Slashdot Mirror
Stop Global Warming With Smog?
lkypnk writes, "The AP is reporting that Nobel Prize winning scientist Paul Crutzen has suggested deliberately spreading a layer of particulate matter in the upper atmosphere to help reflect some of the sun's energy in an effort to combat global warming. He reminds us that the eruption of the volcano Pinatubo in 1991 cooled the planet by as much as 0.9 degrees; he believes his computer simulations show a similar effect from deliberate injection of sulfur into the atmosphere by humans. Whatever the feasibility of the idea, as the president of the National Environmental Trust has said, 'We are already engaged in an uncontrolled experiment by injecting greenhouse gases into the atmosphere.'" From the article: "'It was meant to startle the policy makers,' said [Crutzen]. 'If they don't take action much more strongly than they have in the past, then in the end we have to do experiments like this.' ... Serious people are taking Crutzen's idea seriously."
This eerily reminds me of the dark sky in "The Matrix"...maybe life DOES imitate art
Infinite time means everything that can happen, will. You being you is absolutely incidental. You do not exist.
NOVA did an excellent episode about this. The theory is that pollution is greatly masking the effects of global warming.
Stop the increase of the climate change from CO2 pollution, with more pollution!!!!!!
Although there is probably some good science behind the idea, there was also good science behind the idea of using the Cane Toad to kill the Cane beetle, and that worked out well for everyone didn't it.
The effects of the eruption were felt worldwide. It injected large amounts of aerosols into the stratosphere--more than any eruption since that of Krakatoa in 1883. Over the following months, the aerosols formed a global layer of sulfuric acid haze. Global temperatures dropped by about 0.5 C (0.9 F), and ozone destruction increased substantially.
from http://en.wikipedia.org/wiki/Mount_Pinatubo
This has been kicked around for a few years, at least. I remember reading it in Thomas J. Elpel's "Direct Pointing to Real Wealth", which is very out-there and hippieish. As such, I'm mildly surprised it's news at all to a science-minded website such as this one.
Perhaps life really is full of possibilities.
killing the paitient to cure the disease.
We're already doing this, though again, it's in an uncontrolled way. It's called "global dimming", and it's already an environmental disaster in some parts of the world.
Attack its weak point for massive damage!
We are already engaged in an uncontrolled experiment by injecting greenhouse gases into the atmosphere.
So why not make matters "better" by starting a second, uncontrolled experiment?
Seven puppies were harmed during the making of this post.
A few weeks ago (here, on slashdot) they wanted to pour sulphur or something into the atmosphere, now smog?
What part of "the earth is 2/3rds water, which evaporates, naturally, the warmer the planet gets, covering the planet in CLEAN, NATURAL, REFLECTIVE, WHITE, FLUFFY, clouds of water vapour" do these brainiacs not get?
Ever been outside? On a hot day? And had a cloud drift over. Ever felt the blessed relief as you race your bicycle up a 12km, 7% incline, maxing at 22% and felt the cooling effect as the sky becomes more overcast, shielding you from the burning rays of the sun and providing a UV protection of up to 50% compared with clear skies?
Quit trying to add stuff to the atmosphere, it's where the problems started in the first place.
The only thing they should be adding to the atmosphere is the leaves of the trees they plant. And lots of them.
.. that's when we call in Godzilla.
This is nearly a dupe of another Slashdupe story which was up not so many days ago.
Akvo.org - the open source for water and sanitation
I mean, if we for example trigger the climate into an ice age kind of way then its going to be really bad. I don't think it is a good idea to try and fuck with mother nature because she will only need to fuck us once and we will be gone where the dinosaurs roam.
Maybe we should just accept the impacts of global warming instead of trying to cover them up too early. It has taken several years for the policymakers to quit their denial phase and at least acknowlege a problem. If a quick hit can slow the warming for a while then everybody will be encouraged to continue profligate carbon consumption for another few years or a decade. Every delay we induce in the current impact will make the subsequent situation worse. Instead, let's start adapting now so we don't have as much disruption later. Ya know, maybe if we have to change our lives to adjust we will ask how we can actually reduce the problem. What a concept!
I knew I've read about that on Slashdot before.
If you follow the link in the old Slashdot story, you'll find out that it's indeed about Paul Crutzen's idea as well.
The Tao of math: The numbers you can count are not the real numbers.
Volcan eruptions tend to throw a staggering amount of rock & dust into the air ... that's no easy feat to emulate. Compare the energy output of the Mt St Helens eruption with modern nuclear weapons for example.
This paper predicts (as do many solar scientists) that the next two solar cycles will be much weaker than has happened for more than 100 years. If that happens the temperature will drop an average 1.5C which is what happened during the "Dalton Minimum".
That cool enough for you?
In 20 years time, they'll be praying for global warming.
Tubby or not tubby. Fat is the question
FWIW, I came out for something like this last April.
Shading the Earth won't get rid of the direct effects of excess CO2, such as ocean acidification and preferential growth promotion of undesirable plants like woody vines vs. trees. But the beauty of injecting a few million or tens of millions of tons of sulfur in the upper atmosphere is that it spreads out much more widely, the effects will reduce drought and heat stress which are killing plants and turning land into desert, and you might even cut the original pollution by taking the sulfur from some existing source.
Cutting heating and stress on plants looks like it reduces the CO2 problem directly, by enabling better CO2 uptake. If you don't believe me, take a look at the Keeling curve and tell me what else could explain the flattening in the two years after Pinatubo. Take your time, I'll wait.
Sustainability and energy independence essay
http://science.slashdot.org/article.pl?sid=06/09/1 9/2022220
This just in: NASA engineers have desided to stop global warming without more chemical experiments. They are going to put a semi-transparent sun shade in orbit around the sun. It will evenly block 30% of the suns rays from hitting the earth. Says Pizpot, a Slashdot reader, "Why didn't I think of that"?
Photochemical smog is the product of reactions between hydrocarbons, oxides of nitrogen and ultraviolet light. Smog contains ozone. This has almost nothing to do with smog.
Sustainability and energy independence essay
> When you program a computer model to raise the temp when you increase CO2, the computer program will tell you the temp will go up when you raise CO2.
So, what part of the physics of greenhouse gasses do you reject?
> We can't predict weather 5 days out with our current computer models, how could they possibly predict these other trends?
For a lot of phenomena it's far easier to predict the longer-term trends than the shorter-term details.
Sheesh, evil *and* a jerk. -- Jade
Filling atmosphere with something.. hmmm.. Why does this bring "Mad Scientist" into my mind?-)
When will people stop using this silly argument?
Do you know if in ten days it will be warmer or cooler than now? Probably not.
Do you know if the next summer will be warmer than the next winter? If you live in the northern hemisphere, at a sufficient distance to the equator, I'd bet on it.
So how can we know that the summer will be warmer than the winter if we can't even tell the temperature change in about ten days? Think about it!
The Tao of math: The numbers you can count are not the real numbers.
Global dimming either from this or other means (like sulphate aerosols) will only result in less light reaching the surface. Yes it will result in less warming. But also there's less photosynthesis, less crop production, and a reduction in fixation of CO2 from the atmopshere, causing CO2 levels to rise yet further. Instead of trying to fix the symptoms, we should be trying to fix the underlying problem and that is ceasing to burn carbon. The fix is simple. Replacing it with something else is the real problem and that is where efforts should be focused (like a decent fusion reactor and hydrogen economy but that's a whole new debate)
So we have the global warming research crowd which lives and dies by the research grant, and we have the anti-global warming crowd which lives and dies by funding.
And there's the global warming mitigation crowd who wants to create fame or money solving the problem.
This whole argument is based on the highly-attested theory that global warming is in fact occurring. There's numerous evidence that global warming is a fallacy. I'm not saying which side is correct, but basing this theory on another theory (which may or may not be true) is not a wise idea.
Reading comprehension.
This is slashdot, not a college campus.
Ever see the conspiracy sites regarding "chemtrails?"
A few years ago the government publically tested (google, you'll find government web sites covering this, and it's far less insidious than what the conspiracy nuts suggest) certain particulates and their effect on weather patterns. Between this and cloud seeding, there isn't really anything new or earth-shattering about the idea.
The question is: how do you spread enough particulate matter? It would take many, many aircraft and tremendous amounts of fuel to distribute such matter - PLUS the matter needs to be inert/non-toxic (so using fissionable nukes is likely not an option).
Another option is to perfect nuclear fusion devices (so that no fission reaction is required to spur it) and look into the potential using those devices to induce volcanos to erupt. Not very practical no matter how you look at it, considering that the power of natural explosive volcanic eruptions (Mt. St. Helens, Vesuvius, etc.) dwarf even our largest nuclear devices.
It's an interesting solution, the problem is how does one go about getting enough inert fine particulate matter high enough in the atmosphere to a) remain suspended for any length of time and b) effectively reduce IR without reducing the UV that plants require for photosynthesis?
The Christian Right is Neither (Christian nor right). See: Matthew 23, Matthew 25, Ezekiel 16:48-50
Didn't this happen on Futurama once and it all went horribly wrong? Did robots fart? itsatrap, for sure - don't let that Nobel Prize mislead you...they can be deadly (reference: Simpsons episode "Bart Gets Famous" where Lisa impales Bart on her Nobel Prize but I couldn't find a screencap *do'h*)
Hmm, this kind of reminds me of when they introduced a species of animal into Australia that didn't belong there to combat another animal, then that animal thrived and caused more harm than good. When you make a soup too salty, you can't very well add more stuff to make it taste right. You gotta ditch it and make a new soup. We can't really ditch our atmosphere and start over, but we can definitely stop putting more crap in it before it's too late. I dream that my kid's first car will be powered by hydrogen fuel cells and spit water out the exhaust pipe.
"There is no Honor, without Pie."
-Weeble
Without light surely our plant friends won't be able to soak up the CO2 at ground level.
Engineering is the art of compromise.
Or, put another way, it's simply harder to disprove long-term claims by the global-warming crowd since their scare tactic is based on something that even they say won't happen for a long time. For now I'll stay firmly in the 'no way we can tell what's going to happen' camp; which is not to say that pollution is acceptable, there are plenty of provable local effects (smog anyone?) which tell us that reducing the crap we spew into the atmosphere is a good idea.
I'm just not buying into the doomsday prohpecy or the draconial measures that the global warming PAC wants to apply to first world nations while completely ignoring the actions of third-world nations (kyoto). These types of things fly directly in the face of any claim that the issue is about global, rather than local, impact.
* I drive a prius, fwiw.
All these drastic actions that do more to mess with our environment are reckless. We barely understand that we don't really understand the complex feedback systems we've already upset. We have a much higher confidence that merely reducing our Greenhouse pollution will at least buy us time to learn what we can do to stay in the climatic "sweet spot" in which we've evolved our civilization.
Not to mention that producing all these extra artificial climate "enhancements" will produce a lot more pollution in their industrial processes. And use the existing political economics players, in manufacturing and energy, who have shoved us down the road to the Greenhouse with reckless abandon. They will screw up any complex/delicate procedure if it means more fast money, regardless of the worse consequences that they'll have to share (except the really old capitalists who'll die before their legacy is inherited).
Startling politicians, who understand Climate Change only as a buzzword tradeable on the open market, with visions of increasing pollution to fix the climate hazards that pollution has created is a terrible way to do business. It will just lock down their fear and greed. The reptile brains that survived the last climate change cataclysm, wrapped in mammal bodies. I don't want to go the way of the dinosaur, especially by voluntarily throwing myself to the Tyrannosaurus Rex who represents the fossil fuel industry.
--
make install -not war
Ever been outdoors on a clear spring or winter night? It's colder without clouds. Clouds hold in heat on the night side.
Low-level clouds shade the ground but the reflected sunlight just warms up the lower atmosphere on its round trip. Very high clouds have a cooling effect, though.
Fortunately, the work on climate change is being done by people who understand these effects and who observe and refine numbers for them.
I think he took this idea from Highlander II: The Quickening, but in that movie it was a pollution-like shield to protect the earth after the depletion of the ozone layer.
Well, nature is among the most complex systems we're aware of, so it's always extremely hard to claim an idea and easily see if it'd work. The obvious question this idea raises to me is for example: how would the reduced solar energy affect wildlife, and what chain effects would that have to nature, both as for animals and plants?
Beware: In C++, your friends can see your privates!
it seems to me that the earth has already started to work on this approach on it's own.
over the past few years as the ocean temperatures have increased, so has the techtonic activity. the number of earth quakes have been on the increase. i would speculate that an increase in volcanic eruptions will be next.
the question will be what effect this will have on humans?
Great so we lower the temp of the planet while we kill away plant life and the insects that go along with it.
by TheSpoom (715771) Uncaring Linux user here. I have nothing to add to this but please continue. *munches popcorn*
The problem though with any clever ideas like dumping reflective stuff in space is that, if the modelling is wrong ("oops! missed a minus sign!") then the clean-up efforts to go fetch all the stuff back is going to cost quite a bundle and make more environmental problems than we had before we started.
Engineering is the art of compromise.
"Don't these scientists learn anything from the movies, Matrix or Highland 2 anyone?"
They did, but the episode of the Simpsons where the rogue comet melted in the layer of pollution over Springfield was far more popular.
Remember: Simpsons reference > Matrix reference.
"I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)
On one hand we're being told that having CFCs and other things around the earth produces "greenhouse effect" and traps heat. Now they are telling us that things in the atmosphere don't do that, they reflect away the heat.
So which is it? Or do some things reflect while other things insulate? Do we need to mix the coctail properly to get the desired effect?
Besides, if global warming is a problem, why are they looking for ways to make it warmer?
I work for the Department of Redundancy Department.
This is much like Tylenol - lowers body temperature and temporarily removes pain, but doesn't cure the symptoms.
Simpy
> Or, put another way, it's simply harder to disprove long-term claims by the global-warming crowd since their scare tactic is based on something that even they say won't happen for a long time.
On the contrary, it has already been going on long enough for us to observe the consequences.
Sheesh, evil *and* a jerk. -- Jade
While, i will grant that global warming is just a "theory," claiming that this is a valid argument for not trying to develop another theory is quite simmiliar to people who claim that evolution is just theory a and therefore we should neither continue teaching it nor researching speciation, the fossil record, and genomics - without the theory of evolution, those that study these aspects of earth's biology would have nothing to theorize about. This line of argument is neither helpful nor meritricious.
The evidence pointing toward episodic global warming is very compelling, especially when seen in the hockey stick graph, for those of us who understand visual representations more than verbiage. Global warming, though just a theory, is pretty well established, where the question really lies, and why this atmosphric blanket might need to be further researched is, how much impact are humans really having on the climate? Granted, there is evidence that humans have already managed to divert a global ice age, so it is unlikely that we aren't completely benign, this does not mean that the current warming has as much to do with us as we would like to think. The earth has natural cycles of warming and cooling, so, although I agree that we should cut down emissions, and try to be a little less environmentally impactful, we also need to figure out wether this current relative warmth is due to our noxious by-products, or just part of a natural cycle that has existed for billions of years. On the one hand, humans are highly destructive creatures and should be aware of the harm they cause Gaia, on the other, we are also too proud and need to stop internalizing our locus of control to the point that we loose our pragmatic perception of what is really going on in the world.
Most green house gasses stay in the atmosphere for a long time (10-100 years). "Smog" stays up for a much shorter period of time so we would have to keep pumping ever larger amounts of it into the atmosphere daily to offset the green house gasses. That is very unlikely to tenable for a significant length of time.
Predicting climate is different from predicting weather. I cannot tell you whether Chicago will have a white Christmas (weather prediction), but I can tell you with a lot of confidence that Christmas will be colder than the 4th of July even a million years into the future (climate prediction).
Climate models are not tricks. The physics goes in. The climate comes out. It's not a trivial curve-fitting exercise the way you seem to think. We call them "primitive equation" models not because they are primitive, but because we *don't put the answer in* in any way. The model isn't told that Chicago winters are cold and Florida winters aren't. It *figures that out* from the physics.
mt
- Add Sulfur to atmosphere to maintain global temperature.
- Greatly decrease the pH of precipitation.
- Disrupt world plant ecosystems with soil pH modifications.
- People die.
Use a different material; create a different way for people to die.A parallel: patient is suffering from atherosclerosis. Do you:
- A: prescribe a change to the patient's current 50% fat diet, or
- B: prescribe medication to balance the muck that the patient is pushing into his vascular system?
A little bit of both, one might say. Well, that is a very costly and risky ("Warning: side-effects may include nausea and death.") approach, which may well become necessary when there is no other option. The reason we typically get to that point of no return is because we consistently refuse to be proactive and solve the problem early and in the right way. "It's just too hard to change my diet." "It's just too hard to cut our emissions. Jobs will be lost. Oh, dear me. Oh! We can start an industry that pumps counterpollutants into the atmosphere. More jobs. More money! More! More!"Genius.
FTFA: A massive dissemination of pollutants would be needed every year or two, as the sulfates precipitate from the atmosphere in acid rain.
Oops.
I image that the climatoligists are discussing the problem of acid rain, but I must have missed it.
[Fuck Beta]
o0t!
Or, to be a little more accurate as to how the process works, when you program a computer model with the currently established physics (including things like, say, the absorption spectra of atmospheric carbon dioxide) and various known positive and negative feedbacks etc., the computer program tells you that the temperature will increase when you raise CO2.
There is, of course, a vast difference between predicting immediate changes at a very local scale, and predicting general trends on a wide (in this case global) scale. I can't predict whether a particular line of chips will have more transistors packed onto it or not, but that doesn't mean Moore's law hasn't been quite effective over the last decade.
Craft Beer Programming T-shirts
That's exactly how Dinosaurs (the muppet series) ended, Earl Sinclair proposed covering the earth on smog because of some plague of tropical weed, and then the earth froze and the dinosaurs extinguished.
I live in Australia, here are some recent anecdotes:
We are currently experiencing the "worst drought in 1000yrs", the Murray-Darling Basin has dried up, our major cities have permenant water restrictions and some rural towns are being abandoned. This years forecast grain harvest has been reduced by 50% (-12,000,000 Tonnes), our dairy herd has been culled by 20%, and half starved livestock have flooded the markets in expectation of an even drier summer.
We had a record heat wave in october (37C) followed by two cold snaps with snow falling on bushfires and hail the size of cricket balls. The unseasonal frost killed, apples, pears, grapes and other temperate fruit crops that flower in spring. Oh yeah, a cyclone wiped out our bannana crop earlier this year.
As for TFA: The Earth is not a fucking toaster, the last thing it needs is a "darkness knob".
And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
I certainly hope this is just to fire the proverbial rocket up the arses of the policy makers, otherwise this is insane.
Its one thing to toy with nuclear particles in underground labs or swap super virii collections. But at least *when* mistakes are made they are relatively self contained within a small geographic area. Think about all the major industrial/mechanical "accidents" claiming countless human lives that could have been prevented in hindsight by humans.
If someone in my local area/state/country is allowed to do those things I usually get some right of say. A vote, a protest or a chance to move away.
But I think it is outrageous and unforgivable to allow a global experiment that can affect the entire human race. We have enough man made catastrophes affecting entire countries without deciding to take the entire world out. To simply add to a recognised problem is simply ludicrous.
There is NEVER a guarantee a solution will work, no matter how well intentioned or thought out. Especially of this scale. But there always a very good chance it will have an adverse affect down the road. We always seem to justify its ok to fix something because we want it to work NOW, at the expense of LATER.
Only repetitive testing gives you a level of comfort with an outcome that you are willing to accept something as safe. Pharmaceutical drugs go through many years of trials, and still sometimes they are withdrawn after years of common usage.
Lifting the haze (pun intended) on all the media and political hype, global warming is not cut and dried. Even if it is 100% true (ie. a recent man made phenomenon), the earth, being the living organism it is, is healing itself the way it knows how. But if we go panicking and pouring more fuel on the fire, earth's backlash may be even more severe.
From years in the software biz, the correct solution is ALWAYS to fix the ROOT CAUSE. Anything else is just denial.
Why don't they just suggest we kill ourselfs off as its certainly humans creating the global warming problem.
I saw on PBS a show on the darkl ages of the 1500's that was likely a volcano explosion in teh indonesia area. It caused the darkening of the sky for some decade or three. Such that daylight was short and heavily masked by the cloud of sulfer covering the planet, It wasn't a healty or abundant farming time for humans.
Principal Skinner: "Ah that's the beauty of the thing, come winter the Godzillas will freeze to death."
--
The last digit of pi is four.
Anyone who needs evidence science is an inexact science need only remember Carl Sagan and his wrong prediction on the Kuwait oil fires.
Sagan famously predicted on ABC's Nightline in 1991 that smoky oil fires in Kuwait (set by Saddam Hussein's army) would cause a worldwide ecological disaster of black clouds resulting in global cooling. Retired atmospheric physicist and climate change skeptic Fred Singer dismissed Sagan's prediction as nonsense, predicting that the smoke would dissipate in a matter of days. In his book The Demon-Haunted World, Sagan gave a list of errors he had made (including his predictions about the effects of the Kuwaiti oil fires) as an example of how science is tentative.
And that prediction explicitly about the effects of something on our atmosphere, ostensibly by one of our most noted intellects. The notion that we have any notion of what the effects of this effort would ulitmately be is indeterminant, and could introduce far more disastrous and devastating unforeseen results.
Good grief, where the hell have you been. I thought that level of ignorance was peculiar to the 1990's.
Weather != Climate: Climate is the long term statistics of weather.
Computer models: The computer chip that allows you to display your ignorance would not be possible without computer models.
And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
... thus solving the problem once and for all.
But-
ONCE AND FOR ALL.
Seriously though, wouldn't it be great if global warming happened but nuclear winter canceled it out?
Ok, put on your tinfoil hats. I suspect this is already going on. It's quite an obvious solution when you think about but one which environmentally would never be supported.
http://www.chemtrailcentral.com/
I'm not saying that's the definitive website but I think it's worth thinking about. Ok, now reach for your -1:looney modpoints.
spoonerize "magic trackpad"
If you'd like to do some of the experiments discussed in the article yourself, the EdGCM project has wrapped a NASA global climate model (GCM) in a GUI (OS X and Win). You can add CO2 or turn the sun down by a few percent all with a checkbox and a slider. Supercomputers and advanced FORTRAN programmers are no longer necessary to run your own GCM. Disclaimer: I'm the project developer.
Space and Computers.
I've said this before, but not only would iron fertilization sequester tremendous amounts of carbon (100,000 K for every 1 K of iron used in the desolate zones) but cyanobacteria produce DMS which creates cloud cover. You don't have to distribute anything.
___
It's the end of my comment as I know it and I feel fine.
..as we alternate year over year with using Sulfur in odd numbered years and Baking Soda in the even number years. This would also enhance the general SMELL of the place, keeping it fresh and preventing food odors from mixing on a global basis.
The problem with quotes on the internet, is that nobody bothers to check their veracity. -- Abraham Lincoln
This hair-brained scheme is not endorsed by your average climatologist, which are more interested in studying climate than playing politics anyway.
Throwing that much SO2 in the air is indeed asking for trouble. For starters, it won't save the Greenland and West Antarctica ice caps from melting (a planet with SO2 + CO2 will be much warmer at the poles and slightly cooler at the equator). There's probably plenty more wrong, but that alone should be reason enough shelve this proposal.
Great...who wrote the article?! I have some ideas.
Blocking off the sunlight used by the ecosystem, global agriculture, ocean/forests, orchards, etc, in order to stop the side effects of industrial pollution (e.g. global warming) sounds like a bad idea.
The world DEPENDS on sunlight: Sunlight feeds algae, algae feeds plankton, plankton feeds fish, fish feed US (as well as other fish, whales, birds), crops need sunlight, PEOPLE need sunlight...sunlight DEFINES the seasons.
If everybody prayed and asked the LORD nicely, and thanked Him for what we HAVE, that global warming would just vanish. Who believes THAT? (I do, for one)
"Forgive us our trespasses, as we forgive those who trespass against us." -Jesus Christ The Lord's Prayer
NASA stole #3 and now a Nobel Prize scientist just stole #1. Wonder if there is still time to get a patent on idea #2, my personal favorite, before someone else steals it. Never realized before that there was a market for insanely stupid ideas. Time to write up that business plan
No not really. We only have accurate climate data back maybe 100 years, and before that most of it is just generalized references in written documents. The truth is that myopic folks are looking at a tiny, tiny span of data and ignoring that the earth climate is subject to forces and influences that cycle over thousands or even millions of years. Looking at the bigger picture, we can see that the earth has been slowly warming since the ice age. They are just now admitting that the "ozone hole" appears to be cyclical and is actually getting smaller despite the increase of CFCs which they claim caused the problem.
This is just silly. What physics? The well understood effects of high and low clouds, changes in solar radiation, cosmic rays, heat flux into and out of the ocean, I assume? Oh, wait, we don't have a clue about any of that...
"Stop Global Warming With Song?" I did. and I'm not dyslexic. I guess the von Trapp really can save the world.
Dr. Crutzen, the atmospheric chemist that proposed the idea of deliberately spreading a layer of particulate matter in the upper atmosphere is himself "not enthusiastic about it," and that it was meant more for shock value. That's what is interesting about the scientific community. Sometimes if an idea could work it will still be suggested no matter how far out it seems. It's only a hypothesis that is placed on the table to be tested and researched if there is interest. Who knows, it could slow down our problem, it could speed it up.
u s_climate.html) In this article (replace anywhere where it talks about continental drift with plate tectonics as that is more accurate) the author outlines atmospheric CO2 levels corresponding to global temperature in the "Global Temp. & Atmos. CO2 over Geol. Time" graph. We are today most like the carboniferous period with our temperature and CO2 levels. The mesozoic had all the dinosaurs and look at the CO2 levels. Large animals eat small animals that eat plants that thrive on CO2. Plant life was incredibly abundant to soak up all that CO2.
Politics, however, can drive some scientists to look for a question instead of an answer. They already have the answer they want. I like to think that doesn't happen too often. The greater mixing of science and politics here is, when a scientist (and hopefully a scientist that is actually a specialist in the field they are reporting on) reports possibilities to uninformed officials they can take one of the possibilities, or predictions, for prophecy. Science is never 100% certain. It can get close though.
Yes global warming is real. The earth changes over time. We have not always been this temperature and we all know that. CO2 levels have also greatly fluctuated through time. (Similarities with our Present World URL:http://www.geocraft.com/WVFossils/Carbonifero
The problem now is that we don't know what will happen next. We aren't sure if history will repeat itself as we are now getting warmer by getting incredibly more warm, or if this interglacial period will only continue into another full on ice age. Yes, volcanoes and other natural phenomena add to climate change (earth's interaction with the sun; and even though on average volcanoes only emit at most 3% of a years CO2, large single eruptions like Pinatubo can emit at least the amount of CO2 produced by the US in a single year: those volcano numbers are a little fuzzy so feel free to correct me on them), but we are adding to it with our industry. We've had to rely on fossil fuels till now because we didn't really have much better choices for the last few centuries. But now we have do. We can certainly change our ways and cause much fewer harmful emissions, but unfortunately it may come down to whether moneymakers think it is worth the effort and cost to switch away from todays fuels (which will definitely be a costly and world changing effort).
So did we really tip the iceberg? or was the earth going to do this anyway. You tell me.
If you want to combat global warming by getting less sunlight on Earth, I'd much prefer the NASA way where they'd put a variable size dark disk in orbit at a Lagrange point between the Earth/Sun, because you can always click "undo" on that, or just tell it to shrink the umbrella to nothing realtime. Injecting more crap into our atmosphere will just make things more complicated, and taking the stuff back out is not at simple, let alone getting realtime control on the effects.
Ack! Please stop talking about this! The last thing we need is ignorant, suburban SUV drivers thinking that they're actually helping the planet!
Ozone in atmosphere = good
Ozone at street level = doubleplus bad!
I know this, you know this, but soccer dad thinks "oh, I'd better turn on the air conditioning to help global cooling!"
- RG>
Hey pal, this isn't a pleasantforest, so don't waste my time with pleasantries!
The basic problem is this:
1) Global warming is complex, and can not be undeniably explained to a normal person.
2) Therefor: The only way to tell the veracity of global warming is to examine the messenger.
3) The messengers all have huge biases, either for or against.
4) Therefor: There is not enough information to act upon.
Thing like this anouncement help fight against this, because you can't exactly call someone who is calling for world-wide polution a tree hugger.
Well, maybe a tree hugger on (sulfuric) acid...
while (sig==sig) sig=!sig;
I wonder how feasible it would be to send a space ship into orbit around the Sun such that it is directly in the path of light directed at earth. At that range a relatively small screen of reflective foil could block a considerable area on earth and could be used to regulate temperature by deflecting or concentrating light in different places. The ship would be powered by using the screen as a sail to catch solar radiation and position itself appropriately. It could also be used to cool oceans in the path of Hurricanes thereby decreasing their power.
While I am not exactly sure about the whole "reflective clouds to cool the planet" idea, I do know that clouds of phosphate would be a much better idea than sulfate. Phosphate "smoke" (from burning white phosphorous with oxygen) is highly reflective and is often used as a smoke screen. When sulfate is dissolved in water you end up with sulfuric acid, the causative agent of acid rain. Phosphate in water does not form such a strong acid and is in fact a fertilizer. As the phosphate came out of the atmosphere we would end up with a slight increase in the nutrients in the land and oceans (though diluted over the entire surface of the planet the effect would be minimal).
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
considering the maths on c02 and global warming doesn't point to man made warming, it's fucking premature to be spraying sulphur into the air. they always like to quote 1998 - 2001 as the hottest years on record, what they don't like to tell you is that it's a fact that 40 - 60% of the extra heat was attributed to increased solar activity.
If you mod me down, I will become more powerful than you can imagine....
Iron is the limiting factor in the desolate zones of the earth's oceans (which are all far away from shore.) Fertilize the earth's desolate zones with iron. 1K of iron is enough to fix 100,000K of carbon due to algae growth. Also, cyanobacteria produce Hydrogen Sulfide, which leads to cloud the formation of nice white puffy clouds. And it does it far out at sea where acid rain isn't a problem. This would kill two birds with one stone.
Tests have already been done re: feasibility, but the possibility of trading carbon credits in a new market looked to be a huge source of funding for folks like Enron. And nations with less industry would rather not have to compete with the industrialized nations.
___
It's the end of my comment as I know it and I feel fine.
Climate models are not tricks. The physics goes in. The climate comes out. It's not a trivial curve-fitting exercise the way you seem to think.
Really? Because last time I heard, random data goes in and hockey stick graphs come out. Yeah, it seems the climate models produce hockey sticks regardless of what you put in them, physics or otherwise.
If we didn't have a clue, friend, the climate models wouldn't work.
The climate wouldn't emerge from the primitive equations. Simulated rain wouldn't fall in wet places and would fall too much in dry places. The simulated jet stream wouldn't meander where the jet stream meanders. The simulated Gulf Stream wouldn't flow where the Gulf Stream flows. The simulated Antarctic Circumpolar Current would circumnavigate the Antarctic. etc.
The Japanese are even getting simulated hurricanes with simulated eyes forming on primitive equation global scale climate models and following hurricane tracks.
You have no business telling people what they don't understand and can't do when they can actually do it.
mt
I seem to recall that a Russian researcher, Yury Israel, has done research to indicate that the addition of sulpher compounds to the jet fuel used by international airline flights, which fly at 60,000+ feet to take advantage of the jet streams, would result in particulate dispertion into the stratosphere and global temperature reduction due to reflection of sunlight. Perhaps not the best solution to the problem, but an intriguing proposal none the less...
"Oh, wait, we don't have a clue about any of that..."
Just because you don't have a clue does not mean everyone else is similarly clueless.
And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
And eventually all those millions of tons of sulfur in the upper atmosphere return to earth in the form of sulfuric acid rain and kills all the crops.
9/11 Eyewitnesses to Explosive WTC Demolition 1 of 2
Second, he did a further analysis of a practical mechanism to introduce SO2 into the upper atmosphere. I think he settled on balloons or artillery shells, and the cost was something like tens of billions of dollars a year. Since the stuff only stays up there for months, it would be a reoccuring cost.
Finally, it has the unpleasant side effect (per earlier replies) of raining down on the planet in the form of acid rain. Since the ocean is already getting more acidic due to increased CO2 levels (which combined with water get you carbonic acid-i.e. soda water), this might be a fatal drawback. The one thing worse than global warming is an oxygen deprived ocean, which ironically leads to sulfur coming back up as hydrogen sulfide (which at least once killed over 90% of the life on earth during a particularly spectacular episode of runaway global warming called the "Great Dying.")
Anyway, we probably won't have time or money to develop or impliment such a idea (nor another idea using a space shade to partially block the sun hitting the earth) because of abrupt climate change: when the climate is forced, it doesn't respond smoothly and gradually. Instead, proof in the form of ice core samples show that the climate at first resists changing, then abruptly changes to another stable state. In other words, it is predictable that within a decade or two our climate will abruptly change from the mild Holocene of the last ten thousand years, to a hotter dryer climate that has resulted in mass extinctions many times in the past. Here is a link to an article I wrote if you want a further explanation http://www.planetsave.com/ps_mambo/Independent_New s/Science/Abrupt_climate_change_predicted_within_2 0_years_200609117794/
We won't have the resources to launch SO2 into the upper atmosphere, particularly repeatedly, especially if it didn't make an immediate dramatic difference. Furthermore, we aren't going to pull the hammer back by getting an "SO2" program all ready to pull the trigger if things get really bad. Instead, typically we'll wait until catastrophe hits, then we'll be looking for the silver bullet yesterday. Neither a SO2 program, or the space shade program will be seriously on track until after the resources are unavailable. Any resources will be used up for consequence management, not to institute some expensive technologically spacious global warming pie-in-the-sky program that won't have immediate results for years and years.
On the other hand, I have an alternate suggestion (the advantage is it wouldn't need a great deal of resources, a large team of scientists, or a great deal of time to impliment):
It is unreasonable to expect that mankind will so dramatically reduce their greenhouse gas emissions (GHG) fast enough to avoid abrupt climate change. A fast growing population combined with growing per capita energy use, plus trillions of dollars in fossil fuel infrastruction means we are on track to double our CO2 emissions by 2050.
Furthermore, a warming earth means that carbon sinks will become carbon emitters bigtime. In other words, it is predictable that soon the earth will start emitting far more GHG than humans, at the same time it is able to absorb less of mankind's CO2 pollution. Nature absorbs about half of mankind's 8 billion tons of CO2 emitted each year. By 2030 it is predicted that nature will only be able to absorb 2.7 billion tons a year.
The only solution for global warming is to remove the CO2 from the air after it has been emitted. I suggest using genetic engineering to improve nature's ability to absorb CO2. Perhaps seeding a GMO into the ocean.
Why not try for a nuclear winter to offset global warming ?
They seem to suggest these kind of things based on a limited understanding of global warming issues and feedbacks, so why not add to the mess in a way we think we know will cool things down?
Like someone above says, we're so good at adding to the mess, and it's much easier than doing less of anything.
Bring me an accurate model that reflects past performance, then we can talk. I've dealt with chaotic systems before and while no cakewalk, it can be done.
"[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
So we effectively reduce the sunlight hitting the Earth,
which slows plant growth,
we burn more fuel to compensate for the cooler weather releasing more Carbon,
requiring more light to be reflected,
goto line 1
Truely it is mans ultimate dream to destroy the sun, I will do the next best thing by blotting it out. - Mr. Charles Montgomery Burnes
In the not too distant future, next Sunday A.D.
Just as the US and other nations have done on multiple occasions, Kyoto-nations could show some GUTS and legally force a ban on all goods produced by methods disregarding the Kyoto protocol (read: all goods produced with energy).
How's that for a change?.. oh..and yes its not gonna happen, and yes its because the WTO is US-dominated, and yes that is a natural extension of historical power become institution, and no, i am not anti-US.
Try telling that to the Kyoto supporters.
The last thing we need is for particles sent into the atmosphere to settle on the polar ice, thereby increasing heat absorption and melting the ice caps, raising the sea level and flooding most of our major cities.
Paid Q&A/Research
Doesn't that old han end up swallowing A GOAT before then end of that song?
I fo rone welcome our goat-eating wonder-esophagus overloads.
Suppose you are riding in a car and there suddenly appears a lot of fog on the road. You ask the driver to slow down and he answers "I'll keep speeding because we aren't sure that there's anything dangerous on the road".
If we do not have enough information on the dangers ahead, that's reason enough to reduce the emission of potentially dangerous greenhouse gases.
That's not how simulations are done, what you suggest would be a waste of time. You should first learn something about the mathematics of simulations, a good place to start is in this book.
Then you should learn something about the physics, I suggest chapter 1 in this book to learn how to calculate the spectrum of the radiation emitted by a body as a function of temperature.
Knowing all that, it's a simple matter to realize that sunlight is emitted by the sun at a shorter wavelength than heat radiated by the earth, because the sun is hotter than the earth. It just happens that CO2 absorbs less radiation at shorter wavelengths than at longer wavelengths, therefore heat from the sun reaches the earth surface, but heat radiated by the earth surface gets absorbed by the CO2 in the atmosphere.
The rise in the temperature isn't programmed into the simulations, it's a result of the calculations, which use data that has been verified many times.
This is not a new idea. It's Global Dimming and it has been here for quite some time. But the reason why we haven't done such thing yet is not that no one figured out the precise plan. It's because we have a reason why we started filtering exhaust. One is medical, another is interference with rain clouds - Remmeber the famine of 1984? Guess what was the reason. For more information check the 2005 BBC's documentary about Global Dimming, it should answer all the question.. Still this is a better idea that putting a giant sunshade to space...
There are two kinds of people - those who are radioactive and those who have already decayed..
No, that's the beautiful part. When wintertime rolls around, the gorillas simply freeze to death.
The sane response to all proposals of this ilk is not "hey, maybe global warming isn't such a big problem after all." The sane response is sheer terror.
Say you start putting particulates into the atmosphere so their cooling effect will counteract the warming effect of the CO2 we put into the atmosphere. Well particulates don't stay up in the atmosphere as long or spread globally in the same patterns that CO2 does. So we would be getting into a continuous process of deciding how much to insert into the atmosphere where and when so that not only the global weather is OK, but so that no huge weather distrubances are caused regionally. Gotta make sure the monsoons arrive on time in India, without setting off too many hurricanes in the Gulf. In other words, what is being proposed is that mankind take over active management of the world's climate.
Yes, our understanding of global climate has advanced by leaps and bounds, and weather models are really fairly good these days, but not anywhere near THAT good. If you planted a four-year-old kid who had seen "There Goes An Airplane" in the pilot's seat of a Boeing 747 and turned off the autopilot, you'd be in approximately the same delightful situation.
I suppose sooner or later we are going to be forced to actively manage the planet's weather, but we need to do everything we can to make it as much later as possible. The fact that there are lots of maniacs waiting in the wings, ready and willing to take over the management of the earth's climate if we screw up its natural balance enough should only be taken as more encouragement to cut CO2 emissions for all we are worth, as fast as we can. We need to invest in learning all we can about climate, in hopes that the maniacs will know a bit more about what they are doing when their turn comes, and we generally need to build international cooperation, because the geopolitical problems of managing global weather are at least as scary as the scientific ones.
Sure, it will take out a good chunk of the United States with it, but it will have an effect on global climate for hundreds of years afterward. The magma chamber beneath Yellowstone is *huge*; we're talking something thousands of times more powerful than Mount St. Helens.
And then of course there's the theory that the Earth's magnetic field will be almost nonexistent during the expected magnetic pole reversal coming shortly (starting within ~300 years). During the few thousand year transition, we're going to get hit hard by radiation anyway, so global warming may be irrelevant. And at least some of the CO2 will be swept away by solar wind.
Sorry, you're wrong. The climate doesn't emerge from primitive equations. What emerges from primitive equations is nothing like our climate. After adjusting numerous fudge factors to "calibrate" the simulations, they do sort of act sort of like real climate. Or to put in another way, after adjusting numerous fudge factors to make the simulations act like our climate they (amazingly) act sort of like our climate. Unfortunately, that tells us almost nothing about what our climate would be like with different inputs.
Google for "overfitting".
-mike
I think it's a matter of consistency.
Here we've had Kyotovocates telling us for a decade that they KNOW their calculations are correct (despite questions), they KNOW the impact of X amount of CO2 and particulates output by country Y over Z years, they KNOW that global warming is going to have such-and-such effects to the TENTH of a degree over a century...
So with the general public being slapped in the face repeatedly by such certitude, how ironic is it that OTHER people with OTHER agendas are claiming similar certainty with their 'global climate-changing' suggestions? Reminds me of Thomas Moore's comments about tearing down the law to attack the devil - if you justify global action based on theoretical mechanisms, you can't disupute OTHER people making use of the same mechanisms differently. That would be hypocrisy, and would (perhaps) reveal that your original goals were more political than scientfic, now wouldn't it?
Because you cannot claim that YOU know precisely how a system works, and then assail someone else using pretty much the same mechanics to come to a conclusion YOU don't like.
-Styopa
Small payloads to deploy sulpher mist might be G-resistant enough to endcourage launch via magnetic rail gun, rather than rockets.
I appreciate that this is designed to spur policy action as opposed to being a real solution but it points out the vested interest ecologists and climate change experts have in screaming about the sky falling and offering no engineering solutions. Yes, climate change is inevitable at this point. What we should be doing is talking about engineering solutions rather than ordering all economic activity to cease in the name of environmental salvation. The damage has been done. We need to implement effective engineering controls to limit the undesirable effects and if possible begin engineering our climate. Eventually that will mean barrier walls around major cities to prevent the ocean from coming in and probably underwater cities to support the growing populations but I don't accept the frankly stupid response of the NTS. Life is an uncontrolled experiment. Persisting in alarmism and rejecting any solution based on the industrial capabilities advanced economies have developed gets us no where. You can pray to Gaia however much you want and that will not stop the polar ice caps from melting. What is needed is a drive to perfect technologies that will adapt and preserve natural forms. These will take time and effort to design and implement and thus are exactly the type of solutions that environmentalists refuse to consider. They'd rather hug a tree than innovate.
What would Richard Feynman do, if he were here right now? He'd do some math and he'd follow through!
Anyone know the answer to this one?
Why inject sulfur dioxide into the atmosphere? Surely there is a mass produced gas that will preferentially reflect visible light that doesn't result in acid rain.
There are some knobs that have to be twiddled to get the thing to work. But it does work. And the reason it is interesting is exactly because there aren't enough knobs to do the sort of overfitting you are talking about.
The models have perhaps a few hundred degrees of freedom in their design and millions of degrees of freedom in their output.
I'm not saying the enterprise is above reproach, but I am tired of blanket criticism from people who don't know anything about it. If you have something substantive to say, come out and say it.
mt
...global whining!
Libertas in infinitum
Pinatubo threw a lot more SO2 into the air than this scheme would require, and current industrial emissions are many times greater - the problem with our current emissions is that they're too much, too low in the atmosphere.
Sustainability and energy independence essay
So you'd prefer considerably warmer at the equator and much, MUCH warmer at the poles? Until we can pull atmospheric CO2 (and other GHG's) back down, those are the alternatives. Not even space diffractors would alter the trend toward equalizing north-south temperatures.
Of course, we do have some choice of where we put the sulfur. If we reflected a lot more light away from the poles, we might even be able to re-establish some of that lost difference.
Sustainability and energy independence essay