theres quite a few links about it. This plasma thing is not that hard to do. It is definitely less technoligically advanced than scramjets. Also, SCRAMJETS would probably use plasma drag reduction too. It is not that hard to do. Plasma shieding can be accomplished with a glorified welder's plasma torch.

      Links:
      Sandia article
      This article provides some good info on plasma drag reduction as well as other hypersonic aircraft subjects.
      A Russian plasma page.

      --
      If you don't understand any of my sayings, come to me in private and I shall take you in my German mouth.
  52. Airbreathing engines are needed by NewtonsLaw · · Score: 3, Insightful

    The most expensive stage of any orbital or even suborbital launch is the first 30 miles or so.

    At these low altitudes, air resistance is a major factor and, due to the heavy fuel-load still onboard, a great deal of power is required.

    Conventional rocket motors suffer from the need to carry their own oxidizer (O2) but if the first stage of flight used air-breathing engines then far less of this heavy fuel element would be required. The result would be a lighter "wet" vehicle that required less power to fly.

    This is why NASA and other researchers are spending such huge amounts of money on things such as the SCRAMJET and Pulse Detonation Engines.

    Unfortunately it appears that there's still a big gap between laboratory and launchpad as far as these new engine designs are concerned.

    Liquid-fueled rocket engines will always be risky and fuel-hungry. The magnitude of improvement in safety and price-performance being sought will probably have to wait until they're perfected.

    1. Re:Airbreathing engines are needed by steveha · · Score: 2

      No.

      Airbreathing engines do you no good anywhere but during the first few minutes of takeoff; after that, they are extra mass you have to push around. Also, a design with both airbreathing engines and rockets is more complicated than a design with just rockets.

      Liquid oxygen is cheap. It takes up little room onboard. Carrying a bit extra is no big deal.

      You want a design that will work every time. A multiple-engine rocket, with enough engines that you can handle one or two engines failing, is what we need.

      Note that in a two-stage design, it might make sense for the first stage to be air-breathing.

      And that is all I know about air-breathing engines on spacecraft. I gleaned this by reading sci.space.* newsgroups on USENET.

      steveha

      --
      lf(1): it's like ls(1) but sorts filenames by extension, tersely
    2. Re:Airbreathing engines are needed by mpe · · Score: 2

      Conventional rocket motors suffer from the need to carry their own oxidizer (O2) but if the first stage of flight used air-breathing engines then far less of this heavy fuel element would be required. The result would be a lighter "wet" vehicle that required less power to fly.

      One possibly useful idea would be for the carrier (or even towing) vehicle to have a plant producing lox from the air it is flying through. Thus the oribital vehicle need only take off with fuel on board.

    3. Re:Airbreathing engines are needed by ArtDecayed · · Score: 1

      The problem with having an air breathing engine is that it is 'dead-weight' once the rocket engine is in use. However, it is possible to design a single engine that is both air breathable and can then be used as a conventional rocket engine.

      Such a thing has already been designed - it was for a failed UK project called HOTOL. The british government of the day (in their infinite wisdom) decided that the engine design was a military secret and thus classified it. I believe the engine designer worked for Rolls-Royce and was not too happy about it, if I remember correctly!

      Our glorious government was also responsible for classifying public-key cryptography when it was discovered - some 5-10 years before it was (re-)discovered by Whitfield Diffie and Martin Hellman.

      --


      'The best thing about deadlines is the wonderful WHOOSHing sound they make as they go by.' - Douglas Adams
  53. Umm no by Edmund+Blackadder · · Score: 2

    What is sitting in Gorky park was a prototype used for structural testing.

    There is a fully functional prototype that flew one orbital mission before funding ran out and is currently mothballed somewhere in some hangar (probably not a ranway).

    So i dont know where i was "totally ill-informed".

    1. Re:Umm no by Ars-Fartsica · · Score: 1
      So i dont know where i was "totally ill-informed".

      In presupposing that Buran represents even a potential option for spaceflight.

    2. Re:Umm no by letxa2000 · · Score: 2
      There is a fully functional prototype that flew one orbital mission before funding ran out and is currently mothballed somewhere in some hangar (probably not a ranway).

      Can you provide a link? I remember the Soviets working on a Shuttle-like vehicle, but I'm with the rest of the audience here... I only heard about them making a prototype. I've NEVER heard of anyone launching a Shuttle/reusable space vehicle except for the U.S.

    3. Re:Umm no by Anonymous Coward · · Score: 0

      Here's some info from NASA. There was actually one flight, and curiously, it was unmanned. It went up, went around Earth twice, and landed on it's own on autopilot. Not bad, eh?

      http://liftoff.msfc.nasa.gov/rsa/buran.html

    4. Re:Umm no by PyroMosh · · Score: 1

      You're right... It *was* silly of him to presume that something that ACTUALLY FLEW IN SPACE (albeit without a crew) could possibly represent a potential option for spaceflight. How silly!

    5. Re:Umm no by mlong · · Score: 1
      Can you provide a link? I remember the Soviets working on a Shuttle-like vehicle, but I'm with the rest of the audience here... I only heard about them making a prototype. I've NEVER heard of anyone launching a Shuttle/reusable space vehicle except for the U.S.

      Just to add my 2 cents...I remember reading back then (maybe in Popular Science or Popular Mechanics) that they did fly the Buran once on remote control and it did a successful orbit/return.

      --
      //m
    6. Re:Umm no by Anonymous Coward · · Score: 0

      You're really quite an asshole ars-fartsica aren't you ?

      then again i think you already knew that

  54. Slashdot editors doing a good job this week... by Anonymous Coward · · Score: 0

    Stories about NASA aside, I'd like to take time to seriously complement /. editors for doing a very good job of meeting expectations this week.

    An absence of lame blurbs and the worn out "must read/good read", etc., along with a generous cross section of topics users expect, has made visiting these last few days a joy...thanks!

  55. Spam in the can. by Anonymous Coward · · Score: 0

    So much for Buck Rogers. No all you future space cadets are just spam in the can.

  56. Then why did they kill more crews than the US? by Anonymous Coward · · Score: 0
    If there is one thing that can describe the Russian space program, it is serious loss of life throughout its existance...most of it officially undocumented.

    Of course they didn't have a device to prevent political "corrections" like the severe beatings Gargarin was given after his flight was over (and there are in fact photos of him with his face beaten in).

    1. Re:Then why did they kill more crews than the US? by mpe · · Score: 2

      Of course they didn't have a device to prevent political "corrections" like the severe beatings Gargarin was given after his flight was over (and there are in fact photos of him with his face beaten in).

      There, of course, being no possibility that his injuries might have been caused by being subjected to high G forces...

  57. Linear Aerospike Engine by cprice · · Score: 3, Interesting

    I wonder what has become of Lockheed Martin's "Linear Aerospike" engine technology. When X-33 went down the tubes, LA engine tests continued. The results looked somewhat promising.

    1. Re:Linear Aerospike Engine by FTL · · Score: 2
      > I wonder what has become of Lockheed Martin's "Linear Aerospike" engine technology. When X-33 went down the tubes, LA engine tests continued. The results looked somewhat promising.

      Excellent question. Take a close look at Lockheed Martin's proposal. See anything you recognise? :-)

      --
      Slashdot monitor for your Mozilla sidebar or Active Desktop.
    2. Re:Linear Aerospike Engine by JimPooley · · Score: 2

      It looks like the ship in "Moon Cresta"...

      --

      "Information wants to be paid"
  58. Don't Poo Poo the Shuttle by zulux · · Score: 2

    Every time a NASA is mentioned 'round here - sombody always mentions how screwed up the shuttle is. How it's expensive, and comlicated, and it sucks. I can see their point - if our goal was to launch a bunch of crap into space. But our goal isen't that - it's to learn things. In this endevour (pun intended) the Shuttle has been wonderfull. When we get to colonising the moon, we'll resurect the Saturn 5 - but for advancing the state of the art, the shuttle has been worth it.

    As an aside, I'll bet you that the the SR-71 'Blackbird' replacement, the Auroura, was made possible by things learned by making the Shuttle - like the tiles. But as we don't know much about the Auroura, so I'm just pulling crap out of my butt.

    Anyways, comerial rocketry is great for launching stupid XM radio satelites - the shuttle is great for learning and doing wacky things like fixing Hubble.

    --

    Moneyed corporations, non-working 'poor' and criminal prisoners are turning productive citizens into tax-slaves.

  59. random sPAMMATION by Anonymous Coward · · Score: 1, Interesting


    Triple YOUR SALES OVERNIGHT

    Simply by Accepting Major Credit Cards
    Are you turning away your share of more than 375 million sales?
    That's how many credit cards are being used nationwide.

    Charges in 2001 alone topped $10 Trillion

    DON'T MISS OUT ON YOUR PART OF THE ACTION

    Regardless of your credit history...

    Soon you can tell your customers you accept :

    Visa MasterCard American Express
    Discover Debit Direct Check, and MANY MORE

    You are 99.6% GUARANTEED to get a merchant account.

    If you want more money, we can help

  60. It's about friggin' time by Chembro · · Score: 1

    Well, I have to say that NASA's move is at least ten years too late, hell, in 2012, we'll have flying cars by then (where are they now?), and our technology will be much improved. That said, what will the new design be like? Will it be a sleek, space-age (wait, isn't that a bit old?), and have cupholders with artificial gravity? Comments appreciated.

    1. Re:It's about friggin' time by Anonymous Coward · · Score: 0

      I'm still waiting for someone to explain artifical gravity as portrayed on scifi shows to me. Seems to me the only way to get gravity in space is acceleration. Of course the acceleration required to get to a useful speed (assuming you found a light, cheap, compact fuel) would squash any occupants. Never did figure out the system shown in 2001, unless it was activated only during coasting speed, and turned of for acceleration and deceleration, so obviously "Please fasten your seatbelts during takeoff and landing" would have a whole new meaning.

  61. Shuttle tiles by Animats · · Score: 2
    No way could you use Shuttle-like ceramic tiles on a high performance military aircraft. Those tiles can't even withstand raindrop impacts on ferry flights. Buran could, but not the Shuttle.

    There's been talk of reviving Buran, which would be good. It's a more modern design than the Shuttle.

  62. Thrust by Anonymous Coward · · Score: -1, Flamebait

    640K of thrust should be enough for everyone

  63. Foolish assumptions by Scudsucker · · Score: 1

    The problem with the assumption that private industry can do any task better than the government is that private industries are about making money first and everything else is a distant second.

    NASA is about space exploration, not about making money. If there was no NASA and everything was left to private companies, there would be no Mars Pathfinder, no Hubble teliscope and no Moon landings because they don't make any money. We'd just be launching satellites and have Bill Gates pay to go up to orbit the earth.

    The other problem with leaving it to industry is all the time and resources wasted on duplicate efforts. Look at the plethora of differnt standards for Bluetooth, HDTV and recordable DVD formats as an example.

    Not that government is always the solution, but neither is it always the problem.

  64. adendum by Scudsucker · · Score: 1

    What I should also have said is how it can work pretty well to have a combo of gvt and private industry for space....kind of like how the defense department operates. DOD say "we want a plane that has x range and x payload" and let Boieng and Lockheed (sp) fight it out to produce the best plane.

    1. Re:adendum by Tazzy531 · · Score: 2

      i thought that is how it's done. They outsource a lot of the stuff to other companies. The Jet Propulsion Lab (JPL) is at the California Institute of Technology. I'm assuming others are involved also, I'd suspect, Boeing too.

      --


      _______________________________
      "I'm not Conceited...I'm just a realist..."
  65. An important fact to consider by Y-Crate · · Score: 3, Insightful

    Commercialization of space could make NASA's life easier. Now, they loathe the idea of having to compete, it would show just how much mismanagement there really is at the organization.

    However.......one of the single biggest problems with the Space Shuttle is also one that could be solved in the future by creating a market for them - with space tourism or somesuch.

    When you decide to build something like the Shuttle or the Concorde and then you find yourself with one or two users and no need for any more beyond the origional production run, then you have serious problems down the line that drive up costs to an insane level.

    Simply put, you run out of spare parts.

    The Shuttle and the Concorde were built all at once. The factories churned them out one after another. They needed parts - lots of them - so factories mass produced them.

    Then, there weren't any more Shuttles to be made, so there was no need for parts to be built.

    Time passed.

    Things broke down.

    And they broke down again.

    And again.

    Guess what happened? They started to run out of things. But you can't retool an entire factory to make 100 more of something you need - and do this for every part. So, instead, when something breaks, you have to make it. If some parts of the Shutte go bye-bye, guess what? Someone has to walk into a file room, pick up the blueprints and make a one-off of that part by hand.

    Sounds like excruciatingly time and money consuming fun, huh?

    Well, it _is_ .

    A growing market for a vehicle such as the Shuttle would mean more parts could be built, and for less. A permananet Shuttle maintence industry could be established, driving costs through the basement.

  66. And in other news just to hand by Anonymous Coward · · Score: 0

    Australia welcomes US Heroes!

  67. Re:George Bush calls on NASA to put a man on the S by NewtonsLaw · · Score: 2
    George Bush calls on NASA to put a man on the Sun

    When asked how they were going to deal with the intense heat likely to be encountered on any journey to the sun, NASA responded "no problems, we'll send them at night"

  68. You are a moron aren;t you ? by Anonymous Coward · · Score: 0

    They have nuclear weapons pointed at us

    Dickhead - and how many does the US have pointed at them ?

    And your's have fuel as your country has the money to maintain them

    While you are at it maybe you should do a bit of research and find out about the nuclear target packages that included Paris in france, Bonn in Germany and other allied countries - this was the case in the 80's when i was still serving with SAC at Edwardes - maybe you should get a clue you twit

    You really are quite and impressive asshole

  69. The Right Policy by Baldrson · · Score: 0, Flamebait
    1. Guarantee the purchase of contained water at $1000/lb in low Earth orbit, stationary (less than 5mph) relative to and within a kilometer of a specified target.
    2. For companies succeeding in delivering any water at all, permanently stop taxing anything but the government's cost of underwriting their loss of declared asset value due to force and/or fraud.
  70. alternate vehicles? by Anonymous Coward · · Score: -1, Redundant

    Have they considered a giant dragonfly design ...with smaller moth-like escape vehicles?

  71. Naivete? by XNormal · · Score: 3

    Naivete is the opposite of wisdom, not intelligence.

    Only if you equate wisdom with cynicism. Being cynical never got anyone to the stars.

    I'm naive, and damn proud of it.

    --
    Stop worrying about the risks of nuclear power and start worrying about the risks of not using nuclear power.
  72. telepresence by j09824 · · Score: 3, Insightful
    For earth orbit, telepresence is a much more cost-effective way of having "astronauts" perform work in space. You still get all the benefits of human flexibility with none of the costs of life support systems. And telepresence at this point is probably less cumbersome than a space suit.

    If we need real-time human intelligence for planetary exploration, telepresence from orbit is likely also a better choice than human landings: you reduce risks greatly, save on equipment, and still get real-time manipulation. But current planetary exploration goals are so modest that purely robotic systems are probably better.

    So, let's scrap human space flight for the time being. We can do an enormous number of really neat exploratory missions in space for the cost of the shuttle program and its replacements. When we return to the issue of human space travel again in a few decades, we'll have much better technologies.

    1. Re:telepresence by Anonymous Coward · · Score: 0

      The moonlandings happened before I was born. Now the capability no longer exists. If you scrap manned space travel, that capability will also cease to exist.

      The USA would not be the first empire to fall, simply because it is easier not to try anymore...

  73. Why does a moon base need to be 'metal'? by kesuki · · Score: 4, Interesting

    Who says the 'moon base' has to be made out of metal? Why can't you ship up some excavation tools, and light weight polymers and build an airtight underground lunar base with the only imported metal being the airlock doors? True, this doesn't provide you with any method for creating food, but We Could have had a lunar base easily. One much larger than any of the space stations we've shipped up, because as you recall all of those ARE made out of tons and tons of metal. There is also a cumulative advantage, the longer you've been building stuff on the moon, the more resources are at your disposal to build more complex projects... Unlike the space stations which all fall back to earth after a few decades. Depending on how far we push nanotech we may not even need to build factories on the moon, we may just need to send up a few machines that recieve power wirelessly and process raw materials into usable resources.
    The moon is a more practical environment to work in, the low G enables a person to remain there signifigantly longer than in the microgravity of space.
    The Biosphere projects are partially aiming at researching the viability of building an enclosed, self sustaining habitat on the moon, but even if you build a moon base that requires resupplying like space stations do, it could easily be done for less money as long as you take advantage of the fact that you can always dig a hole use some plastic to make it airtight and cover it with a metal lid. Homsteaders used to build houses out of earth and mud where trees weren't available, so why should we build lunar bases out of 'industrial grade metal' when really the only part that has to be metal is the door.

    1. Re:Why does a moon base need to be 'metal'? by mixama · · Score: 1

      Building a self sustainable biosphere in a man made structure is beyond our current technology. We havn't even been able to do it on earth what makes you think that we can do it on the moon?

    2. Re:Why does a moon base need to be 'metal'? by sunspot42 · · Score: 2, Interesting

      Very true. Not only that, but it might be possible to build shelters using nothing more than solar energy and moondust. We might be able to melt the lunar "soil" (regolith, I suppose) in kilns powered by solar energy and form it into blocks or other shapes as needed, working with it like a ceramic. It might even be possible to build spacecraft and satellites partially out of such material.

      You might also be able to reproduce larger objects in 3D printers that use lasers to melt the powdery lunar material and build objects layer-by-layer. The US military is already experimenting with such devices here on earth, using powdered metals to reproduce parts in the field. In theory, such devices could produce objects of any shape and of considerable size.

    3. Re:Why does a moon base need to be 'metal'? by sunspot42 · · Score: 1

      Any biosphere we create on the moon doesn't have to be fully self sustaining. There are plenty of materials on the moon - oxygen, hydrogen, carbon - that can be used to give the artifical biosphere a boost when needed.

    4. Re:Why does a moon base need to be 'metal'? by shadowbearer · · Score: 0


      Forty some years ago going to the moon was beyond our "current technology".

      This is how we advance - decide we're going to do something, figure out how to do it, then go ahead and do it. Of course the decision part seems to be the toughest one here in the states....

      SB

      --
      It's old. The more humans I meet, the more I like my cats. At least they are honest.
    5. Re:Why does a moon base need to be 'metal'? by coronaride · · Score: 1

      [shrug] a little far fetched, by why couldn't, after a couple primary excavation missions, they crew disassemble the shuttle, using its parts for construction? kind of reminds me of command and conquer, with the mobile construction vehicle.

      --
      Those who can, do. Those who can't, go into business for themselves.
  74. Y-Wing??? by Anonymous Coward · · Score: -1, Flamebait

    Is it just me, or does this design look a little too similar to the Y-Wing". Would NASA have to pay Lucas for the copyright? Is this a conspiracy by NASA to cash in on the Episode II hype? I think so!

  75. Gragarin's reward? by geoswan · · Score: 2
    If there is one thing that can describe the Russian space program, it is serious loss of life throughout its existance...most of it officially undocumented.

    Of course they didn't have a device to prevent political "corrections" like the severe beatings Gargarin was given after his flight was over (and there are in fact photos of him with his face beaten in).

    Let me see if I understand what you are suggesting. Are you saying that even though Gragarin's missions seemed successful to the rest of the world, he did something that displeased his masters, and they had him beaten up, and allowed photos of him with the marks of these beatings still on him?

    This is all news to me. But I remember during the buildup to the main attack in the Gulf War, a number of pilots were shot down. When the Iraqis allowed pictures of these airmen, there was a lot of speculation in the press that they too had been beaten. Then I heard someone less charged with emotion who said that being bounced around during a really rough landing could leave bruises on an airmen's face that looked like those one might get from being beaten up. This sounds reasonable to me, so I am going to assume, unless you can muster up more evidence, that any facial bruising you see in photos of Gragarin was due to a really rough landing.

    1. Re:Gragarin's reward? by Anonymous Coward · · Score: 0

      Well, the proof you see is is that its all "officially undocumented". Since there is no official documentation of it available, it must be true that theres a coverup! Did you grasp that logic?

      Presumably, this guy must be privy to some *pretty class i fied* *top sekret* information (how else could he, and only an *elite*, *select* few others, *know* all these things that the entire rest of the world has never even heard of?)

      Either that, or he's just another paranoid conspiracy theorist nutjob blowing hot air, like all the dorks running around saying the moon landing was faked. I swear, its embarassing to be a member of the human race sometimes.

  76. Yeah right by Colin+Smith · · Score: 2

    The shuttle was supposed to be cheaper than disposable rockets. Look at it's costs now.

    NASA simply doesn't do cheap.

    --
    Deleted
  77. Sort of... by tgd · · Score: 2

    They don't do it to maintain competition, they do it to keep the industry skill sets high. With the massive budget cuts in defense spending at the end of the cold war, mergers and layoffs were destroying the skilled worker base that had been built up. By spreading around contracts (and, in some cases, pushing companies to partner with other companies in the design and construction of larger projects), they ensure that companies with particular skill sets, and their highly skilled machinists, etc all remained in business and employed.

    Thats the biggest reason that projects like the Seawolf continue -- to keep companies like Electric Boat in business, and to keep the extremely valuable skills their worker base represents available for future projects.

    You can say a lot of things about our government, but you can't say the people doing these things are stupid. Just because the general public isn't up to speed on the reasoning doesn't mean there aren't very good reasons for them doing things the way they do them.

    1. Re:Sort of... by Sir+Elton+John · · Score: 1

      Okay, some of that makes more sense to me. As I said, I'm not up-to-speed in how the defense industry really works, having only heard about it from one person.

      --
      "I'm a rocket man / Rocket man burning out his fuse up here alone." - Sir Elton John
  78. Arguing on the internet by October_30th · · Score: -1
    --
    The owls are not what they seem
  79. NASA: Buran did Fly by anonymous+cupboard · · Score: 1
    According to NASA, Buran did get to orbit (in 1988) and it safely landed under adverse conditions which would have the Shuttle seeking an alternate. I guess if you flash some dollars and ask nicely the plans could be yours for a song.

    One of the main reasons that the project was abandoned was that development was far from complete and it would a lot more cash to "Man-rate" it.

    One thing that the Russians are very good at is metallurgy, particularly with respect to titanium alloys. The US could equal this, but at a substantially greater cost of production.

    1. Re:NASA: Buran did Fly by McSpew · · Score: 2

      I guess if you flash some dollars and ask nicely the plans could be yours for a song.

      Now that would be ironic. It turns out the reason the Buran looks so much like the Space Shuttle Orbiter isn't coincidence. The Russians used plans for NASA's orbiter as the basis for the Buran design.

      The Russians are great at getting performance out of cheaper, simpler systems, but there are always tradeoffs. When the Soviets were worried that the A-12 (interceptor version of the SR-71) and the XB-70 (mach 3+ nuclear bomber) might actually go into production, they worked night and day to develop their own mach 3 interceptor.

      The result was the MiG-25, which in some configurations can fly at mach 2.83. However, unlike the SR-71/A-12 which were designed to cruise at mach 3, the MiG-25 could only achieve its top speeds at tremendous cost to the aircraft. The plane would run out of fuel in a matter of minutes at that speed and the engines needed to be replaced after a flight reaching that speed.

      Yes, the MiG-25 was much cheaper than the A-12, and it was even cheaper than the F-15, which was the USAF's response to the MiG-25, but it's not realistic to expect it to routinely achieve its maximum speed. The American aircraft it was designed to compete against can routinely achieve their top speeds.

      Russian ingenuity is real, but there are very good reasons why American aerospace technology costs so much more. Frankly, the Russians aren't as worried about killing people.

  80. Nuclear rockets - Project Pluto by dpilot · · Score: 2

    A few years back there was an article in an aviation magazine about the US investigations into nuclear propulsion back in the 50's and 60's. I guess some of the kibosh came when they started looking for pilots who were "past reproductive age." There were investigations into a manned bomber, (I remember my older brother's plastic model of the thing when I was a kid.) and a cruise mother-missile that dropped bombs. The latter was called Project Pluto, and was the focus of the article.

    It was meant to fly over enemy territory at Mach 3, dropping bombs. It was also had a terribly dirty exhaust. In the end, they weren't sure which caused more damage: sonic boom from the low-level supersonic overflight, the bombs, or the exhaust. One of the things that killed it was the inability to test, because we couldn't find a place to fly it over, since the flight alone was so obnoxious.

    --
    The living have better things to do than to continue hating the dead.
    1. Re:Nuclear rockets - Project Pluto by kalidasa · · Score: 1

      See George Dyson's book on Project Orion for more details into nuclear propulsion ideas in the 50s and 60s. The original designers (including George's father, a little-known scientist whose first name is Freeman - as in the Sphere guy) intended a quite large interplanetary vessel (1 kT payload - that's right, boys and girls, one KILOTON payload, and I don't mean bombs, I mean passengers) powered by the ignition of relatively small fission charges (kiloton range, I think, and this time I do mean bombs) every half second or so; their motto was "Saturn by 1970". It is apparently quite plausible, technically, but it died because there was no way to eliminate the risk of fallout from atmospheric launches, and really no cheap way to haul the 4,000 ton beast (payload, propellant, and mechanism, including a 1,000 ton pusher plate to deflect the plasma and provide radiation protection) into LEO where it might be safer to use.

  81. Inefficent Americans could learn from Russians by nomadicGeek · · Score: 2, Insightful

    Maybe we should start to take notes from the Russians.

    Funny how our competitive capitalistic system ended up producing a bloated monolithic space industry dominated by a government bureaucracy. Our funding of NASA has been too high in my opinion. It allows all sorts of inefficiency like the space shuttle while discouraging private enterprise from getting into the game. Why risk time and money getting into space when the US tax payer is willing to foot the bill and assume all of the risk. It is much easier and safer to feed from the government trough. As another /.'er pointed out, the competitive bidding process is a sham. All of the contractors share the work amongst the others when a contract is awarded. The rules of the game are well established and profits are repeatable. You layoff or hire staff with the ebb and flow of government funding and lobby all you can to keep things going.

    The Russians on the other hand have a cheaper and more efficient way of getting into space. Their lack of funding has actually encouraged innovation and efficiency. They can't spend their way into space. They must be clever. They also seem to be open to new sorts of ventures such as paid space tourism. Our high brow NASA frowned upon the riff raff getting into space but the cash strapped Russians were forced to be more pragmatic about things.

    I think that it is a shame that our space program which started out to be a demonstration of US might and know how has turned into what it has. It is downright un-American. After 40+ years of space flight our space program should look much different. I would prefer funding dozens of smaller competing designs compared to one large shuttle project. Encourage efficiency and innovation, not playing it safe. Why put all of your eggs in one basket? Why lock yourself to one design by one company? NASA has so much money invested in the shuttle that they can't walk away from it even though it has not even come close to meeting its original goals.

    The Russians pushed to efficiency and needing funding will ultimately be more open to trying new things. Entrepreneurs and visionaries will probably have a much easier time dealing with them than the US program which tends to push them aside. The one thing that I see getting in the way is that they seem to be feeding at the US government space program trough also. They may end up being as complacent as our traditional contractors going for the easy and repeatable money.

  82. Don't mix passengers and freight by Richard+Kirk · · Score: 3, Informative
    Who remembers the Rolls-Royce HOTOL proposal? It must be over 25 years ago now. It was to be a reuseable airbreathing horizontal take-off thing. It looked like an aircraft, but it had no crew, and it was aimed at the space bulk freight market. This would have saved a bunch on all the life support and pressurization stuff for the early models. If it had been found reliable after, say, 50 flights, then there was the option to add and extend a pressurized cabin, toilets, lemon-scented towels in individual sachets, and other comforts.

    Okay, Britian has a long history of telling people what they ought to have built without actually putting very much together themselves. But it still strikes me as the right solution.

    1. Re:Don't mix passengers and freight by Anonymous Coward · · Score: 0

      Can't beleive you made this last comment,
      what about the Comet (worlds first jet airliner,
      celebrating it's 50th Birthday this year), Concorde
      and the Harrier.
      The British Aviation industry on a budget tiny
      compared to the US has consistently come up with
      new innovations.
      It's a shame no one was prepared to finance HOTOL,
      Nasa could easily afford a HOTOL style project
      but as usual the US solution was much more
      ambitious and costly and never got built.
      I believe the US spent more On SST research than
      the entire Concorde project cost and ended up
      with nothing more than cardboard mock up.

  83. Astronaut survivability... by Mysticalfruit · · Score: 2, Interesting

    Well the first problem is the proximity of the crew to hundreds of thousands of highly explosive fuel. At least with a rocket, the crew is on top and you can have some sorta either vertical or lateral escape system that can fire off with in 1/10 of a second of the rocket detecting a propellent cookoff. With the shuttle, the craft is strapped to the side of said fuel. The only way you could improve the crews surviveability would be to modularize the shuttle in such a way that if a propellent cookoff was detected, it would fire the crew capsule laterally away from the main fuel tank (and be able todo this while not killing the crew from g-forces and still getting them away quick enough that the concusive forces of the exploding fuel and the shrattnel from the fuel tank don't shred the vechicle.) This is a totally feasible. The biggest problem would be the weight involved. I t would increase the cost per pound instead of reducing it.

    I'm not sure what a better solution would be, but I'm sure that some smart people will come up with a solution.

    --
    Yes Francis, the world has gone crazy.
  84. sheesh -- inflation by slurry47 · · Score: 2

    I thougt a pound was just over two dollars -- or is that the Euro? -- but 10,000-1,000 dollars per pound! Just shows how little I understand the intricacies of international finance.

    --


    Dirt doesn't need luck.
  85. working on this for 20 years already by peter303 · · Score: 2

    And cnaned one program after another. Just more hot air from NASA.

  86. It has nothing to do with technology, it's 80% ops by Anonymous Coward · · Score: 0

    The extreme costs of the Space Shuttle
    have nothing to do with the technology
    and lots to do with NASA's desires to
    keep 40,000 people on the payroll at
    contractors offices and NASA centers.
    The biggest way to cut costs is to focus
    on improving operations. Nothing in the
    space launch initiative changes this.
    the sole and critical factor is looking to
    reduce headcount.
    the sole criteria to review a nasa proposal
    is to determine how many people will work on
    it. if it's less then 100 it's likely to
    succeed, if it's more then a 1000 it is
    doomed.

  87. What about the little guys? by Anonymous Coward · · Score: 1, Insightful

    It's not surprising, but it is a little disappointing to see that the only companies being considered for the final phases of the space launch initiative are the same few companies that have held a chokehold on the industry since almost its inception.

    Over the past several years, I have watched countless small companies try to break into this market and fail. In 1998, there were over 80 for-profit companies around the world attempting to develop launcher technologies. Most of these have failed now.

    I will be the first to admit that most of these companies deserved to fail, putting fantasy before reality. But to watch the glimmer of technological evolution be quashed because NASA chose to only back the "Big Boys" is a real disappointment.

    Can anyone tell me the last "small" company to get a foothold in the space launch business? Orbital is the closest I can come.

    just the ramblings of someone who hoped for better.

  88. So *that's* what KISS stands for... by smithmc · · Score: 1

    ...and here I always thought it was "Knights In Satan's Service". Y'know, with that scary makeup and all.

    --
    Downmodding is the refuge of the weak. Don't downmod, make a better argument!
  89. Reusable launch vehicles are STUPID! by wowbagger · · Score: 2

    Put down that flamethrower and follow me on this before you reply.

    I assert that reusable launch vehicles for normal space launches are stupid.

    Every kilo of mass on the launch vehicle costs, therefor every kilo that does not DIRECTLY contribute to getting the payload into space is wasted - worse, since you have to have the fuel to boost that kilo, you increase the mass of the rocket by several MORE kilos, each of which has to boosted at least part of the way, requiring more fuel....

    Now, if reusability DOESN'T increase the mass of the rocket, fine. Go for it.

    However, in reality making any part of the launch vehicle reusable WILL add to the mass of the rocket, therefor reducing the payload or increasing the fuel cost.

    What we need for normal launches is a dirt-dumb-cheap rocket, something we can churn out by the hundreds. I suggest a large solid fuel rocket - no expensive turbopump to machine. Make the casing out of either simple rolled metal, or possibly even a cellulose compound ("big paper rockets"), filled with solid fuel. Something designed to burn up on re-entry so that we don't spend kilogram 1 on recovery.

    Now, this is only for heavy lifting - chucking stuff into orbit. Obviously, these rockets would not be man rated - you still need a man rated shuttle to put people in orbit. HOWEVER, you can now make the shuttle just a people hauler, reducing the size of the shuttle (and therefor the cost). This was the original intent of the shuttle - then the DOD got involved, demanded an increase in payload, which was WHY the shuttle had to have the SRB's added in the first place.

    OK, if you've read everything this far, and you still feel like flaming, knock yourselves out.

  90. No crew -- max crew survivability by rlglende · · Score: 1


    Why flight crews? They don't fly the shuttle anyway: it is all automated.

    "Max survivability of human cargo" is a much different issue, much easier engineering.

    --
    "The Constitution, the WHOLE Constitution, and nothing but the CONSTITUTION."
  91. BDBDBDBD by zrk · · Score: 1

    You tell 'em, Buck.

  92. Putting assunder conspiracy therories by Anonymous Coward · · Score: 0

    I don't remember why NASA went with the solid boosters. It may have had something to do with which Congressional district the SRBs are built in.

    The choice to use SRB's was made for two reasons.

    The first reason is efficiency. In the initial stage of flight, most of a rockets mass is fuel. It is very inefficient to burn propellent which generates moderate thrust compared to it's mass The SRB's produce ~70% of the total thrust in the initial stage of flight while only accounting for a fraction of the total mass. Using liquid fuel boosters would necessaraly be much larger to generate the same thrust and would substantialy contribute to the total mass of the package.

    The second reason is financial. Most of the cost of a shuttle launch lies in labour expenses to refitt the shuttle after each flight. Components such as engines need to be replaced and rebuilt. The simplicity of the SRB design allows this to be done at a much lower cost because there are fewer components to replace.

  93. Chemical is so pass� by Anonymous Coward · · Score: 0


    You know, the whole "science" community has got its blinders on. Chemical rockets are so old news.

    NASA needs to go and twist the arms of the black ops projects and get them to release the UFO anti-gravity technology the spooks have been futzing with for 50 years... Problem solved.

    I think I've got some of that element 115 lying around in my closet somewhere. Gezz, where's Lazar when you need him?

  94. Freudulent Analysis... by Thag · · Score: 2

    You know, I'm always annoyed when people bring up Freud in polite conversation. Granted, it was a joke this time, but.

    To quote Sam & Max, "You're on the cutting edge of third-grade humor."

    I've always thought that Freud's genius lay not in providing any particular insight into the human mind and soul, but rather in selecting imagery so vague that it can be applied to almost anything. Because almost everything in the universe is either kind of round or kind of elongated.

    Jon Acheson

    --
    All opinions expressed herein are my own, and not those of my employers, who are appalled.
  95. Problem solved by Syberghost · · Score: 2

    They could more than double crew survivability by just sending up three astronauts at a time instead of seven.

  96. That's because the shuttle is an utter failure. by Thag · · Score: 3, Insightful

    Firstly, no, the shuttle's primary mission is to launch stuff into space. If all we wanted to do was "learn stuff," we could do it far more economically using subscale unmanned test vehicles.

    Secondly, the shuttle was originally supposed to save money vs. the Saturn V. It doesn't. It is at minimum an order of magnitude more expensive to run than the staged rockets it replaced. Just how expensive is not clear: it depends how much of the cost of its infrastructure you include in the cost of a launch. But the absolute minimum I've seen quoted is 300 million a launch, and that does not include infrastructure at all. Compare it to a cost of 20 million for a commercial flight of a Soviet space capsule, which includes both payments on infrastructure and a profit margin. And, because the shuttle was designed at the command of politicians and beaurocrats, the infrastructure is spread all over the country, to spread out the pork and give work to each of the beaurocrats' petty little domains. Why, for instance, didn't we just build the shuttle factory adjacent to the launch site, and cut out the cost of transporting it across the country? Why weren't the landing fields adjacent to the launch site from day one? Why use expensive and dangerous booster rockets? Why build the booster rockets using completely different technology than the main engines? Because it was a beaurocratic clusterfuck, that's why.

    The shuttle was supposed to be reusable, so that it could be turned around quickly and relaunched. Instead, it takes months to refit a shuttle.

    The shuttle was supposed to be safer than the systems it replaced. Obviously, Challenger blew up, the Saturn V's did not (the crew of Apollo 1 died in a ground test of the capsule, not the rocket). But also, one has to look at the underlying problem of operational complexity: the shuttle is just too damn complicated. It is a credit to the people involved that it has flown as safely as it has.

    There were supposed to be many shuttles, flying every few weeks, which would have made each launch less expensive by spreading out the infrastructure costs more. Instead, there are a handful of shuttles, flying about once a year. They're too expensive to build, and take too much time to refit.

    I'm not even going to talk about it landing at airports.

    Lastly, when you look at Shuttle, you have to point out that at the time we stopped production of the Saturn V, we HAD THE SATURN V ALREADY. The space shuttle cost billions to develop, on top of what we had already spent to develop the Saturn V. Worse, it set the space program back at least 20 years. Hell, we still don't have a replacemnt for the Saturn V.

    Jon Acheson

    --
    All opinions expressed herein are my own, and not those of my employers, who are appalled.
    1. Re:That's because the shuttle is an utter failure. by zulux · · Score: 2


      Yep!

      Another "The Shuttle Sucks - But My Hypothetical Saturn-5-Moon-Colony Idea Rules"

      See the trouble was that the US Public diden't give a shit about the Saturn 5, only the Military/Airplane companies had the clout to get somthing though a Congress that would rather spend money feeding retards.

      So yes, your Saturn 5.1 would have been great - by it never would have been built. I'd rather have the crappy shuttle that is actually running, than somthing that never would have gotten off the crayon drwaing board.

      So become Benovelent Dictator of these United States - and eventually the Satrun 5.1 will get built. And we can go meet the moon people.

      The sick thing of the whole NASA business, is the I bet that as a public, we spend more money on pretend space exploration though movies, books and video-games , than we do on real exploration.

      Oh well, time to adjust the foil hat.

      --

      Moneyed corporations, non-working 'poor' and criminal prisoners are turning productive citizens into tax-slaves.

  97. Why Don't They Just Buy 10 of Each? by Thag · · Score: 2

    And, while you're at it, throw the doors open for any other company that can put payload x into orbit y for z dollars.

    Here's the deal:

    You build a launch system and run 2 successful test flights (say, putting aluminum girders and panels and robots up near ISS, so later on we can build a space station that doesn't suck), and we buy 10 launches in 10 years.

    You pay your own R&D. If you can't make the launches for the price you bid, you eat the extra cost. At any rate, US Gov doesn't sign a contrct with you until we see the launches. And to be sure, we'll put aside the first 5 launches for unmanned payloads.

    You would have to put it into law that NASA and DOD would be forced to buy the launches, so that the next president or congress couldn't weasel out of it.

    It gets the NASA beaurocracy almost completely out of the picture, as well as the congressional pork that would otherwise interfere with efficiency.

    And, it would get real competition back in. What we're seeing here is the Old Boy's Club of Space.

    Jon Acheson

    --
    All opinions expressed herein are my own, and not those of my employers, who are appalled.
  98. Laser launchers. by Christopher+Thomas · · Score: 4, Informative

    Ground based lasers will always be subject to thermal blooming due to atmospheric attenuation.

    Interesting. Is this caused by the lasers or just natural artifacts of the atmosphere? Incidentally power is the cheap bit in the equation, and you need less of it delivered at altitude due to g-limiting anyway; so it may not matter.


    Atmospheric. You have two effects happening. One is that minute particles in the atmosphere scatter the laser beam. This is unavoidable, and causes exponential attenuation over long distances. The second is that the atmosphere absorbs some of the light you're sending, and heats up. This causes optical mayhem that defocuses the beam.

    Compounding the problem is the fact that you'll have to fire through a *lot* of atmosphere. Your craft needs most of its velocity to be tangential, and you want as long an acceleration path as you can get away with to keep the acceleration to something that a) you can provide and b) won't damage your cargo. This means a grazing path through the atmosphere, which means your lasers will be firing through hundreds or possibly thousands of kilometres of air (i.e. as far as you can manage).

    The only practical scheme I can think of for very long distances is to have multiple stations along the flight path and to fire a converging beam, so that heating problems are only significant for the last little part of the beam path.

    On a couple of other points: You'll be using a laser array, not a single laser, so the cost will be directly proportional to the power required. More power means more cost.

    Also, I have doubts about a heat-exchanger system working. Throughput tends to be low compared to the power flow required to get high ISP, and a heat exchanger means a heavier craft. The most practical craft design I've seen suggested, which has flown in small-scale tests, has the bottom of the craft being a curved mirror with a central projection. The laser is focused by the mirror and heats air immediately below the central projection, which is shaped to force the air to move away from the craft.

    Laser launchers are a neat idea, and avoid the problem of carrying most of your reaction mass when set up in jet mode, but there are formidable engineering problems to overcome before they're practical.

    1. Re:Laser launchers. by WolfWithoutAClause · · Score: 2
      Also, I have doubts about a heat-exchanger system working. Throughput tends to be low compared to the power flow required to get high ISP, and a heat exchanger means a heavier craft.

      The heat exchanger is not a huge problem- the heat flow is comparable to the heat flow that a microprocessor heatsink sees in fact. And you have to compare this with turbopumps- with this system no turbopumps are needed; it's a laser powered pressure fed rocket in fact; with a high ISP.

      The most practical craft design I've seen suggested, which has flown in small-scale tests, has the bottom of the craft being a curved mirror with a central projection. The laser is focused by the mirror and heats air immediately below the central projection, which is shaped to force the air to move away from the craft.

      I'm not sure that's really practical as it stands. Nobody has or can afford a pulsed laser of the required power, and nobody is planning to build one. Secondly, this is purely an airbreathing design- as such it cannot make orbit (the 'orbital version' has extra tanks). Thirdly it requires a laser pointing from directly below, but 93% of achieving orbit involves sideways motion. Still, variations of these ideas may make orbit, but they are all then much more complex.
      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    2. Re:Laser launchers. by Christopher+Thomas · · Score: 2

      The heat exchanger is not a huge problem- the heat flow is comparable to the heat flow that a microprocessor heatsink sees in fact. And you have to compare this with turbopumps- with this system no turbopumps are needed; it's a laser powered pressure fed rocket in fact; with a high ISP.

      The heatflow per unit area in a microprocessor heatsink is miniscule compared to the flux you'd need to drive an engine with an Isp of 600, unfortunately. You need to get your exhaust hotter than any chemical rocket can manage. I have doubts of you even being able to *use* a heatsink under these conditions, as the exhaust temperature will be hotter than the degradation/melting/boiling temperatures even for things like tungsten carbide and carbon. Rocket nozzles survive by being actively cooled by fuel coming in, which gives a blanket of cooler exhaust next to the nozzle wall. For a heat exchanger to work, your wall has to be hotter than the desired exhaust temperature.

      And turbopumps aren't terribly relevant to the issue - alternate designs don't need turbopumps either.

      I'm not sure that's really practical as it stands. Nobody has or can afford a pulsed laser of the required power, and nobody is planning to build one.

      Exactly the same could be said for a continuously driven laser launcher. Both would require building batteries of lasers on a huge scale. Not even the laser fusion experiment facilities come close.

      Both are practical to build, though the number of lasers required (and thus cost of the ground facility) will differ.

      Secondly, this is purely an airbreathing design- as such it cannot make orbit [...] Thirdly it requires a laser pointing from directly below

      Sure it can. You just have to accelerate tangentially or nearly tangentially for most of the trip (which increases your laser path and thus the engineering challenge, but you'd need to do this anyways to keep acceleration sane with an air-breather). Once you're in the upper atmosphere, losses due to drag on the way out are manageable (as long as mass per unit cross-sectional area of the craft is much larger than the mass per unit area of the atmosphere it plows through on the way out, you don't lose much velocity).

      If you really want to use a design that carries its own fuel, you can still use this scheme. Just spray gaseous fuel out to the focal point of the mirror (you have a blast deflector right next to it, so this isn't difficult).

    3. Re:Laser launchers. by WolfWithoutAClause · · Score: 2
      "I have doubts of you even being able to *use* a heatsink under these conditions, as the exhaust temperature will be hotter than the degradation/melting/boiling temperatures even for things like tungsten carbide and carbon."

      The claim of the designer was that the surface temperature was only 1000C. I haven't checked his maths. He didn't mention using a few tricks, but he didn't elaborate. ;-) Actually, come to think of it, he may have been using a special sort of piston pump; so a sort of turbopump may have been involved.

      Exactly the same could be said for a continuously driven laser launcher. Both would require building batteries of lasers on a huge scale.

      True. However semiconductor lasers are seriously cheap and getting cheaper all the time. If a reason for launching this much stuff can be found, then this is probably a better architecture. In particular if the lasers can scale to tourism payloads then we are talking something that can be funded.

      Once you're in the upper atmosphere, losses due to drag on the way out are manageable

      Pretty much be definition, if you are in the upper atmosphere you aren't in a stable orbit. And even if you leap out- your orbit still intersect the atmosphere.

      Just spray gaseous fuel out to the focal point of the mirror

      Sorry, doesn't work. When the fuel burns it forms an opaque combustion layer- and then your laser doesn't focus right. That architecture needs a pulsed laser.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    4. Re:Laser launchers. by WolfWithoutAClause · · Score: 2
      The second is that the atmosphere absorbs some of the light you're sending, and heats up. This causes optical mayhem that defocuses the beam.

      This effect can be made arbitrarily small. The vehicle is moving very fast; so it can't heat at that end.

      OTOH, the energy density at the ground can be made aribitrarily small by spacing the lasers, so I don't think this is more than an annoyance.

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
    5. Re:Laser launchers. by Christopher+Thomas · · Score: 2

      True. However semiconductor lasers are seriously cheap and getting cheaper all the time. If a reason for launching this much stuff can be found, then this is probably a better architecture. In particular if the lasers can scale to tourism payloads then we are talking something that can be funded.

      ...And I just finished coming from a seminar where they discussed prototype diode lasers with a 3db frequency of 30 GHz. Pulsing a diode laser isn't a problem :). You need more of them to get the same output power (since your duty cycle is less than unity and your pulse spacing is long enough that you can't consider them equivalent to CW from a heat POV), but that's just amortized into the per-flight cost like the plant cost is under any scheme. It them becomes a question of whether other benefits of a pulsed scheme provide a benefit that outweighs the added cost. (IMO, the fact that a pulsed system could be air-breathing and avoid the whole reaction mass problem is more than enough benefit to cancel the added cost).

      Just spray gaseous fuel out to the focal point of the mirror

      Sorry, doesn't work. When the fuel burns it forms an opaque combustion layer- and then your laser doesn't focus right. That architecture needs a pulsed laser.

      And this is a problem why?

      I still don't see why a pulsed solution would be impractical. Yes, you need a bigger laser installation, but so what?

    6. Re:Laser launchers. by WolfWithoutAClause · · Score: 2
      You need more of them to get the same output power.

      What duty cycle do you reckon is needed- 100:1 perhaps? Do you think that 100x the lasers might be a tad expensive? Ok, I suppose you can probably run the laser at higher peak power, so its not quite that bad, but you're probably still going to need an order of magnitude more lasers. It was expensive already but this is gonna cost...

      --

      -WolfWithoutAClause

      "Gravity is only a theory, not a fact!"
  99. Excuse me, Sir? by Skip666Kent · · Score: 2

    "Rocket Man" was written by David Bowie.

    --
    **>>BELCH
    1. Re:Excuse me, Sir? by Sir+Elton+John · · Score: 1
      "Rocket Man" was written by David Bowie.

      Surprisingly, you are not the only one confused by this. Bernie and I actually did write that for the Honky Chateau record in the early 70's ('72 or '73, if I can recall). Perhaps you are confusing the tune with David's "Space Oddity," the single of which was released a few years prior, if I am not mistaken.

      Space was a popular subject in those days, and I fear we were all a little swept away in the romance of it all. Incidentally, I identify still with those old lyrics, as I see the Internet as today's equivalent to the outer space of the late 60's and early 70's. So I think I still may be a Rocketman once more.

      You are excused, of course. Best of luck to you.

      --
      "I'm a rocket man / Rocket man burning out his fuse up here alone." - Sir Elton John
  100. Human Space Flight by Teancum · · Score: 2

    There are a couple of problems with this line of reasoning. First of all, it presumes that you know all of the technical issues to do telepresence (aka Heinlein's "Waldos"). You still have to get the robots/monitoring equipment into place and the sort of equipment you are talking about takes quite a bit of infrastructure in order to get it going. I believe that this is used in parts of the Nuclear Power industry quite a bit, because the risks far and away stronger than the cost of the equipment. Check out the web site for INEEL for some additional information regarding the use of robots as you are suggesting, but in another context.

    The other problem is the concept that people just can't live in space. What is going to need to happen for space flight to be exciting again like it was in the early 1960's is to have people up there sticking their nose in places that nobody has ever been to before. A color television just doesn't do the same justice as a human eye, noticing subtle stuff that you would just miss on a monitor. The geology that Harrison Schmitt of Apollo XVII did on the moon just couldn't be duplicated by sending a Viking-style probe to the moon, grabbing a couple of rocks, and coming back to the earth. Much of what we know about lunar geology is due to the efforts of the last three Apollo missions.

    It is also unavoidable that people MUST eventually get into space. To doom humanity to this little chunk of rock in an obscure backwater arm of a rather ordinary galaxy is, in my opinion, a great waste of the amazing potential of mankind.

    Finally, there is the often quoted phrase "LEO (low-earth orbit) is more than halfway to the rest of the Solar System." If you get a strong human presence in a low orbit environment, it will be essentially trivial to travel anywhere else in the solar system, including Mars, the Asteroids, etc.

    Mind you, I am not saying that there wouldn't be tasks that couldn't be done via remote-control. There will be stuff like this, and where appropriate it should be done. Just don't openly dismiss the fact that this is the only option that should be considered.

  101. Northrup Grumann Stumping for Boeing? by Falshrmjgr · · Score: 1

    Why does the Northrup Grumman design feature a Boeing Logo? you can just make it out on the top!

    --
    "I wasn't using my civil rights anyway...."
  102. We don't need another shuttle! by wronkiew · · Score: 1

    The Space Launch Initiative is the wrong way to go. Even if NASA picks a design and builds it, we will just end up with another inefficient government-run launch system that costs 10 times as much as anyone else's. Why are we letting NASA control access to space? Why do ordinary Americans have to go to the Russians to get into space? This SLI business is just another example of big, dumb NASA trying to do things the only way it knows how, and messing up the US launch market in the process.

    So how should NASA get a new rocket? NASA should invest in American businesses who have good ideas without trying to control them, and they should pay American companies (maybe Russian companies?) to send their astronauts into space.

    Foozone.org
  103. Buddy, your foil hat ain't working. by Thag · · Score: 2
    Another "The Shuttle Sucks - But My Hypothetical Saturn-5-Moon-Colony Idea Rules"


    Except that I didn't propose a Saturn V or moon colony.

    See the trouble was that the US Public diden't give a shit about the Saturn 5, only the Military/Airplane companies had the clout to get somthing though a Congress that would rather spend money feeding retards.

    I wasn't debating history, I was saying it was a bad call, for reasons I stated which you have failed to refute.
    So yes, your Saturn 5.1 would have been great - by it never would have been built. I'd rather have the crappy shuttle that is actually running, than somthing that never would have gotten off the crayon drwaing board.

    Again, I never proposed building a Saturn V.I. I simply pointed out that the Shuttle program failed to meet its own stated goals, and not by a narrow margin. And again, Saturn V, at the time the decision was made, was already off the drawing board and in production.
    So become Benovelent Dictator of these United States - and eventually the Satrun 5.1 will get built. And we can go meet the moon people.

    Or travel to far-out Planet You.

    Jon Acheson
    --
    All opinions expressed herein are my own, and not those of my employers, who are appalled.
  104. Re:BDB is the answer. Works for RUS. by Zeio · · Score: 2

    Hey, if LEO is what the requirement is, then just get is there. I agree - SV is ugly but it works. This fancy schmancy stuff isn't paying off, as RUS sends stuff into space all the time, most recently for Direct TV:

    Russian rockets idle Òåêñò: Ivan Ivanov [ http://www.gazeta.ru/2002/05/08/USbetrayalle.shtml ]

    Russia's heavy-lift Proton-K rocket successfully took off from the Baikanur cosmodrome in Kazakhstan on its second commercial flight carrying the US communications satellite DirecTV-5. The second commercial Proton-K flight may well, however, be the Russian rocket's swan song, since the ILS launch service provider, which exercises the exclusive right to use the Proton carrier, has expressed a preference for American rockets.

    The Proton-K carrier was to take off from the Baikonur launch pad at 2100 Moscow time on May 6. However, owing to technical problems the launch was cancelled only two minutes before the scheduled blastoff. The launch was put back 24 hours, and at 2110 on May 7 the rocket successfully blasted off into space. Several minutes later the US DirecTV-5 satellite was safely positioned in its orbit.

    According to RIA-Novosti reports, the orbit parameters are of a maximum distance of 245km from Earth and a minimum of 198km. Russian Space Force's experts said that once placed into the orbit, the satellite will then move into the interim orbit, and later into the target orbit - the so-called high elliptic and circular orbits with altitudes ranging from 700 to 40,000 km. In line with the experts' estimates, the satellite will hit the target orbit at 0332 Moscow time on May 8.

    In comments for RIA, a Space Force specialist noted that the 4.3-ton DirecTV-5 communications satellite is designated to provide digital television services to customers in North American. Its payload amounts to 48 powerful transponders. The satellite will be taken to a geostationary orbit where it is expected to work for no less than 15 years. The device is meant solely for telecommunications and will not be used for military purposes.

    International Launch Services is a joint venture of Lockheed Martin Corp. in the United States, with Russian companies Khrunichev State Research and Production Space Center, and Rocket Space Corporation Energia. The company was formed in 1995 to provide launch services for the American Atlas and the Russian Proton vehicles for customers worldwide.

    Tuesday's launch was Proton's second commercial flight this year. In December last year, director general of Khrunichev Alexander Medvedev optimistically said that in 2002 his company planned to launch at least 9 commercial flights jointly with the ILS. In addition to that, the Khrunichev Centre planned to carry into space the European astrophysical observatory Integral, Russian communication satellites Express A-4 and Louch, three navigation satellites for GLONASS system, and several military satellites. (Note: GLONASS -Global Navigation Satellite System- is a satellite based radio navigation system which provides an unlimited number of users with all-weather 3D positioning, velocity measuring and timing anywhere in the world or near-Earth space). Altogether, Khrunichev planned to carry out 15 Proton launches this year. That would set a new record for the number of Proton flights, with the current record of 14 flights being set in 2000.

    But in the first four months of the current year Proton has been launched only twice. In April, the Russian rocket travelled into space with the communication satellite Intelsat-903 and the DirecTV device on its second flight. To all appearances, the 2000 record will remain unbroken in 2002, since the ILS failed to secure the planned number of orders for Proton.

    It is expected that by the end of the year Proton will have placed only two more commercial devices into orbit - the US EchostarVIII (launch scheduled for June 16) and the European Astra-1K (August 16). The launch of the US communications device GE-12, earlier planned for the 4th quarter of 2002, has been postponed till 2003.

    Four more satellites will be travelling into space in the near future, but not on board Proton. Only one of those has ''flown the nest'' from Proton to other launch service providers: the owners of AtlanticBird-1 have decided against using Proton and are instead considering Europe's Ariane or the US's Delta-IV as alternatives.

    As for the other three satellites, ILS has decided not to launch those on board the Russian carrier, but on board the US rocket. Asiasat-4 is to travel into space on board Atlas IIIA in June, while European HotBird-6 and Canadian Nimiq-2 will be on board Atlas V, the new carrier of Lockheed Martin, in July and October respectively. As a result, the Russians will not receive the $340 million revenue it had forecast.

    By jumping ship to other carriers it seems that ILS has made a conscious decision to give up cooperation with Russia altogether. As long as Lockheed Martin only had the Atlas II carrier, which was not exactly renowned for its lifting capacity, the ILS used Proton carriers to launch commercial satellites into space, which allowed it to retain its market share. But as soon as the US company learned to produce the more powerful Atlas III and Atlas V launchers, ILS started to award contracts primarily to them.

    The future now looks bleak for Proton. Paradoxically, the producer of Proton, the Khrunichev Centre, under their agreement with the founders of ILS, does not have the right to enter into contracts with foreign customers. Moreover, ILS has the same exclusive right for the use of another Russian rocket Angara, also developed by Khrunichev, therefore, the same sad fate is likely to befall that carrier, too. Thus, it seems, the Americans, who have retained their market share with the help of Proton, are set to seal the fate of the Russian rockets.

    08 ÌÀß 17:50

    --
    Legalize the constitution. Think for yourself question authority.
  105. The physics of dirt by oneiros27 · · Score: 2

    It's an interesting theory, but there are some benefits of metal that you don't get from rocks. For one, if you import metal, it's all of a known quality. With on site rock, you're taking a significant risk--

    Is the rock porous? What sort of loading can it take? How risky is it to mine?

    Once you have this sort of information, you can determine the risks of attempting what you're suggesting. There may need to be some sort of a sealing process to prevent permeation, and an ultrasound scan to determine if there are any fissures to be worried about. [which they'd have to constantly re-check while mining, and after every major meteor hit in the area].

    I do see it as being a definate possibility for living, however, due to the risks involved [ie, accidentally breaking through to a cave which is connected to the surface, and causing decompression], I would assume that they'd want to set up a preliminary construction camp from which to build the caves.

    --
    Build it, and they will come^Hplain.