Slashdot Mirror


Stop Global Warming With Smog?

lkypnk writes, "The AP is reporting that Nobel Prize winning scientist Paul Crutzen has suggested deliberately spreading a layer of particulate matter in the upper atmosphere to help reflect some of the sun's energy in an effort to combat global warming. He reminds us that the eruption of the volcano Pinatubo in 1991 cooled the planet by as much as 0.9 degrees; he believes his computer simulations show a similar effect from deliberate injection of sulfur into the atmosphere by humans. Whatever the feasibility of the idea, as the president of the National Environmental Trust has said, 'We are already engaged in an uncontrolled experiment by injecting greenhouse gases into the atmosphere.'" From the article: "'It was meant to startle the policy makers,' said [Crutzen]. 'If they don't take action much more strongly than they have in the past, then in the end we have to do experiments like this.' ... Serious people are taking Crutzen's idea seriously."

271 of 361 comments (clear)

  1. The Matrix by alexhard · · Score: 5, Insightful

    This eerily reminds me of the dark sky in "The Matrix"...maybe life DOES imitate art

    --
    Infinite time means everything that can happen, will. You being you is absolutely incidental. You do not exist.
    1. Re:The Matrix by irn_bru · · Score: 5, Insightful

      This eerily reminds me of the old lady who swallowed a spider to catch the fly...

    2. Re:The Matrix by shipbrick · · Score: 1

      reminds me of global cooling in the 70s when they wanted to melt some glaciers

    3. Re:The Matrix by Bill+Dog · · Score: 4, Insightful

      Makes me think that we should stop to think that maybe we don't have all the answers, and maybe we shouldn't necessarily go and fuck with things in such radical ways. Seems like the likelihood of us creating significant harmful effects from deliberate action to alter things is much greater than what we might be causing inadvertently by just going about our business.

      --
      Attention zealots and haters: 00100 00100
    4. Re:The Matrix by CodeMasterPhilzar · · Score: 1
      The minute they do this, someone else is going to point out the study just completed that shows the Antarctic ice sheet is growing ... (to the tune of about 29G tons/year, that's a lot of ice!)

      Then they'll want to tax us and spend it on studies and oddball schemes to induce warming to prevent an ice age. What I've come away from the last 30 years of "environmental study" and "environmental science" with is this. There's not enough useful studying going on, too much reliance on computer modeling and assumptions, and not really much science.

      --
      --- Just another Code-Monkey
    5. Re:The Matrix by Profane+MuthaFucka · · Score: 1

      It actually reminds me of Budd Dwyer's last news conference. Been nice knowing y'all.

      --
      Fascism trolls keeping me up every night. When I starts a preachin', he HITS ME WITH HIS REICH!
    6. Re:The Matrix by mgabrys_sf · · Score: 1

      Well yes - if it doesn't prevent global warming at least it will be a decent enough prevention measure against our soon-to-come AI overlords. As a human - I support this.

    7. Re:The Matrix by SurturZ · · Score: 1

      Didn't they also try this in one of the 'Highlander" films?

    8. Re:The Matrix by AndyTheSayer · · Score: 1

      Which study is this? I work in a related field and was at a seminar a couple of weeks ago discussing the contined breaking up of large parts of it. I'd be quite intrigued to read the article!

    9. Re:The Matrix by jandersen · · Score: 2, Funny

      This eerily reminds of the guy who pissed himself to keep warm.

    10. Re:The Matrix by Chris+whatever · · Score: 1

      Actually it reminds me more of Highlander 2 when Christophe Lambert (the actor) invents a shield made of chemicals to prevent radiation from the sun

      While in the matrix they only wanted to kill the energy source from the robots

    11. Re:The Matrix by bobcat7677 · · Score: 1

      Yes, I'm thinking the guy's real motive is a pre-emptive strike on the machines. But then we would have to dig in close to the center of the earth to keep warm. I prefer the surface thank you very much.

    12. Re:The Matrix by pclminion · · Score: 1

      Makes me think that we should stop to think that maybe we don't have all the answers, and maybe we shouldn't necessarily go and fuck with things in such radical ways.

      But that's exactly what the researcher is saying! The idea is to send the message to world governments, "Look, either we take definitive action NOW to reduce our global impacts or a few decades down the road we might be reduced to whacked-out ideas like THIS as our only feasible option."

      I don't think the researcher thinks this is a "good" idea, merely one possibility to mitigate devastating effects should they actually come to pass. Does this idea scare you? Good, I think that's sort of the point.

  2. NOVA episode by aarku · · Score: 4, Interesting

    NOVA did an excellent episode about this. The theory is that pollution is greatly masking the effects of global warming.

    1. Re:NOVA episode by acherrington · · Score: 4, Interesting
      yeah, nova did a really great job covering this a few months back. What the person here is talking about is implementing a concept of Global Dimming. I can't really I say that I support the idea though. Instead of getting rid of the greenhouse gases, we are going to continue to literally mask the problem. Why not just solve the base problem?

      Global dimming is the gradual reduction in the amount of global hemispherical irradiance (or total solar irradiance) at the Earth's surface, observed since the beginning of systematic measurements in 1950s. The effect varies by location, but worldwide it is of the order of a 4% reduction over the three decades from 1960-1990. This trend has reversed during the past decade. Global dimming creates a cooling effect that may have partially masked the effect of greenhouse gases on global warming.
      --


      Victory is gained, not in knowing your opponents next move, but in preempting them.
    2. Re:NOVA episode by FreakWent · · Score: 1

      buffon.

      There is plenty of warming here, find some photos of the antarctic over the last fifty years.

      More overall heat leads to more overall movement, so high and low pressure areas are larger and more intense. We've had a range of maximums of 16 to 31 in less than a week here; it snowed in Queensland and snowed on some of our summer bushfires in the blue mountains.

      That same pressure cell which is pulling up cold antarctic air for us is also dumping plenty of warm air down there as winds on the other side of the cell push north to south, which will of course lead to more melting.

    3. Re:NOVA episode by malsdavis · · Score: 3, Informative
      Then why is there warming in the smokey Northern Hemisphere and none at all in the Southern Hemisphere


      If I had mod points it would be -1 for "Utter Bullshit".

      There is much evidence of a general warming trend occurring in the southern hemisphere, pretty much the same amount as that occurring in the northern hemisphere. There are also many recordings of record freak occurrences associated with the gentle warming that appears to be occurring all around the globe; record sized icebergs breaking off from Antarctica and record draughts in the Amazon rainforest are just a couple of recent examples.

    4. Re:NOVA episode by uncadonna · · Score: 4, Informative
      Then why is there warming in the smokey Northern Hemisphere and none at all in the Southern Hemisphere?

      We now wait for the traditional round of excuses.

      We'll save the excused for actual facts, shall we? The Southern hemisphere is warming, despite recent assertions to the contrary from certain unreliable sources.

      graph

      context

      You are entitled to your own opinions but you are not entitled to your own facts.

      --
      mt
    5. Re:NOVA episode by malsdavis · · Score: 2, Funny
      ...and record draughts in the Amazon rainforest are just a couple of recent examples

      erm, I meant "drought" rather than "draughts". I do not personally know of any evidence of a recent increase in the playing of the game draughts within the Amazon rainforest.
    6. Re:NOVA episode by Capsaicin · · Score: 4, Insightful

      Instead of getting rid of the greenhouse gases, we are going to continue to literally mask the problem.

      And think of the potential. Countries like China, could claim carbon credits for the copious particulate matter they produce, thus cancelling out their escalting C02 emissions! I hope Cutzen's attempts to "startle policy makers" doesn't backfire in this fashion.

      Next we'll have some bright spark suggesting using Nuclear Winter, in a similar fashion. You know kill two birds with one stone ... take out the largest fossil fuel burning population centres and cool the planet at the same time. Ooops, I just suggested it, didn't I?

      --
      Better to be despised for too anxious apprehensions, than ruined by too confident a security. --Edmund Burke
    7. Re:NOVA episode by The_Wilschon · · Score: 2, Interesting
      Instead of getting rid of the greenhouse gases, we are going to continue to literally mask the problem. Why not just solve the base problem?
      Because we know how to do this. Getting rid of already extant greenhouse gases is going to be a much trickier problem. I've heard an awful lot of moaning and doom-and-glooming over global warming, and precious little in the way of actual solutions. Especially the type of solutions that are implementable. Telling everyone to stop driving their cars and stop using electricity generated from greenhouse-producing generators is about as effective as telling the tides not to come in. Besides, even that would only decrease (albeit significantly) our production of greenhouse gases. It wouldn't do much at all to reduce their actual concentration in the atmosphere. However, global dimming type projects could very well counter the effects of the greenhouse gases, giving us enough time to figure out a way to actually reduce those gases. Or, giving us time to implement long-term reduction plans, such as replacing gas-burning cars as quickly as possible, planting more trees, and waiting for the trees to eat up all the CO2. And the dimming would mitigate the warming effect that forests have by virtue of their lower albedo than pretty much any other type of terrain.

      If the doomsday proclaimers are right, then we have precious little time before global warming goes out of control and we turn into venus (exaggeration, yes I know). Decreasing the total amount of insolation could buy us enough time to actually fix things. Now, of course, we should choose something to implement the dimming that we can easily undo, or that will undo itself (requiring us to maintain it for as long as we need it).
      --
      SIGSEGV caught, terminating

      wait... not that kind of sig.
    8. Re:NOVA episode by MorseKode · · Score: 1

      By the way, this week we had one of these freak ocurrences where I live (Rosario, Argentina), we had an ice storm with ice-balls ranging from 5cm to approx. tennis balls with strong winds (http://www.youtube.com/watch?v=UJvmlbMS9X0 http://www.youtube.com/watch?v=YZa-4VJFcyI). Lots of cars lost their windshields and almost every bulding in the city looking north-west has its windows brokens.

    9. Re:NOVA episode by wasted · · Score: 1
      ...and record draughts in the Amazon rainforest are just a couple of recent examples...
      erm, I meant "drought" rather than "draughts".


      Darn, and I thought they had invented a bigger beer mug down there.
    10. Re:NOVA episode by doom · · Score: 1
      The_Wilschon wrote:
      Instead of getting rid of the greenhouse gases, we are going to continue to literally mask the problem. Why not just solve the base problem?
      Because we know how to do this. Getting rid of already extant greenhouse gases is going to be a much trickier problem. I've heard an awful lot of moaning and doom-and-glooming over global warming, and precious little in the way of actual solutions. Especially the type of solutions that are implementable. Telling everyone to stop driving their cars and stop using electricity generated from greenhouse-producing generators is about as effective as telling the tides not to come in.

      Nuclear power exists. The United States uses it for 20% of it's electric power, France uses it for most of their electric power. It's not some odd ball "alternate energy" source that doesn't really generate enough to matter: there isn't any reason in principle that it couldn't replace the 50% of our power that we still generate with coal power. Except of course, for some doom-and-gloom moaning about how it's evil, evil, evil.

      Not that I have any thing in principle against "amelioration" schemes, either...

    11. Re:NOVA episode by Evil+Pete · · Score: 1

      It would buy us some time. But if continued would just be like ingesting more and more antidote to tackle an increasing toxin ... sooner or later something is going to go badly wrong. It would lead to an unstable situation.

      One scenario: after a couple of decades of this strategy we have a few big volcanic eruptions (they're not that rare) which cause a considerable dimming globally, enough to affect global food production, I mean there has already been a lot of dimming by this time anyway. Which triggers an economic downturn. Which reduces industrial pollution which starts a warming cycle, by reducing the particulants. Such cycles have periods, and if you don't get the right phase you will produce positive feedback resulting in a ... um interesting situation.

      --
      Bitter and proud of it.
    12. Re:NOVA episode by RealGrouchy · · Score: 1
      NOVA did an excellent episode about this.


      Funny, 'cause when I clicked on that link, the header said "Major funding for NOVA is provided by Google and BP ".

      As much as I love PBS and its free online documentaries, any energy/pollution-related material would have to be taken with a pretty big chunk of salt if that very program is being funded by a large energy corporation.

      I mean, that fear of editorial conflict of interest is the whole reason PBS operates the way it does.

      - RG>
      --
      Hey pal, this isn't a pleasantforest, so don't waste my time with pleasantries!
    13. Re:NOVA episode by WhiplashII · · Score: 1

      This is why I personally advocate putting mirror satelites in orbit. The satelites can either reflect more sunlight in or block the sunlight as needed, and can adjust to events very quickly.

      The only problem is that it is a tad expensive, and I can't get a "consensus of scientists" to support it...

      --
      while (sig==sig) sig=!sig;
    14. Re:NOVA episode by aarku · · Score: 2, Insightful

      You need a critical eye for all information present to you. It doesn't matter who is sponsoring it. Stop spreading FUD, especially when you obviously haven't seen the show.

    15. Re:NOVA episode by poopdeville · · Score: 1

      There's no a priori reason why the US couldn't have an energy surplus with enough nuclear power. Heck, we could sell energy on the free market to subsidize the next silly war we get into. (Or just help lower our taxes. Or even create machinery to take care of our food production, using the very same nuclear power. You know, actually solving problems and helping the country grow concretely)

      --
      After all, I am strangely colored.
    16. Re:NOVA episode by Decker-Mage · · Score: 1
      The only thing tricky about it is that the models are consistently wrong in predicting actual climatological behavior so any manipulation of extent conditions could easily throw the entire system out of whack (i.e. towards a, or more accurately more than one, strange attractor to global ice age and/or radical warming. I've been creating and validating models for the last thirty- three years at least mine are accurate to +/- 1% or better. None of the current models can get even close to 60% of the variation explained. So tinkering on this level with the overall green-house gas levels and/or absorbed solar energy is fraught with hazard.

      In any case, you do not have to throw particulates into the atmosphere. That's the stupid solution. Seeding of, say, the Antarctic Ocean shelf and other regions with particulate iron, of which we have much available, could easily radically increase the growth of plankton (and it's that radical change I worry about, just as a radical change in reactor criticality can cause a near instantaneous meltdown). The installation of OTEC (Ocean Thermal Electric Conversion) plants in the tropics would have the same result with the added benefit reducing reliance on fossil fuels for power production and industrializing the developing world in a more 'environmentally friendly' manner. Speaking as a multi-disciplinary systems engineer and economist/econometrician, there are quite literally dozens if not more than a hundred technological solutions that can be implemented would we had the political courage to do so. This observation is not unique to myself although I did notice the trend early. It's not my problem, nor my children's problem as I have none. I won't be around long enough for it to be a problem.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
    17. Re:NOVA episode by timmarhy · · Score: 1

      "It wouldn't do much at all to reduce their actual concentration in the atmosphere." they have these amazing things now days called tree's, which suck up c02 and other gases. i know it sounds super simple, but planting more tree's and advancing our technology to produce fewer and fewer emissions is what we need, and it's what's being done rightnow. sure it's not as sexy cool as a save the world last ditch effort spraying crap into the atmosphere, but it's the right solution.

      --
      If you mod me down, I will become more powerful than you can imagine....
    18. Re:NOVA episode by Decker-Mage · · Score: 4, Interesting
      The sad thing about nuclear power in the US is that it is not a technological problem that prevents its deployment. Inherently safe plant designs do exist (one of my fields of engineering), ones where every safety system can and does fail, yet the plant simply cannot meltdown (a CLOCA - Complete Loss Of Coolant Accident - is more an internal radiological cleanup problem than anything else. These designs are not new. Nuclear waste is not only managable but can be rendered inert and safely stored for tens of thousands of years. Nothing new here either. Nor are finding geologically stable sites for construction of these sites. Again nothing new, look for salt domes which only occur, I might add, in geologically stable areas (and which is why they are great for storing real nuclear waste).

      The problem is solely socio-political. It costs more to prepare, obtain, and shepherd through a totally uncertain legal system the required permits for construction than the actual construction itself. Add the decade long lead time to ground-breaking for which interest on capital is charged but not recouped. As icing on our heaping pile of fecal matter pie here, toss in unknown legal liability concerns due to the unresolved waste repository issue. No ration economic actor will engage in construction of such plants. Actually, given what I know about the problems that we will also be facing with fusion plants, I firmly believe that we will never construct any for civilian power production in this country either. So much for that man on the white horse.

      The best we can do from absolute recycling of all wastes for power production, assuming 100% recovery of energy with no recovery energy costs (yeah, right, just toss the second law of thermodynamics) is just under 5% of total power production in this country. Wind power, which is problematic at best, however let's again assume it is perfect, gets you another 5% assuming you cover this country with wind farms even in inappropriate areas. Forget tidal, it's a non-starter even if you capture all the tidal energy for the coastal US, total recovery less than a tenth of a percent. Solar is out even before it leaves the gate. The best sites for massive solar arrays, ignoring space, are our deserts and that won't fly against our 'environmentally-minded' 'friends'. Frankly, there is no way to come up with the rest of the power this country needs to function without increasing nuclear-based power production. [I'm leaving OTEC out of this as it would not be based in the US if maximum efficiencies are desired.]

      One hopes that we will get a radical breakthrough in the near future. We engineers can actually solve the problems in front of us as is, nothing new required. Just lots of capital investment. Although I wouldn't turn down some breakthroughs.

      [Disclaimer: Former member of Greenpeace who broke from the membership over nuclear power. I was the only one at the meetings that could even explain what the various types of radiation were or their health hazards.]

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
    19. Re:NOVA episode by evilviper · · Score: 1
      Why not just solve the base problem?

      Because YOU haven't invented (inexpensive) (cold?) fusion yet...
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    20. Re:NOVA episode by Anonymous Coward · · Score: 2, Insightful

      Disclaimer: Former member of Greenpeace who broke from the membership over nuclear power. I was the only one at the meetings that could even explain what the various types of radiation were or their health hazards.

      Just to let you know you're not alone.

      I'm a former GP employee, and remember distinctly a meeting (ca. 1988) where there were 2 "scientists" (me, as a new grad, and a biology prof), when we were discussing Global Warming. The Prof made a remark to the effect that the science looked good, and if this thing (GW) turned out to be true, we (GP) might be facing the situation where we would actually have to advocate nuclear energy. As you can imagine the looks from the nuclear campaigners in the room were close to fatal, and after a moments silence the conversation continued as if he had never said anything.

      My thought were 1) Boy, are you brave! and 2) You are probably correct.

      And this is a really big problem we have in relation to Global Warming, namely: 1) a large segment of the population will dismiss the threat because they see it as some green issue and they are ideologically opposed to environmentalism. and 2) many environmentalists have spent so much of their lives campaigning against nuclear energy that they are psychologically unable to reverse direction now. This leaves only a very small fraction of the population that both a) accepts the real likelihood of the threat posed by GW and b) accepts the fact that nuclear energy is the only realistic solution, at least in the short-term, for cutting our dependance on fossil fuels. Scary!

      Personally, I'm no fan of nuclear energy, I'm pretty certain more accidents will happen and there will be more Chernobyls. But I think those who decry nuclear energy haven't quite come to grips with the potential threats posed by GW. The risk of localised nuclear contamination has to be weighed up against the more general risks to large areas of the habitable planet. Sometimes in life, the lesser of two evils must be chosen.

    21. Re:NOVA episode by RsG · · Score: 3, Informative

      Doesn't work that way I'm afraid. Trees slow the problem, but they don't solve it.

      There is a global process called the "carbon cycle" that I invite you to research on your own. Essentially, all organisms excrete carbon dioxide, which is then reused by plants during photosynthesis, releasing oxygen and storing the carbon. What you may not realize is that plants are not exempt from the first part of the carbon cycle; they still release the carbon they absorb. A closed system that included plants, but no animal life, would still have airborne Co2, which would be absorbed by plants during the day, and released during the night. Planting more trees adds a carbon "sink", since it's that much more carbon locked up as biomass, but they don't magic it away.

      As long as the amount of carbon in the system doesn't change, the greenhouse effect will remain where it is (at least over human timeframes). What we've done with fossil fuels is taken hydrocarbons that were outside of the carbon cycle, and burned them (increasing the amount of Co2 in the atmosphere), thereby increasing the existing greenhouse effect.

      To solve this permanently, we'd need to create carbon sinks that are outside of the carbon cycle, to replace the fossil fuel carbon sinks we've already burned. This is possible, but not as simple as planting trees; such artificial carbon sinks would have to be inorganic if they're to be permanent. Any carbon locked up in in organisms is going to find it's way back into the air.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
    22. Re:NOVA episode by Decker-Mage · · Score: 4, Insightful
      The chief engineering discipline I was trained in was nuclear engineering and I will be the first to acknowledge the dangers. The rational dangers, especially since I worked professionally and taught for four years before serving in the US Navy was statstics and probability theory, that and computer science. Rational dangers. We have a few metric tons of high level waste, especially if we vitrify the damn stuff. Heck, it might even have future economic value when we figure out how to manipulate at the quantum nuclear level (and we will, I know that). Coal, and only to a slighly lesser degree oil petroleum, produces millions of metric tons of fly-ash, is far more hazardous in terms of radiation exposure due to radon gas and other isotopes introduced into the environment, and you still have to find a place to dump the stuff. KW-hr for KW-hr, waste for waste, coal/petroluem produces 400,000 times more waste than nuclear. That's a hard number. Give me a break. It's like Alar or DDT all over again.

      Actually, this ties in with the decline of science and engineering candidates, and programs, in this country. I deal in the real world. I don't give a damn about ideology, belief systems, even social morés actually. The anti-nuclear wing of the environmental movement isn't rational (you should have heard one of them attempt to explain alpha radiation). I could discuss, what I can discuss publically, Cherobyl until I'm blue in the face. The plain fact of the matter is that such an accident as Chernobyl cannot occur over here, period. We do not even have an operational breeder reactor (Chernobyl was a cadmium moderated breeder) in this country, let alone any reactor without a containment dome, nor are we idiotic enough to bypass all the engineering safeguards and then conduct experiments on the reactor. [Or at least I hope the NRC isn't on that last point. I sometimes wonder.] I'll just leave it there.

      Nature blessed us far beyond anything we deserved giving us a huge endowment of fossil fuels for cheap energy production and radical new materials, equally large endowments of uranium-235, -238, and if we would design towards it, especially thorium. But these are simply down payments. Fission and even fusion are simply a stop-gaps. We've had the technology now for over thirty years to build OTEC, SPS (Solar Power Sattelites), achieve break-even on fusion, improve the efficiency of plants for conversion to ethanol (plants are barely 1% efficient), and especially to engage in extremely heavy duty, Manhattan Project level, research into what makes our planet's complete ecology tick, and investments to achieve energy (and materials) independence for everyone, not just those of us in the 'rich' west. Instead what we face our challenges from the uninformed, or the ill-intentioned, to block any and all potential approaches to breaking out of this deadlock. Remember the windmill farm over the horizon from the Kennedy Compound?

      As it stands right now, your children's children may curse the people living today to eternal damnation for squandering our endowment. We are well beyond the scientific research stage, it's (relatively) simple nuts-and-bolts engineering. As I've said elsewhere, not my problem. I don't have long left on this planet (alive anyway). What continues to amaze me is that when I break the numbers down for the actual spending required, even accounting for 500% inefficiencies typical of NASA and other government agencies (you can tell I was in government), it's cheap. Dirt cheap. [Total] Highway Spending Bill 'Pork' cheap. If we have to spend money on pork, lets do it here.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
    23. Re:NOVA episode by Ihlosi · · Score: 1
      Planting more trees adds a carbon "sink", since it's that much more carbon locked up as biomass, but they don't magic it away.



      It takes CO2 out of the atmosphere. There's no need to magic it away as long as the biomass isn't being burned immeditately after growing.



      As long as the amount of carbon in the system doesn't change, the greenhouse effect will remain where it is (at least over human timeframes).



      If you can change the ratio of CO2 in the atmosphere to carbon bound solid organic molecules, the greenhouse effect will get less.



      To solve this permanently, we'd need to create carbon sinks that are outside of the carbon cycle, to replace the fossil fuel carbon sinks we've already burned.



      A forest will, given enough time, do that. The end result is called "soil".



      Any carbon locked up in in organisms is going to find it's way back into the air.



      As long as you can lock up more carbon in solid form than finds its way back into the air in the same amount of time, the CO2 level in the atmosphere will drop.

    24. Re:NOVA episode by DiamondGeezer · · Score: 1

      That same pressure cell which is pulling up cold antarctic air for us is also dumping plenty of warm air down there as winds on the other side of the cell push north to south, which will of course lead to more melting.

      Fascinating. How would it cause more melting if its still well below zero down there?

      --
      Tubby or not tubby. Fat is the question
    25. Re:NOVA episode by RsG · · Score: 1
      It takes CO2 out of the atmosphere.
      And then promptly releases it again. Did you miss the part where I mentioned that trees release Co2, the same way we do? Even if you don't burn them, they will respire. And when they die, they will rot.

      You are quite correct however, in that storing carbon as biomass reduces the amount in the atmosphere. I don't think I ever said otherwise in my post. A good way of looking at it is to think of a forest as a carbon reservoir; the carbon is stored, but not eliminated, and the storage capacity is finite per unit area (X many square km of land stores Y many tonnes of carbon as biomass).

      If you can change the ratio of CO2 in the atmosphere to carbon bound solid organic molecules, the greenhouse effect will get less.
      Agreed. My point was more that the level of those same organic molecules is elastic. The carbon is stored, but it isn't "locked" the same way it is in a fossil fuel bed. Hence why I said doing this alleviates the problem, but doesn't completely solve it.

      A forest will, given enough time, do that. The end result is called "soil".
      Here, I think you are mistaken. I did say "outside of the carbon cycle", and soil is not outside of the carbon cycle, it is still biologically active. Organisms in the soil still respire. Moreover, a forest is not needed if we wish to store carbon in soil; the soil itself is a carbon sink, with or without trees. It isn't relevant to a discussion on planting forests as a way to combat the greenhouse effect.

      As long as you can lock up more carbon in solid form than finds its way back into the air in the same amount of time, the CO2 level in the atmosphere will drop.
      To a degree, yes. You will note that I never said otherwise - I argued that it was not a be all and end all solution. We will also need more permanent carbon sinks, and energy sources that don't come from fossil fuels, if we are to fix the problem fully.
      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
    26. Re:NOVA episode by DiamondGeezer · · Score: 1

      If I had mod points then your reply would get -10 "Handwaving argument"

      None of your supposed evidence answers the question why the SH is not warming (according to the satellite record).

      --
      Tubby or not tubby. Fat is the question
    27. Re:NOVA episode by Pharmboy · · Score: 2, Interesting

      Even some former Greenpeace members are coming around on nuclear power. You don't have to be a genius to know it will take nuclear power, biofuel blends (ethanol and biodiesel blended with petrofuels) plus energy efficiency to solve the issue. Right now, research is coming along pretty good and it looks like switching to alternative energy will produce a net benefit to the economy if we continue along a steady path. SEER ratings are going up, CAFE standards need to go up, the Feds are giving nice tax subsidies for biofuel generation while we migrate (although most states are NOT...) Wind and solar power generation is becoming more efficient every year. Jobs are being created. My house is still comfy year round.

      And for the record, I am not an environmentalist, whom I detest. Less pollution makes air nicer to breath (a plus), but I am not sold on the whole 'global warming' scenario. I'm just an ex military guy who is fed up with feeding Iran and others with my dollars. I prefer our energy dollars stay at home, preferably in my own wallet.

      Now if Ford and Chevy would just build an efficient car worth buying, instead of hybrid vehicles that do nothing except get them tax credits.

      --
      Tequila: It's not just for breakfast anymore!
    28. Re:NOVA episode by malsdavis · · Score: 1

      Evidence is not needed as to why it's not warming, because it is showing a warming trend. I don't know what "satellite record" you are referring to but it is out of sync with the vast majority of satellite records and other data.

    29. Re:NOVA episode by JakartaDean · · Score: 1

      Mate, I don't have any mod points, and I can't find out how to send a message to you. So, using the inappropriate public forum: Well done. As a former engineer, and one who's interested in public policy, I appreciate your post. That may be because I was predisposed to agree with your position, but you make the arguments forcefully. Dean

      --
      The subject who is truly loyal to the Chief Magistrate will neither advise nor submit to arbitrary measures (Junius)
    30. Re:NOVA episode by ate50eggs · · Score: 1

      It's weird that we have two opposing problems - too much energy in the atmoshpere and constant demand for energy to power our cars/homes/electric razors. is there a way to capture energy by dumping atmospheric heat into space?

      I'm picturing big heat sinks in the upper atmoshpere, connected to heat collectors on the ground. heat goes up and we get energy from the seebeck effect. getting a bunch of heat sinks into the upper atmosphere should be easy... right?

      --
      not everything is a science experiment!
    31. Re:NOVA episode by smbarbour · · Score: 1

      Granted, I am not a climatologist or anything else related to this, but I would think it would do more than just mask the problem and in fact make it worse. We reduce the sun's ability to heat the planet while at the same time reducing the effectiveness of the natural process for removing carbon dioxide (a.k.a. photosynthesis). Perhaps we should instead try to engineer some plants with increased efficiency of photosynthesis.

      (This next comment is a little tongue-in-cheek)
      If I recall correctly, there is a certain plant that has a decently high efficiency at photosynthesis that also has a tendency to grow just about anywhere. Unfortunately, this plant has been outlawed in many countries due to the effects of consuming it (either by ingestion or inhalation of its smoldering remains).

    32. Re:NOVA episode by careysub · · Score: 1
      The problem is solely socio-political. It costs more to prepare, obtain, and shepherd through a totally uncertain legal system the required permits for construction than the actual construction itself. Add the decade long lead time to ground-breaking for which interest on capital is charged but not recouped. As icing on our heaping pile of fecal matter pie here, toss in unknown legal liability concerns due to the unresolved waste repository issue. No ration economic actor will engage in construction of such plants.

      This attributes the lack on interest in nuclear power investment entirely to regulatory and legal issues rather than any intrinsic problem with competing with other power investments in the marketplace.

      I would direct interested readers to a very good recent study on the issue of nuclear power: "The Future of Nuclear Power" at http://web.mit.edu/nuclearpower.

      Referring to pg. 41 of the study: "under what we consider to be optimistic, but plausible assumptions, nuclear is never less costly than coal."

      The fundamental problem is that nuclear power has an intrinsic high capital cost that makes it hard put to compete with other forms of energy that have lower capital costs. This is *not* a function of regulatory delay.

      The MIT analysis excludes a couple of factors that makes the barrier to investment even higher. The estimated cost of nuclear power is valid (given that all the optimistic assumptions prove out) over the expected (40 year) life of the plant. But investors want a faster pay-out, the faster the better. Given equal cost power, they will prefer plants that achieve this cost over a shorter time period - i.e. ones that are less capital intensive. So even if nuclear power matches coal in cost or is marginally superior, over the planned plant life, it will still be discriminated against by investors. (Another disincentive that Decker-Mage mentions above is potential legal liability.)

      Unless there is some penalty applied to coal generation that limits capacity added, or drives up the cost, nuclear power is not going to complete in a market-driven power business. (This capital cost problem afflicts solar power also.)

      Regulatory intervention in the power production industry is going to be required to restrain the growth of CO2-releasing coal power. Carbon taxes are one possibility, requiring carbon capture and sequestration is another.

      --
      Starships were meant to fly, Hands up and touch the sky - Nicky Minaj
    33. Re:NOVA episode by cliffski · · Score: 1

      why is tidal energy so easily written off? seems to be a totally waste-free non polluting energy source, especially the undersea tide-driven turbines. The tides are predicatble and with us forever. is it not economic? and how much has been spent on R&D. In the Uk at least, nuclear has proven masively uneconomic, is there any good reason to go for nuclear and not tidal? (granted its different for the UK, we have coastline coming out of our ass).

      --
      DRM-free indie games for the PC and Mac: Positech Games
    34. Re:NOVA episode by doom · · Score: 1
      Actually, this ties in with the decline of science and engineering candidates, and programs, in this country. I deal in the real world.

      Yeah, me too.

      I don't give a damn about ideology, belief systems, even social morés actually.

      But then, that's one of the reasons I do care about ideology and so on... but then, what I actually wanted to comment on was this:

      The anti-nuclear wing of the environmental movement isn't rational (you should have heard one of them attempt to explain alpha radiation).

      I took a look at Helen Caldicott's latest book recently, and it appears that she's claiming that nuclear power is all a sham because mining the nuclear fuel and constructing the plants and so on actually requires burning loads of carbon emitting fossil fuel.

      I ask you, even without looking into the numbers on that -- imagine saying the equivalent of that to someone with a scheme to put photovaltaics on rooftops. What would you expect them to say? Answer: "That's only true at the moment, once we have this alternate energy source in place we'll be able to construct more of it using just the alternate energy."

    35. Re:NOVA episode by lmpeters · · Score: 1
      Nuclear waste is not only managable but can be rendered inert and safely stored for tens of thousands of years.

      Look at world history. Has any civilization managed to exist without the occasional upheaval for tens of thousands of years? The Roman Empire barely lasted over 1,000 years, and even China has been subject to more than a few major upheavals in its 6,000-year history. You can't count on nuclear waste sites being overseen properly in the middle of any sort of political upheaval. Unless you can guarantee that the nuclear waste will require NO OVERSIGHT WHATSOEVER during the tens of thousands of years you intend to store it, and you can eliminate the risk of it being used for nuclear weapons (e.g. dirty bombs), I think you're going to have to drastically reduce the time it needs to be stored for nuclear power to be a safe option.

      Still, if it turns out that it's impossible to power the world with other renewable energy sources (e.g. solar, wind), I suppose that maybe nuclear power has reached a point where it's ultimately less risky than oil. But maybe that has more to do with politics; I'm not sure.

    36. Re:NOVA episode by Decker-Mage · · Score: 2, Interesting
      Actually I don't need to look at the numbers, I know the numbers. The chip industry is getting better about this although it has a long way to go especially in the manufacturing of photovoltiac cells. Before the shift away from using PCE as part of the manufacturing (cleaning) process), the sheer amount of hazardous chemical waste was mind-boggling even to someone used to dealing with materials in metric tons and kilotons. It's still far from ideal and with the introduction of nanotechnological processes into the photovoltiac mix, process engineering will on become more complex as will dealing with the wastes.

      As for fission power, her comment is so out of date it isn't even funny. The uranium (and should we use an alternative process, thorium) is already mined and stockpiled. The last time I looked at the data, it's a couple of hundred years worth at current usage rates for uranium and potentially thosands of years for thorium. The photovoltiac cells, and alternative converters of solar energy, do not exist. So on the one hand we have an existing, usable supply, and on the other hand (economist, remember?) we have something that still needs to be manufactured, and actually in this case, we need to create the manufacturing plants as well.

      Which way would you go were you a rational actor? Duh!

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
    37. Re:NOVA episode by Decker-Mage · · Score: 1

      The reason it is written off is that even if all the potential tidal power from the coastlines of the United States were captured, it would supply less than 1%, yes one percent, of our electrical needs and that's assuming that the process is 100% efficient which nothing can be under the second law of thermodynamics. You also face very high captial startup costs and as another poster pointed out in this thread, investors in utilities avoid that like the plague. OTEC is a far better approach in comparison, for the same capital investment you get higher amounts of electrical production and the pollutant effect in this case is more fish. I think we can deal with that kind of side effect.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
    38. Re:NOVA episode by Decker-Mage · · Score: 2, Interesting
      As I believe I pointed out, there a potential uses for this so-called waste. What may be waste at one particular snapshot of the technological arc may be highly valuable at a (near) future date. This is also historical fact as has been demonstrated time and time again. Materials that were thought to be useless turned out to be highly desirable in future manufacturing processes. Coal tar would be my prime exhibit with mine tailings from various metal mining sites that were high in elements such as titanium, molybdenum, etc. Heck, at one time, urananium-oxide (yellowcake to be specific) was thought only to be useful as a dye for over a thousand years, at least. Oops.

      As for the terrorist threat {yawn}. It is way overhyped by people that don't have a clue about what they are tallking about. First off, dealing with high-level waste requires the resources, specifically the equpment, currently only available to governments. This stuff is not only extremely radioactive, but toxic as well. True, give a budget of ten million or so and I could come up with a facility to deal with it but our intelligence services would pick up on that in short order. Secondly, the stuff will be guarded and almost certainly more well guarded than is the case with our current on-site storage scheme which was always meant to be a temporary solution. While in the service I served on a counter-terrorism team and prior to entering the service I studied terrorist tactics. Terrorists can achieve their goals far more easily than stealing vitrified, high-level waste, having to evade NEST and the counter-terrorist military op of the millenium, and ensuing fall-out (pun intended). Good thing I wear a white-hat since I could easily come up with ops far more impressive, effective (political, media), and secure.

      In any case, the point is not that we use nuclear (fission or fusion) unto the end of days. We merely use it as a stepping stone to achieve renewable energy independence. Sending fifty to a hundred billon a year to overseas energy suppliers is downright idiotic when a similar investment of one years cost could easily eliminate that cost entirely using not a single bit of new technology except in the case of genetic engineering of plants for ethanol production, but that's dirt cheap in comparison to cthe capital startup costs of some of the other required tech.

      When you get down to it, the world of economics is just like the world of engineering. Both exist in a system of constraints and the job involves dealing with those constraints to maximum the return on investment. When I realized that it became no surprise that I am comfortable in both worlds.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
    39. Re:NOVA episode by lmpeters · · Score: 1

      If you look back at my original message, I never said anything about TERRORISTS using radioactive waste to make weapons; I know that the terrorist threat has been way overhyped. But I do think that as long as the potential exists for radioactive waste to be misused, someone will be tempted to misuse it.

      My concern about nuclear energy is the possibility (I'm not yet convinced one way or the other) that it will ultimately land us in a difficult situation similar to the one that fossil fuels have landed us in now. Perhaps you're right that radioactive waste will become a valuable resource in the near future, as has happened with other materials in the past. However, your assessment depends on technology that (as far as I can tell) have not yet been invented, and history has also shown that it's incredibly difficult to predict technology more than a few years into the future (whatever happened to the flying cars, jet packs, moon bases, et al. we were supposed to have by now?).

      As long as the risks are accounted for, I wouldn't be opposed to the use of nuclear power as a temporary measure to eliminate our dependence on foreign oil, as long as once the technology is in place to move to 100% renewable energy, we actually move to renewable energy.

    40. Re:NOVA episode by Decker-Mage · · Score: 1

      Agreed. Complacency is a continuing issue with all technological solutions and has been since the first flint or obsidian tools. I don't settle for good enough, even when I worked for the guv'ment, but it does seem to be the human condition. Sadly.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
  3. What a wonderful idea. by Freaky+Spook · · Score: 3, Insightful

    Stop the increase of the climate change from CO2 pollution, with more pollution!!!!!!

    Although there is probably some good science behind the idea, there was also good science behind the idea of using the Cane Toad to kill the Cane beetle, and that worked out well for everyone didn't it.

    1. Re:What a wonderful idea. by kfg · · Score: 2

      Before we go fucking around with the Earth as a whole it might be a good idea if we first figured out how to make a biodome work worth a damn, a much simpler undertaking.

      There might also be something of an instructive parable in the lives of people like Emperor Ch'in and Howard Huges, who died of their attempts to remain alive.

      KFG

    2. Re:What a wonderful idea. by megaditto · · Score: 1

      You will find that many problems can be solved by "fighting fire with fire".

      Literally, controlled burnings and backfires can be used to stop forest fires.
      Cancer-causing agents such as X-Rays, BrdU, Taxol, and Thalidomide can be used in chemotherapy to kill cancer.
      Immunizations often use attenuated pathogens to build up body's immunity to the real thing.
      Even cities have to at times be destroyed in order to save them.

      --
      Obama likes poor people so much, he wants to make more of them.
    3. Re:What a wonderful idea. by tsjaikdus · · Score: 1

      Stop the increase of the climate change from CO2 pollution, with more pollution!!!!!!

      It's like a patch for Windows. Once you start patching, you'll never be able to stop.

  4. It may have cooled down the earth.... by Anonymous Coward · · Score: 1, Informative

    The effects of the eruption were felt worldwide. It injected large amounts of aerosols into the stratosphere--more than any eruption since that of Krakatoa in 1883. Over the following months, the aerosols formed a global layer of sulfuric acid haze. Global temperatures dropped by about 0.5 C (0.9 F), and ozone destruction increased substantially.

    from http://en.wikipedia.org/wiki/Mount_Pinatubo

  5. Old News by EinZweiDrei · · Score: 1

    This has been kicked around for a few years, at least. I remember reading it in Thomas J. Elpel's "Direct Pointing to Real Wealth", which is very out-there and hippieish. As such, I'm mildly surprised it's news at all to a science-minded website such as this one.

    --
    Perhaps life really is full of possibilities.
    1. Re:Old News by kfg · · Score: 2

      I'm mildly surprised it's news at all to a science-minded website such as this one.

      This website tends to derive its science mind by watching anime and playing Final Fantasy.

      KFG

    2. Re:Old News by myowntrueself · · Score: 1

      This website tends to derive its science mind by watching anime and playing Final Fantasy.

      And in other 'science' news yet another uninterruptible, interminable cut scene will be coming up any time now...

      --
      In the free world the media isn't government run; the government is media run.
  6. Sounds more like... by Lazarian · · Score: 1

    killing the paitient to cure the disease.

    1. Re:Sounds more like... by Shiny+One · · Score: 1

      You've gotta wonder if this has been really thought through properly.

      If we drop the temperature of the earth short term by a single degree, it could continue to drop. It's not like polluting the atmosphere is a reversible thing. We may be forced underground to take advantage of the earth's warm core.

      "[...] we do know it was us that scorched the sky. [...] It was believed they would be unable to survive without an energy source as abundant as the sun."

    2. Re:Sounds more like... by brit74 · · Score: 1

      "Sounds more like killing the paitient to cure the disease."

      No, "killing the patient" would involve the elimination of humankind, or the destruction of life on earth in order to stop global warming.

  7. Global Dimming by roesti · · Score: 4, Informative

    We're already doing this, though again, it's in an uncontrolled way. It's called "global dimming", and it's already an environmental disaster in some parts of the world.

    1. Re:Global Dimming by metlin · · Score: 3, Funny

      Are you telling me that the whole world is going to be a dark, rainy, dreary, grey place like England?

      Oh noeeeeees!

    2. Re:Global Dimming by roesti · · Score: 2, Funny
      Are you telling me that the whole world is going to be a dark, rainy, dreary, grey place like England?

      It's also going to be a place where everyone whinges about everything but does nothing about it. And nobody will be able to play cricket.

      Like England.

    3. Re:Global Dimming by Phil246 · · Score: 1

      dang, if you had windy in that list as well i could have sworn you were describing scotland :)

  8. Oh great by Dunbal · · Score: 1

    We are already engaged in an uncontrolled experiment by injecting greenhouse gases into the atmosphere.

          So why not make matters "better" by starting a second, uncontrolled experiment?

    --
    Seven puppies were harmed during the making of this post.
    1. Re:Oh great by drapeau06 · · Score: 1

      Who said anything about uncontrolled? We are leaving all the other planets in the universe pretty much as-is!

  9. Not this again? by It's+Atomic · · Score: 5, Insightful

    A few weeks ago (here, on slashdot) they wanted to pour sulphur or something into the atmosphere, now smog?

    What part of "the earth is 2/3rds water, which evaporates, naturally, the warmer the planet gets, covering the planet in CLEAN, NATURAL, REFLECTIVE, WHITE, FLUFFY, clouds of water vapour" do these brainiacs not get?

    Ever been outside? On a hot day? And had a cloud drift over. Ever felt the blessed relief as you race your bicycle up a 12km, 7% incline, maxing at 22% and felt the cooling effect as the sky becomes more overcast, shielding you from the burning rays of the sun and providing a UV protection of up to 50% compared with clear skies?

    Quit trying to add stuff to the atmosphere, it's where the problems started in the first place.

    The only thing they should be adding to the atmosphere is the leaves of the trees they plant. And lots of them.

    1. Re:Not this again? by MobileTatsu-NJG · · Score: 1
      Ever been outside? On a hot day? And had a cloud drift over. Ever felt the blessed relief as you race your bicycle up a 12km, 7% incline, maxing at 22% and felt the cooling effect as the sky becomes more overcast, shielding you from the burning rays of the sun and providing a UV protection of up to 50% compared with clear skies?


      Please forgive my ignorance, but isn't the reason that Venus's surface is so hot because of the excessive cloud layer? (Or am I just missing an important detail?)
      --

      "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

    2. Re:Not this again? by It's+Atomic · · Score: 1

      http://earthobservatory.nasa.gov/Library/GlobalClo uds/

      ..."In order to form, clouds require the presence of water vapor and aerosols (tiny solid or liquid particles suspended in the atmosphere)-both are found abundantly in Earth's atmosphere."...

      Your point being?

      Partical?

    3. Re:Not this again? by TapeCutter · · Score: 1

      Bullshit, everyone knows clouds are red!.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    4. Re:Not this again? by It's+Atomic · · Score: 1

      I'm in Melbourne. It's tragic what's happening out there in the bush, absolutely tragic. I am not sure that spraying sulphurous chemicals into the atmosphere is going to improve the situation, however.

      Clouds of tears for the loss of life as they knew it.

    5. Re:Not this again? by TapeCutter · · Score: 1

      I'm also from Melb. The sulphur thing is not a new idea, it would be about as effective as the darkness knob on a cheap toaster.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    6. Re:Not this again? by Talinom · · Score: 1

      Ever been outside?

      Um, this is Slashdot. What is this "outside" of which you speak?

      --
      "Giving money and power to governments is like giving whiskey and car keys to teenage boys." - P.J. O'Rourke
    7. Re:Not this again? by It's+Atomic · · Score: 1

      "Outside" is where the pizza guy comes from / goes to after he drops your pizza off!

      Phew, wasn't sure if anyone would get my weak stab at humour. Thanks.

    8. Re:Not this again? by mulcher · · Score: 1

      Actually Sulfur is a major determinant of cloud formation.. at least over the ocean.
      http://www.csa.com/discoveryguides/dimethyl/overvi ew.php

      Sulfur acts as a cloud condensing nuclei (CCN) which attracts water molecules...

      Clouds are formed by dust, dirt, and sulfur... So your point about an "all natural
      all organic" pure water solution is just plain wrong..

    9. Re:Not this again? by It's+Atomic · · Score: 1

      I'm pretty sure clouds are formed by water vapour too, or are you talking about a different form of cloud than the ones I am meaning? You know, the ones that drop down rain!?

      For the sake of semantics, here are my intended definitions of some words:

      http://www.answers.com/naturally
      Naturally: By nature; inherently.
      http://www.answers.com/organic
      Organic: Of, relating to, or derived from living organisms: organic matter.

      Now look at what I said, compared to what the articles says:

      Me:
      ---
      "the earth is 2/3rds water, which evaporates, naturally, the warmer the planet gets, covering the planet in CLEAN, NATURAL, REFLECTIVE, WHITE, FLUFFY, clouds of water vapour"

      Article:
      --------

      "...natural gases play an important role in moderating our climate..."
      "...Trace concentrations of a sulfurous gas were discovered ..."
      "...Clouds affect the Earths radiation balance and thereby greatly influence its temperature and climate...."
      "...Data indicate that clouds have an overall net cooling effect...."
      "...Albedo is an important factor in the radiation balance, and clouds have the major effect on albedo...."
      "...This affects the radiative properties (reflectance, transmittance and absorbance) of the cloud...."
      "...DMS may influence both the hydrologic cycle and the global heat budget through its part in cloud formation, and may alter rainfall patterns and temperatures...."

      May! The author of the article is far less confident than you are! Why is that??

      I will paraphrase the final point: sulphur gets into the atmosphere from the ocean when naturally occuring organisms are consumed / damaged or killed, and other naturally occurring organisms break down their constituent parts. "...In the ocean dimethylsulfide is produced through a web of biological interactions...."

      Sounds pretty bloody natural to me.

      Compared to dumping a shitload more based on what some very finite-knowledged human (or better yet TEAM of humans) thinks is the right way / amount / time to dump even *more* into the atmosphere, it's very natural.

    10. Re:Not this again? by evilviper · · Score: 1
      A few weeks ago (here, on slashdot) they wanted to pour sulphur or something into the atmosphere, now smog?

      If you RTFA you'd see they are talking about sulphur here, NOT SMOG.

      What part of "the earth is 2/3rds water, which evaporates, naturally, the warmer the planet gets, covering the planet in CLEAN, NATURAL, REFLECTIVE, WHITE, FLUFFY, clouds of water vapour" do these brainiacs not get?

      Oh, maybe they don't get the fact that (transparent) moisture in the air will naturally latch on to tiny particulates (like sulphur) to form opaque "REFLECTIVE, WHITE, FLUFFY, clouds of water vapour" when the humidity is lower than would otherwise be required.

      Oh wait, maybe they do! And maybe it's only you (and the idiot mods) criticizing the experts that don't really understand what you're talking about.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    11. Re:Not this again? by It's+Atomic · · Score: 1

      Oh. So you agree, then? That we should pump sulphates into the atmosphere?

      Ever heard of equilibrium?
      http://www.answers.com/equilibrium
      A condition in which all acting influences are canceled by others, resulting in a stable, balanced, or unchanging system.

      So, very naively and simply (but most importantly, naturally):
      plankton (incl. sulphur+stuff) + seawater + other organisms --> broken plankton + sulphur + stuff + seawater + other organisms

      sulphur + stuff + seawater + other organisms + sunlight --> sulphur in the atmosphere, helping create clouds.
      Now add more sulphur, unnaturally, to the right hand side of the equation. This is basic, naive, unexpert chemistry.

      sulphur + stuff + seawater + other organisms + sunlight + sulphur already in the atmosphere --> sulphur in the atmosphere, helping create clouds + (remaining in the sea) sulphur + stuff + seawater + other organisms + acid rain

      ie you potentially raise the sulphur content of the oceans. Great idea. Kill anything on a global scale lately? Poison any oceans lately?

      People who really think these "experts" can determine when and where to "add things to the naturally occurring biosphere to improve or positively change things" are delusional, surely?

      The exact same arguments as the last slashdot article.

      I RTFA, you twit, it was titled "Could smog protect against global warming?" and contained such pearls of potential joy as
      "...A massive dissemination of pollutants would be needed every year or two, as the sulfates precipitate from the atmosphere in acid rain...."

      Acid rain, you retard, acid fvcking rain. Deliberately produced by man. Unnaturally. I will never stop criticizing experts who advocate increasing the levels of acid rain in the atmosphere. Seen what acid rain does to trees, genius? Great solution, kill more trees via acid rain to reduce global warming. ffs.

      They go on to say "...n past years scientists have scoffed at the idea of air pollution as a solution for global warming, saying that the kind of sulfate haze that would be needed is deadly to people...." etc.

      Call me an idiot all you like, but ADDING MORE SHIT TO THE ATMOSPHERE is not the solution, it's the fvcking problem. The article appears to agree with me. Maybe you should RTFA article again?

    12. Re:Not this again? by willy_me · · Score: 1

      Clouds may appear to limit the heat from the sun, but in reality they actually add to the problem. The energy from the sun gets transfers into the H2O of the clouds. With respect to global warming, this is no different then the energy transferring into the ground. Either way, the energy from the sun is deposited into the atmosphere.

      Where clouds add to the problem is that they insulate the ground preventing heat from escaping. Ever see clouds when it's 40 below? Where I live it never goes below -20 when there are clouds in the sky. Without clouds it can hit -50.

    13. Re:Not this again? by evilviper · · Score: 1
      but isn't the reason that Venus's surface is so hot because of the excessive cloud layer?

      It's the dense atmosphere of Venus (which incidentally also happens to make the formation of clouds possible) holding heat it, but not the clouds themselves.
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    14. Re:Not this again? by evilviper · · Score: 1
      The energy from the sun gets transfers into the H2O of the clouds. With respect to global warming, this is no different then the energy transferring into the ground.

      Clouds are white, and reflect much of the sunlight, unlike the ground...

      Even if that wasn't so, having the heat disperse higher up in the atmosphere would be a slight improvement, as more of it would then escape into space.

      Ever see clouds when it's 40 below?

      Ever see clouds when it's 120 above?
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    15. Re:Not this again? by MobileTatsu-NJG · · Score: 1

      Thanks for the clarification. I didn't trust my public school education on that topic. :)

      --

      "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

    16. Re:Not this again? by kabocox · · Score: 1

      Quit trying to add stuff to the atmosphere, it's where the problems started in the first place.

      No, we just need to build gaint cloud generators around our cities. Let's just A/C the out doors a little.

  10. And when the Smog Monster causes problems... by Channard · · Score: 4, Funny

    .. that's when we call in Godzilla.

    1. Re:And when the Smog Monster causes problems... by CrazyJim1 · · Score: 1

      Yah, I think Godzilla could take Smaug.

  11. The science is duping itself... by bjelkeman · · Score: 1

    This is nearly a dupe of another Slashdupe story which was up not so many days ago.

    --
    Akvo.org - the open source for water and sanitation
  12. Ok what if it gets too cool? by McNihil · · Score: 1

    I mean, if we for example trigger the climate into an ice age kind of way then its going to be really bad. I don't think it is a good idea to try and fuck with mother nature because she will only need to fuck us once and we will be gone where the dinosaurs roam.

    1. Re:Ok what if it gets too cool? by maxwell+demon · · Score: 3, Funny

      Reminds me of the old joke:

      Two planets meet: "Hello, how are you?" - "Bad. I've got homo sapiens." - "Don't worry. That passes."

      --
      The Tao of math: The numbers you can count are not the real numbers.
  13. Maybe we should just accept the impacts by Aging_Newbie · · Score: 1

    Maybe we should just accept the impacts of global warming instead of trying to cover them up too early. It has taken several years for the policymakers to quit their denial phase and at least acknowlege a problem. If a quick hit can slow the warming for a while then everybody will be encouraged to continue profligate carbon consumption for another few years or a decade. Every delay we induce in the current impact will make the subsequent situation worse. Instead, let's start adapting now so we don't have as much disruption later. Ya know, maybe if we have to change our lives to adjust we will ask how we can actually reduce the problem. What a concept!

    1. Re:Maybe we should just accept the impacts by Pierre · · Score: 1

      you are clearly not an engineer :)

      we can fix anything - and then blow it up again...

  14. Deja vu ... by maxwell+demon · · Score: 1

    I knew I've read about that on Slashdot before.
    If you follow the link in the old Slashdot story, you'll find out that it's indeed about Paul Crutzen's idea as well.

    --
    The Tao of math: The numbers you can count are not the real numbers.
    1. Re: Deja vu ... by Black+Parrot · · Score: 2, Funny

      > If you follow the link in the old Slashdot story, you'll find out that it's indeed about Paul Crutzen's idea as well.

      Hell, we won't even read the current Slashdot story.

      --
      Sheesh, evil *and* a jerk. -- Jade
  15. Wrong, sir, wrong! by Anonymous Coward · · Score: 2, Insightful
    The theory is that pollution is greatly masking the effects of global warming.
    No. The theory is not that "pollution is greatly masking the effects of global warming." The theory is that pollution is inhibiting the engine thereof.
  16. logisitcs by terrymr · · Score: 1

    Volcan eruptions tend to throw a staggering amount of rock & dust into the air ... that's no easy feat to emulate. Compare the energy output of the Mt St Helens eruption with modern nuclear weapons for example.

    1. Re:logisitcs by terrymr · · Score: 1

      Volcanic even.

    2. Re:logisitcs by Beryllium+Sphere(tm) · · Score: 1

      It's a problem that's easy to parallelize :-)

      The most common explanation for the 1940-1970 temperature plateau is particulate pollution.

    3. Re:logisitcs by doktoromni · · Score: 1

      You don't need the equivalent mass of dust thrown by volcanic eruptions. You need the equivalent *reflexive surface*. And that can be done with drastically smaller masses, provided that the size of the particles is much smaller than the average particle size thrown by volcanoes and thus the mass-to-surface ratio is tiny. In other words, engineered particles can be made fine enough so that you don't need unrealistic ammounts of them to produce some noticeable effect.

  17. We might not have to do anything at all by DiamondGeezer · · Score: 1

    This paper predicts (as do many solar scientists) that the next two solar cycles will be much weaker than has happened for more than 100 years. If that happens the temperature will drop an average 1.5C which is what happened during the "Dalton Minimum".

    That cool enough for you?

    In 20 years time, they'll be praying for global warming.

    --
    Tubby or not tubby. Fat is the question
  18. Actually, it is when you look at ALL the effects. by Engineer-Poet · · Score: 2, Interesting

    FWIW, I came out for something like this last April.

    Shading the Earth won't get rid of the direct effects of excess CO2, such as ocean acidification and preferential growth promotion of undesirable plants like woody vines vs. trees. But the beauty of injecting a few million or tens of millions of tons of sulfur in the upper atmosphere is that it spreads out much more widely, the effects will reduce drought and heat stress which are killing plants and turning land into desert, and you might even cut the original pollution by taking the sulfur from some existing source.

    Cutting heating and stress on plants looks like it reduces the CO2 problem directly, by enabling better CO2 uptake. If you don't believe me, take a look at the Keeling curve and tell me what else could explain the flattening in the two years after Pinatubo. Take your time, I'll wait.

  19. NASA Shades the Earth by pizpot · · Score: 1

    This just in: NASA engineers have desided to stop global warming without more chemical experiments. They are going to put a semi-transparent sun shade in orbit around the sun. It will evenly block 30% of the suns rays from hitting the earth. Says Pizpot, a Slashdot reader, "Why didn't I think of that"?

  20. Bad article title - SO2 isn't smog by Engineer-Poet · · Score: 3, Informative

    Photochemical smog is the product of reactions between hydrocarbons, oxides of nitrogen and ultraviolet light. Smog contains ozone. This has almost nothing to do with smog.

  21. Re: Simulations by Black+Parrot · · Score: 1

    > When you program a computer model to raise the temp when you increase CO2, the computer program will tell you the temp will go up when you raise CO2.

    So, what part of the physics of greenhouse gasses do you reject?

    > We can't predict weather 5 days out with our current computer models, how could they possibly predict these other trends?

    For a lot of phenomena it's far easier to predict the longer-term trends than the shorter-term details.

    --
    Sheesh, evil *and* a jerk. -- Jade
  22. Mad scientist? by shd666 · · Score: 1

    Filling atmosphere with something.. hmmm.. Why does this bring "Mad Scientist" into my mind?-)

    1. Re:Mad scientist? by pimpimpim · · Score: 1

      Ok, just consider this: he is originally from the Netherlands (which is known for half of it being below sea-level), he won the nobel prize due to his research on the ozon layer, and now he lives in Germany (well above the sea-level). Coincidence? I would say: dutch people: buy some rubber boats now, just in case!

      --
      molmod.com - computing tips from a molecular modeling
  23. Re:Simulations by maxwell+demon · · Score: 1, Informative
    We can't predict weather 5 days out with our current computer models, how could they possibly predict these other trends?

    When will people stop using this silly argument?

    Do you know if in ten days it will be warmer or cooler than now? Probably not.
    Do you know if the next summer will be warmer than the next winter? If you live in the northern hemisphere, at a sufficient distance to the equator, I'd bet on it.

    So how can we know that the summer will be warmer than the winter if we can't even tell the temperature change in about ten days? Think about it!
    --
    The Tao of math: The numbers you can count are not the real numbers.
  24. Will only exacerbate the problem by Gandalf_the_Beardy · · Score: 2, Informative

    Global dimming either from this or other means (like sulphate aerosols) will only result in less light reaching the surface. Yes it will result in less warming. But also there's less photosynthesis, less crop production, and a reduction in fixation of CO2 from the atmopshere, causing CO2 levels to rise yet further. Instead of trying to fix the symptoms, we should be trying to fix the underlying problem and that is ceasing to burn carbon. The fix is simple. Replacing it with something else is the real problem and that is where efforts should be focused (like a decent fusion reactor and hydrogen economy but that's a whole new debate)

    1. Re:Will only exacerbate the problem by SpectralDesign · · Score: 1

      Not to mention -- to put enough smog/sulpher into the upper atmosphere to make a significant impact will take how much energy, exactly? And how will that alter the warming/dimming/polluting types of equations?

      --
      Be who you are and say what you feel, because those who mind don't matter and those who matter don't mind. - Dr. Seuss
  25. Oh Goodie by dasunt · · Score: 1

    So we have the global warming research crowd which lives and dies by the research grant, and we have the anti-global warming crowd which lives and dies by funding.

    And there's the global warming mitigation crowd who wants to create fame or money solving the problem.

  26. On the contrary... by SuperStretchy · · Score: 1

    This whole argument is based on the highly-attested theory that global warming is in fact occurring. There's numerous evidence that global warming is a fallacy. I'm not saying which side is correct, but basing this theory on another theory (which may or may not be true) is not a wise idea.

    1. Re:On the contrary... by maxwell+demon · · Score: 1

      Of course, the real solution is to increase piracy.

      --
      The Tao of math: The numbers you can count are not the real numbers.
    2. Re:On the contrary... by It'sYerMam · · Score: 1

      Please read what a Scientific theory actually means before you start charging off on your non-sequiturs. The Theory of Evolution, Relativity, Quantum Theory... are all "just" theories.

      --
      im in ur .sig, writin ur memes.
    3. Re:On the contrary... by SuperStretchy · · Score: 1

      Correct.. and none have been proven, correct? By theory I mean a scientific proposal not proven to be true. Which also means that it has not been proven untrue. My college physics teacher once told me that it takes more faith to believe in Evolution than anything else. I try to raise the point that I don't like to be told what is "truth" by a group of people who make it their life's goal to prove what they believe is true to be true. I'm sure 99% of you would say the same thing with ID in mind. Therefore, don't get on my case when I raise that point when you don't even know what side of the line I stand!

    4. Re:On the contrary... by It'sYerMam · · Score: 1

      Of course none have been proven. Proof is the domain of mathematics and logic, not of science. If you want to doubt all theories because they're unproven, that's fine, but the rest of us will get on with our lives and use theories for what they are - the best substitute for truth there is when a decision needs to be made. Whatever side of the line you stand on, it does no good to make false implications of meaning.

      --
      im in ur .sig, writin ur memes.
  27. Re:What should I take next semester? by joshetc · · Score: 1

    Reading comprehension.

    This is slashdot, not a college campus.

  28. Chemtrails? by kimvette · · Score: 1

    Ever see the conspiracy sites regarding "chemtrails?"

    A few years ago the government publically tested (google, you'll find government web sites covering this, and it's far less insidious than what the conspiracy nuts suggest) certain particulates and their effect on weather patterns. Between this and cloud seeding, there isn't really anything new or earth-shattering about the idea.

    The question is: how do you spread enough particulate matter? It would take many, many aircraft and tremendous amounts of fuel to distribute such matter - PLUS the matter needs to be inert/non-toxic (so using fissionable nukes is likely not an option).

    Another option is to perfect nuclear fusion devices (so that no fission reaction is required to spur it) and look into the potential using those devices to induce volcanos to erupt. Not very practical no matter how you look at it, considering that the power of natural explosive volcanic eruptions (Mt. St. Helens, Vesuvius, etc.) dwarf even our largest nuclear devices.

    It's an interesting solution, the problem is how does one go about getting enough inert fine particulate matter high enough in the atmosphere to a) remain suspended for any length of time and b) effectively reduce IR without reducing the UV that plants require for photosynthesis?

    --
    The Christian Right is Neither (Christian nor right). See: Matthew 23, Matthew 25, Ezekiel 16:48-50
    1. Re:Chemtrails? by Beryllium+Sphere(tm) · · Score: 1

      Plants photosynthesize from visible light, and if you want particulates in the atmosphere just stop using scrubbers on power plants. And Mt. St. Helens was 24 megatons, the largest human test was 60 megatons (though everything in current arsenals is smaller).

    2. Re:Chemtrails? by myowntrueself · · Score: 1

      Ever see the conspiracy sites regarding "chemtrails?"

      I know several "chemtrail" conspiracy nuts.

      And I feel deeply sorry for them; they are unable to enjoy the simple beauty of a sunset, for them its 'evidence' of the 'chemtrail conspiracy'.

      Sad...

      --
      In the free world the media isn't government run; the government is media run.
    3. Re:Chemtrails? by flyingfsck · · Score: 1

      How do you spread the particles? Easy - You just remove the particulate filters from the coal fired power station smoke stacks.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
    4. Re:Chemtrails? by kimvette · · Score: 1

      Will that cause the particulates to rise to the stratosphere?

      The answer is not the Futurama-esque "just create more garbage"

      --
      The Christian Right is Neither (Christian nor right). See: Matthew 23, Matthew 25, Ezekiel 16:48-50
    5. Re:Chemtrails? by WhiplashII · · Score: 1

      This is easy if you stop trying to go it alone and start thinking about using existing resources. Every day there are just over 10 million aircraft that take off, go up to the stratosphere, and then come back down. Want to get something up there? Coat the bottom of the wing with it, put it in a bag, something. A $10,000 change to the airplane, a few thousand dollars a year to refill the bags at major airports. Easy.

      They say they need about 10 million tons of sulfur put up per year. That is 5 pounds (2.5 kg for you EU guys) per flight! Are you going to tell me that we couldn't require planes to take an extra 5 pounds up with them?

      Now the question of should we do it is valid - but can we do it is not a question.

      --
      while (sig==sig) sig=!sig;
    6. Re:Chemtrails? by Decker-Mage · · Score: 1

      Slight flaw there, since you obviously don't know nuclear weapons design. Fusion weapons use a fission nuclear device to initiate the fusion reaction. You also seem to assume that a fusion detonation yields reduced radiation effects, the only reason I can discern for why one would select a fusion device, as compared to a fission device. That's a heck of an assumption with nothing to back it up. There are numerous conditions that effect the results, most of them environmental.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
  29. Wait a minute... by denmarkw00t · · Score: 1

    Didn't this happen on Futurama once and it all went horribly wrong? Did robots fart? itsatrap, for sure - don't let that Nobel Prize mislead you...they can be deadly (reference: Simpsons episode "Bart Gets Famous" where Lisa impales Bart on her Nobel Prize but I couldn't find a screencap *do'h*)

  30. Introduction of forgien stuff... by jadobbins · · Score: 1

    Hmm, this kind of reminds me of when they introduced a species of animal into Australia that didn't belong there to combat another animal, then that animal thrived and caused more harm than good. When you make a soup too salty, you can't very well add more stuff to make it taste right. You gotta ditch it and make a new soup. We can't really ditch our atmosphere and start over, but we can definitely stop putting more crap in it before it's too late. I dream that my kid's first car will be powered by hydrogen fuel cells and spit water out the exhaust pipe.

    --
    "There is no Honor, without Pie."
    -Weeble
    1. Re:Introduction of forgien stuff... by trewornan · · Score: 1

      This is marginal admittedly but, if you haven't added a lot too much salt a little sugar can mask some of it, it's a tactic of desperation but it can really dig you out of the shit.

    2. Re:Introduction of forgien stuff... by jadobbins · · Score: 1

      Aye, but adding sugar to overly salty soup makes shity soup. The best option is to not put too much salt in in the first place. We need to quit killing our atmosphere with pollution, instead of waiting until it's too late and then filling it with more crap to 'mask' the effect of the pollution.

      --
      "There is no Honor, without Pie."
      -Weeble
  31. Photosynthesis by EmbeddedJanitor · · Score: 2, Informative

    Without light surely our plant friends won't be able to soak up the CO2 at ground level.

    --
    Engineering is the art of compromise.
    1. Re:Photosynthesis by doktoromni · · Score: 1

      Hey, they are not talking about blocking the sun completely a la Matrix. It is just a few percent reduction in sunlight, without significant consequences for photosynthesis.

  32. Re: Simulations by dabraun · · Score: 2, Insightful
    > We can't predict weather 5 days out with our current computer models, how could they possibly predict these other trends?

    For a lot of phenomena it's far easier to predict the longer-term trends than the shorter-term details.


    Or, put another way, it's simply harder to disprove long-term claims by the global-warming crowd since their scare tactic is based on something that even they say won't happen for a long time. For now I'll stay firmly in the 'no way we can tell what's going to happen' camp; which is not to say that pollution is acceptable, there are plenty of provable local effects (smog anyone?) which tell us that reducing the crap we spew into the atmosphere is a good idea.

    I'm just not buying into the doomsday prohpecy or the draconial measures that the global warming PAC wants to apply to first world nations while completely ignoring the actions of third-world nations (kyoto). These types of things fly directly in the face of any claim that the issue is about global, rather than local, impact.

    * I drive a prius, fwiw.
  33. Reckless Driving by Doc+Ruby · · Score: 5, Insightful

    All these drastic actions that do more to mess with our environment are reckless. We barely understand that we don't really understand the complex feedback systems we've already upset. We have a much higher confidence that merely reducing our Greenhouse pollution will at least buy us time to learn what we can do to stay in the climatic "sweet spot" in which we've evolved our civilization.

    Not to mention that producing all these extra artificial climate "enhancements" will produce a lot more pollution in their industrial processes. And use the existing political economics players, in manufacturing and energy, who have shoved us down the road to the Greenhouse with reckless abandon. They will screw up any complex/delicate procedure if it means more fast money, regardless of the worse consequences that they'll have to share (except the really old capitalists who'll die before their legacy is inherited).

    Startling politicians, who understand Climate Change only as a buzzword tradeable on the open market, with visions of increasing pollution to fix the climate hazards that pollution has created is a terrible way to do business. It will just lock down their fear and greed. The reptile brains that survived the last climate change cataclysm, wrapped in mammal bodies. I don't want to go the way of the dinosaur, especially by voluntarily throwing myself to the Tyrannosaurus Rex who represents the fossil fuel industry.

    --

    --
    make install -not war

    1. Re:Reckless Driving by Doc+Ruby · · Score: 1

      Anti some capitalists is not "anticapitalist". Those of us capitalists who want capitalism to be sustainable so we can keep making profits are certainly not anticapitalist. It's the capitalists whose business destroys the relatively equitable capitalism in favor of corporate anarchy, feudalism, or worse, who are the anticapitalists. They're the looters.

      The segue into reptiles and dinosaurs might have gone over your head, even though you know that fear comes from your reptile brain, and your oil comes from fossil feuls. Your "WTF" reaction comes from your fear that more is going on that threatens you. Which you've already started to admit, but cannot grasp, blocked by the knowledge available to you as well as it is to me, but which you repress to go about your own business in whatever is your way. When I dropped the image of a Tyrannosaurus Rex on you, you spat out an Anonymous Coward insult. Which is just bait for me to hit you again with the truth.

      You're welcome. Even though you're an Anonymous asshole Coward. Even your kind of person needs to understand what we're doing to ourselves, if we want to change it. But you don't have to be such a dick about your own limited intelligence.

      --

      --
      make install -not war

    2. Re:Reckless Driving by Doc+Ruby · · Score: 1

      Anonymous wilderness Coward, you're bewildered because you're a nerd, not a geek. Herpetologists are reptile nerds, with a brain. You're just a snake. Spitting Anonymous Coward venom. I drink venom for breakfast. I inherit your Earth as you go extinct. Anonymous looter Coward.

      --

      --
      make install -not war

    3. Re:Reckless Driving by Doc+Ruby · · Score: 1

      OK, Anonymous lizard Coward, you can't even tell when I'm using your own "herpetologist" invocation to make a point about your lack of intellect. "WTF" isn't a natural right, except for dummies, when reacting to something perfectly sensible, like my post.

      I'm not worried about you. But it's more fun to poke you back than it is to wrestle alligators. So you prefer people who claim not to like me. So that justifies your personal attacks when you're the one who can't understand an intelligible post of mine? Stick to snakes. They're more reliable, preferring your heat while ignoring your lack of sense and manners.

      --

      --
      make install -not war

  34. Clouds cut both ways by Beryllium+Sphere(tm) · · Score: 3, Informative

    Ever been outdoors on a clear spring or winter night? It's colder without clouds. Clouds hold in heat on the night side.

    Low-level clouds shade the ground but the reflected sunlight just warms up the lower atmosphere on its round trip. Very high clouds have a cooling effect, though.

    Fortunately, the work on climate change is being done by people who understand these effects and who observe and refine numbers for them.

    1. Re:Clouds cut both ways by Decker-Mage · · Score: 2, Insightful
      Fortunately, the work on climate change is being done by people who understand these effects and who observe and refine numbers for them.

      Ummm..., yeah..., right. Sorry to disillusion you but that is not the case. Clouds and there effects within climatological systems, especially all the positive and negative feedback loops, are the most badly broken area of the computer models and unfortunately the area where we need the best answers. Clouds may very well determine whether we face an ice age or a Venusian future. By way of background, I got my start back in my early teens creating models, empirically testing them against the real world, and teaching my techniques. So far the computer models I've examained and/or read journal articles about do not compare well with real world behavior. You could say models are my 'thang', statistics, systems engineering and analysis, and econometrics (& sociometrics for that matter) and just the way to bring the models into alignment with the real world and make use of them. Archeology, nuclear engineering, logistics, OSHA/HERP/HERF/HERO (some milary jargon in there), epidemiology, bsusiness process, process engineering, power generation, even sociological and psychological, those are just a few disciplines I've operated in and saved the government millions per year (and more than a few lives). [I just wish the government has given me a cut! Oh well.]

      The climatological computer models and often enough aren't even generating predictions of the same order of magnitude, high or low, which is disconcerting in the least and inexcusable in any well-observed or well-understood system, which tells me that climate is neither. Even the mathematical systems of climate are poorly understood. They are non-linear, chaotic systems. While such features do occur in other models I have done over the years, that are not the central defining characteristic of the system! If I had attempted to use these models for a research project before the chairman of my department, I would have been laughed out the door. Dr. F. N. David had no tolerance for inaccurate models and that was the very first thing she taught: follow the data; do not attempt to manipulate the date to match the preconceived model. I shudder to think what would have happened in the military or later working for civil service using models with such accuracies.

      Lastly, as I poionted out above, establishing and enforcing policy decisions based upon models that may, or more likely not, represent the way the (system) actually works is idiotic if not absolutely foolhardy. Multi-disciplinary systems are another of my 'thangs' and climatology overlaps fields from atmospherics to biology, botany, oceaonography, thermosdynamics, and especially vulcanology. The sad fact here is that we completely lack the systems people to even get a good hack at this problem and those that do exist, well good luck getting funding, let alone published. Polymaths are not appreciated where they abide. Especially when they ignore ideologically approved agendas.

      The fields of politics and the sciences are littered with the wreckage of ideologically driven policies based upon theory, not data. Is the globe warming? Yep, nope, maybe. Is it entirely due to man? I doubt it and find that yet another example of Homo Hubris at work. You can actually flip a coin as to whether we are in a period of global cooling or global warming simply upon the basis of what year you select as your baseline for temperature measurements and where those measurements were collected, I cannot emphasize that enough.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
    2. Re:Clouds cut both ways by Decker-Mage · · Score: 1
      I'm not at all opposed to dealing with it so long as we know what we are dealing with. I've already laid out elsewhere here several approaches, critical paths actually, to drastically reducing our carbon budget at least in the First World (developed nations). And it should be noted that even nations in the developing world, e.g. China and India to give just a couple, are investing in non-petroleum product based power production. As it currently stands, answer A is correct but not due to a lack of solutions. We are simply not investing wisely. Near-term political and finaancial returns rule in our system as it currently stands and I don't see that changing until Fresno and Sacramento, CA. become beach-front property or New York City is under a glacier.

      If I should be still alive, which is doubtful as I'm terminal but I've made it past my expiration date by two years so far, I'm going to be in column B without the four arms required. One nice thing about spending much of my early teenage years assosociateing with anthropologists and archeologists (Mom has a Ph.D in Angropology) is that you can practically drop me anywhere on the planet, bare-ass naked, and I'll be able to cope. Don't get me wrong, I'll miss the heck out of my tech, especially my collection of computers, but you can't eat a computer.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
  35. Highlander II: The Quickening by grouchomarxist · · Score: 1

    I think he took this idea from Highlander II: The Quickening, but in that movie it was a pollution-like shield to protect the earth after the depletion of the ozone layer.

  36. Since nature is a complex beast... by Jugalator · · Score: 4, Insightful

    Well, nature is among the most complex systems we're aware of, so it's always extremely hard to claim an idea and easily see if it'd work. The obvious question this idea raises to me is for example: how would the reduced solar energy affect wildlife, and what chain effects would that have to nature, both as for animals and plants?

    --
    Beware: In C++, your friends can see your privates!
    1. Re:Since nature is a complex beast... by shadowmas · · Score: 1

      And that's not the only problem. even provided that sufficient solar energy continues to reach earth what about the effects of smog itself on people. the existing 'smog' already creates so much breathing difficulties in people. how much of a would it be when we make smog intentionally.

      "Well the good news is you wont need to wear sunscreen, the bad news.. well the bad news is you'll have to wear a gas mask"

    2. Re:Since nature is a complex beast... by khallow · · Score: 1

      Smog is a somewhat inappropriate name here. Nitrogen oxides and ozone are the primary ingredient of smog (at least in developed countries). And the sulfur dioxide would be inserted at high elevations well above human habitation. The mixing between that region and the lower atmosphere is limited, so I understand. OTOH, sulfur dioxide is a significant cause of smog-related deaths and inserting this much sulfur dioxide (10 million tons a year) will contribute to some extent. Be aware that far more sulfur oxides than this are inserted each year (according to the previous link natural sources emit 80-290 million tons and human sources emit 70-100 million tons). The key is that this sulfur dioxide would be inserted above cloud layers. One thing that is nice is that sulfur dioxide will come out in about two years time which is pretty good for an atmospheric modification.

    3. Re:Since nature is a complex beast... by khallow · · Score: 1

      Nature is also a stable system. So it's reasonable to believe that small enough changes means small effects. So mildly reduced solar influx might mean (depending on how much sulfur dioxide blocks electromagnetic frequencies used by plants) mildly reduced photosynthesis and plant growth. I don't see a compelling argument that slightly reduced photosynthesis is a real problem except that it might slow down some carbon sinks. The real problem I see is that we might end up long term with a lot of active controls on Earth's climate such that if one breaks or a mistake is made, then the rest might quickly drive the system out of the old stable point.

  37. GIA affect by phrostie · · Score: 2, Interesting

    it seems to me that the earth has already started to work on this approach on it's own.
    over the past few years as the ocean temperatures have increased, so has the techtonic activity. the number of earth quakes have been on the increase. i would speculate that an increase in volcanic eruptions will be next.

    the question will be what effect this will have on humans?

    1. Re:GIA affect by RsG · · Score: 1

      First up, what evidence is there for an increase in tectonic activity? The past few years have got nothing at all on Krakatoa. We've had one standout (the Indian Ocean tsunami), a few minor earthquakes, and that's about it. You don't even have to go back much more than a century to see an era with more earthquakes and eruptions than today.

      Second, how do you get from ocean temperature to tectonic activity? Those things are not strongly related to each other. Ocean temperature is mostly a function of solar input.

      Thirdly, even the pseudo-scientific "gaia" theory only make provisions for the activity in the biosphere. Basically the theory boils down to the notion that the planetary ecology is self-regulating. That does not have anything to do with tectonic activity, as that is a wholly inorganic process. Moreover, nobody in their right mind would suggest that the planet is self-aware; even the founder of gaia theory presents it as a blind reactionary process, not a sentient one. And even then, the evidence supporting this theory is almost nonexistent.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
  38. Photosynthesis by future+assassin · · Score: 1

    Great so we lower the temp of the planet while we kill away plant life and the insects that go along with it.

    --
    by TheSpoom (715771) Uncaring Linux user here. I have nothing to add to this but please continue. *munches popcorn*
  39. Finally a use foor the space elevator by EmbeddedJanitor · · Score: 1
    Burn the CO2 on earth then pump the CO2 into space to make smog.

    The problem though with any clever ideas like dumping reflective stuff in space is that, if the modelling is wrong ("oops! missed a minus sign!") then the clean-up efforts to go fetch all the stuff back is going to cost quite a bundle and make more environmental problems than we had before we started.

    --
    Engineering is the art of compromise.
    1. Re:Finally a use foor the space elevator by Ruff_ilb · · Score: 1

      Except, consider that, if we can MANUFACTURE the material, we can easily give it some sort of self-destruct mechanism. Heck, we might be able to design proteins that, in their normal stage, would be reflective, but when denatured (which we could do through some specific sort of radiation, or even some sort of otherwise harmless bacteria, or, idk... the possibilities are fairly diverse)

      But anyway, that's my point. If we design the thing from scratch, we can come up with more convenient cleanup methods built in.

      --
      http://www.TheGamerNation.com/Forums
    2. Re:Finally a use foor the space elevator by mikael · · Score: 2, Funny

      Just launch lots and lots of weather balloons - they should be white/silver enough to reflect all that light back out to space. And if arranged correctly, they could be used to create advertising visible from space, offering unlimited advertising opportunities.

      --
      Vintage computer adverts: http://www.vintageadbrowser.com/computers-and-software-ads
    3. Re:Finally a use foor the space elevator by WhiplashII · · Score: 1

      What's funny is that this is exactly what I was blogging about earlier - that if they want to be taken seriously, they should seriously talk about the "inexpensive" remediation policies. I even specifically mentioned putting dust in the high atmosphere. (I wonder if he reads the same blogs I do). In my example, for far less than the estimated $400B per year (1% of GDP) decreasing our fuel consumption would cost we could install dirtbags on airliners and dump reflective dirt in the upper atmosphere.

      At least we are talking about positive steps now, not just "don't kill the planet". This also totally eliminates the conflict of interest between the conservationalists and the global warming problem - in essence, they are saying "we take this global warming thing so seriously that we are willing to put aside tree hugging and give real options."

      --
      while (sig==sig) sig=!sig;
    4. Re:Finally a use foor the space elevator by shigelojoe · · Score: 1

      I don't think that'll work. People have been letting go of helium-filled balloons as long as they've been around and it hasn't done shit yet.

    5. Re:Finally a use foor the space elevator by joto · · Score: 1

      If it didn't work, we would already feel the effects of global warming much better. The golf-stream would have changed direction. And the oceans would boil. Just because you haven't noticed any effect, doesn't mean that those helium-balloons are worthless now...

    6. Re:Finally a use foor the space elevator by Pharmboy · · Score: 1

      easily? might? possibilities?

      I think you have just clearly, if not accidently, described why this is a bad idea.

      --
      Tequila: It's not just for breakfast anymore!
    7. Re:Finally a use foor the space elevator by skarphace · · Score: 2, Funny
      ...golf-stream...
      I loose a lot of balls there.
      --
      Bullish Machine Tzar
  40. Re:Life Imitates Art by MobileTatsu-NJG · · Score: 1

    "Don't these scientists learn anything from the movies, Matrix or Highland 2 anyone?"

    They did, but the episode of the Simpsons where the rogue comet melted in the layer of pollution over Springfield was far more popular.

    Remember: Simpsons reference > Matrix reference.

    --

    "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

  41. what's the difference? by v1 · · Score: 1


    On one hand we're being told that having CFCs and other things around the earth produces "greenhouse effect" and traps heat. Now they are telling us that things in the atmosphere don't do that, they reflect away the heat.

    So which is it? Or do some things reflect while other things insulate? Do we need to mix the coctail properly to get the desired effect?

    Besides, if global warming is a problem, why are they looking for ways to make it warmer?

    --
    I work for the Department of Redundancy Department.
  42. Tylenol by otisg · · Score: 4, Insightful

    This is much like Tylenol - lowers body temperature and temporarily removes pain, but doesn't cure the symptoms.

    --
    Simpy
    1. Re:Tylenol by metlin · · Score: 1

      > This is much like Tylenol - lowers body temperature and temporarily removes pain, but doesn't cure the symptoms.

      Didn't you mean to say, "...cures the symptoms, but doesn't cure the cause"?

    2. Re:Tylenol by MadUndergrad · · Score: 1

      I'd say it's more like using blood-letting to treat the fever.

  43. Re: Simulations by Black+Parrot · · Score: 1

    > Or, put another way, it's simply harder to disprove long-term claims by the global-warming crowd since their scare tactic is based on something that even they say won't happen for a long time.

    On the contrary, it has already been going on long enough for us to observe the consequences.

    --
    Sheesh, evil *and* a jerk. -- Jade
  44. Strawmen... by TyrWanJo · · Score: 1

    While, i will grant that global warming is just a "theory," claiming that this is a valid argument for not trying to develop another theory is quite simmiliar to people who claim that evolution is just theory a and therefore we should neither continue teaching it nor researching speciation, the fossil record, and genomics - without the theory of evolution, those that study these aspects of earth's biology would have nothing to theorize about. This line of argument is neither helpful nor meritricious.

    The evidence pointing toward episodic global warming is very compelling, especially when seen in the hockey stick graph, for those of us who understand visual representations more than verbiage. Global warming, though just a theory, is pretty well established, where the question really lies, and why this atmosphric blanket might need to be further researched is, how much impact are humans really having on the climate? Granted, there is evidence that humans have already managed to divert a global ice age, so it is unlikely that we aren't completely benign, this does not mean that the current warming has as much to do with us as we would like to think. The earth has natural cycles of warming and cooling, so, although I agree that we should cut down emissions, and try to be a little less environmentally impactful, we also need to figure out wether this current relative warmth is due to our noxious by-products, or just part of a natural cycle that has existed for billions of years. On the one hand, humans are highly destructive creatures and should be aware of the harm they cause Gaia, on the other, we are also too proud and need to stop internalizing our locus of control to the point that we loose our pragmatic perception of what is really going on in the world.

    1. Re:Strawmen... by SuperStretchy · · Score: 1

      Hence the reason why I did not claim to support one theory over another. I am not a self-proclaimed expert in this field- however I just wanted to emphasize that I don't like being told what truth is when it has not been proven either way. The same goes for ID vs Evolution. There are many people who even deny both sides of that coin. You say that there is a push to get Evolution out of the classroom- but that is a small minority of whats actually going on. Schools where I live would never ever even consider using ID in textbooks- and yet there are many more instances that seem to prove ID over Evolution than no-global-warming over global-warming.

      Its an interesting debate that makes me long for the day when we find out the "winner". Hopefully we won't all be dead before that point.

    2. Re:Strawmen... by ElPikacupacabra · · Score: 1

      Look... dude. ID is not a theory, it's a piece of crap. I don't know how to put this in simpler terms to you, but I'll try:

      You are misled by the use of the word "theory", which comes from its epistemological meaning. In this sense, a theory would be stating that stepping in front of a moving car will hurt you. If I come an propose a different interpretation that stands to the verification that philosophy requires, let's say that a bunch of invisible gnomes with superpowers come very quickly and beat the shit out of you and trow you away making it look like the car has just hit you, it's called a competing theory. It will have a majority of opponents and one supporter, me. In this case, nobody can disprove me since I am claiming that my theory is supported by evidence that cannot be produced, like an invisible gnome with superpowers. In just the same way ID is a theory.

      Calling evolution a theory is like calling gravity a theory, and like calling global warming a theory. Granted, there is a scale of trust that we can place these theories on. But saying that ID is not considered for teaching because people are close minded is like me saying that my gnome theory is not well received because you are close minded.

      Once again, ID and all the justifications behind it from a very small and vocal crowd are pieces of crap and this is obvious to anybody who has the knowledge to see it.

    3. Re:Strawmen... by SuperStretchy · · Score: 1

      Wow.. a little defensive maybe?

      And by the way, I believe in gnomes.

    4. Re:Strawmen... by SuperStretchy · · Score: 1

      Actually no, /. doesn't notify of replies by Anonymous Cowards with -1 modding. Ignorance is bliss, no?

  45. Short term solution only by Elfan · · Score: 2, Informative

    Most green house gasses stay in the atmosphere for a long time (10-100 years). "Smog" stays up for a much shorter period of time so we would have to keep pumping ever larger amounts of it into the atmosphere daily to offset the green house gasses. That is very unlikely to tenable for a significant length of time.

  46. Re:Simulations by uncadonna · · Score: 4, Informative
    Sigh. Like sweeping sand off the beach. Here we go again...


    Predicting climate is different from predicting weather. I cannot tell you whether Chicago will have a white Christmas (weather prediction), but I can tell you with a lot of confidence that Christmas will be colder than the 4th of July even a million years into the future (climate prediction).

    Climate models are not tricks. The physics goes in. The climate comes out. It's not a trivial curve-fitting exercise the way you seem to think. We call them "primitive equation" models not because they are primitive, but because we *don't put the answer in* in any way. The model isn't told that Chicago winters are cold and Florida winters aren't. It *figures that out* from the physics.

    --
    mt
  47. Uhm by umbrellasd · · Score: 2, Insightful
    1. Add Sulfur to atmosphere to maintain global temperature.
    2. Greatly decrease the pH of precipitation.
    3. Disrupt world plant ecosystems with soil pH modifications.
    4. People die.
    Use a different material; create a different way for people to die.

    A parallel: patient is suffering from atherosclerosis. Do you:

    • A: prescribe a change to the patient's current 50% fat diet, or
    • B: prescribe medication to balance the muck that the patient is pushing into his vascular system?
    A little bit of both, one might say. Well, that is a very costly and risky ("Warning: side-effects may include nausea and death.") approach, which may well become necessary when there is no other option. The reason we typically get to that point of no return is because we consistently refuse to be proactive and solve the problem early and in the right way. "It's just too hard to change my diet." "It's just too hard to cut our emissions. Jobs will be lost. Oh, dear me. Oh! We can start an industry that pumps counterpollutants into the atmosphere. More jobs. More money! More! More!"

    Genius.

    1. Re:Uhm by evilviper · · Score: 1
      3. Disrupt world plant ecosystems with soil pH modifications.
      4. People die.

      Hmm... Funny, I don't remember everyone in the world dying after the 1991 Pinatubo eruption, which this plan is modeled after.

      Use a different material; create a different way for people to die.

      Yup, lots of people dying from contrails every year...

      And people think it's only the skeptics of global warming that are the mindless, anti-scientific nutjobs?
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
  48. Re:Actually, it is when you look at ALL the effect by TubeSteak · · Score: 1
    Shading the Earth won't get rid of the direct effects of excess CO2, such as ocean acidification and preferential growth promotion of undesirable plants like woody vines vs. trees. But the beauty of injecting a few million or tens of millions of tons of sulfur in the upper atmosphere
    I find it funny that you mention ocean acidification right before discussing "the beauty of injecting a few million or tens of millions of tons of sulfur in the upper atmosphere"

    FTFA: A massive dissemination of pollutants would be needed every year or two, as the sulfates precipitate from the atmosphere in acid rain.

    Oops.

    I image that the climatoligists are discussing the problem of acid rain, but I must have missed it.
    --
    [Fuck Beta]
    o0t!
  49. Re:Simulations by Coryoth · · Score: 1
    When you program a computer model to raise the temp when you increase CO2, the computer program will tell you the temp will go up when you raise CO2.

    Or, to be a little more accurate as to how the process works, when you program a computer model with the currently established physics (including things like, say, the absorption spectra of atmospheric carbon dioxide) and various known positive and negative feedbacks etc., the computer program tells you that the temperature will increase when you raise CO2.

    When you program a computer model to raise the temp when you increase CO2, the computer program will tell you the temp will go up when you raise CO2.

    There is, of course, a vast difference between predicting immediate changes at a very local scale, and predicting general trends on a wide (in this case global) scale. I can't predict whether a particular line of chips will have more transistors packed onto it or not, but that doesn't mean Moore's law hasn't been quite effective over the last decade.
  50. Weird. by AsparagusChallenge · · Score: 1

    That's exactly how Dinosaurs (the muppet series) ended, Earl Sinclair proposed covering the earth on smog because of some plague of tropical weed, and then the earth froze and the dinosaurs extinguished.

  51. "The lucky country" by TapeCutter · · Score: 5, Informative

    I live in Australia, here are some recent anecdotes:

    We are currently experiencing the "worst drought in 1000yrs", the Murray-Darling Basin has dried up, our major cities have permenant water restrictions and some rural towns are being abandoned. This years forecast grain harvest has been reduced by 50% (-12,000,000 Tonnes), our dairy herd has been culled by 20%, and half starved livestock have flooded the markets in expectation of an even drier summer.

    We had a record heat wave in october (37C) followed by two cold snaps with snow falling on bushfires and hail the size of cricket balls. The unseasonal frost killed, apples, pears, grapes and other temperate fruit crops that flower in spring. Oh yeah, a cyclone wiped out our bannana crop earlier this year.

    As for TFA: The Earth is not a fucking toaster, the last thing it needs is a "darkness knob".

    --
    And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    1. Re:"The lucky country" by WindBourne · · Score: 1

      And yet, it took all this, for your PM to consider that global warming might be occurring. What makes me wonder, is what will it take somebody like W. to think that it is real or that we can do something about it? This is the guy who tells us that the budget is in the best shape that it has been since Reagan, or that WMD still exist in Iraq, or for 5 years, that we are winning Iraq, or .....
      I do worry that our countries have elected ppl like Blair, Howard, or W. Fortunately, Blair is at least concerned about global warming.

      --
      I prefer the "u" in honour as it seems to be missing these days.
    2. Re:"The lucky country" by noigmn · · Score: 1

      He's done more than ignore global warming and go to iraq. So far since Howard's been PM he has dropped our nuclear ban, given up our opposition to the death penalty, supported torture under certain circumstances, destroyed our position as a leader in the world environmentally, dropped funding for science, stopped support for refugees from oppressed nations, 'reformed' our tax system, flooded the housing market by giving incentives, taken away employee rights (what he calls workplace reform), lowered welfare support, stopped the giving of money to poorer countries. And claimed that he is the best PM we've ever had because interest rates are low and we are in budget surplus, YAY!

      --
      Slashdot is powered by your submission.
    3. Re:"The lucky country" by TapeCutter · · Score: 1

      Yep, six months ago I would have agreed but there has been a remarkable turnaround lateley. I belive it was triggered by Bush and (more importantly?) Murdoch having recently both acknowledged AGW as a serious threat.

      The "answer" that Bush, Murdoch, Howard and others are pushing is more nuclear and "clean coal". Clean coal does not yet exist so they can stall for time on that front by giving more corporate welfare to the polluters to study their own navels. When the stalling is no longer effective they envision moving into a millitarally enforced monopoly based on enriching uranium. The "trusworthy" countries will then sell fuel to "developing" and "untrustworthy" countries so they can build reactors instead of coal fired plants.

      Australia is a major international exporter of both coal and yellowcake, our economy has always been based on the "dig it up and sell it" school of economics. The recent climate talks decensend into a NIMBY argument when the question of radioactive waste came up. But still, kudos to Blair and Kofi for their enthusiastic words over recent years.

      My bet is the waste dump will go somewhere west of the Alice, where all those "unsustainable" aboriginal communites are. The sheer arrogance of labeling native tribes "unsustainable" after shoving them into tin huts is mind boggling. I also pity the stone age inhabitants of West Papua (aka: cannibals), thier pristine forests are being set up for two decades of legalalised rape. /rant

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    4. Re:"The lucky country" by TapeCutter · · Score: 1

      Melbourne is known for it's changeable weather, I have lived here for 40+yrs and the last few years have been "without a winter", this year you can taste the summer dust of jan-feb in the middle of springtime. However we did get a similar downpour, 1/4 of our annual rainfall in 36hrs during Feb last year (the middle of 2004-2005 summer), added something like 10% to our dam levels but I can't remember the last time they were over 70% (a regular occurence before the late 90's).

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    5. Re:"The lucky country" by TapeCutter · · Score: 1

      That's no cockroach, that's just grandad.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    6. Re:"The lucky country" by TapeCutter · · Score: 1

      Sorry to answer twice, here is a sattelite picture of the downpour.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    7. Re:"The lucky country" by RoLi · · Score: 1, Flamebait
      [..] stopped support for refugees from oppressed nations [..]

      If that were true, I'd certainly vote for him, because being flooded by "refugees from oppressed nations" (translation: population surplus from irresponsibly breeding 3rd world populations) is much worse than global warming.

      Just look at what is happening in Paris. Or London. Or Los Angeles. Or Miami. Or any place with a large 3rd-world population.

      Or just compare the flooding of New Orleans with the flooding of areas many times bigger (both in area and population) in Taiwan a couple of years ago, Romania last year, Bulgaria 2 years ago or central Europe a couple of years ago.

      Global warming will be bad enough as it is. No need to make it worse by importing irresponsibility, criminality, overpopulation and disease from the 3rd world.

      Be happy if you are lead by politicians who actually do their job (caring about the people who voted them into office is their job. Caring about 3rd world countries is not)

      Greetings from Austria to Australia.

    8. Re:"The lucky country" by noigmn · · Score: 1

      I think you'll find we have a population density of two people per square kilometer and live on quater acre blocks. It's not like we are running out of space. And the average Australian is quite welcoming of foreigners, or at least here in Melbourne.

      Generally if they are coming from countries which are war torn or they are oppressed by governments, they have a bit of Aussie history in them anyway. There's a thing in our culture and history we call the 'Aussie battler'. It's sort of an unwritten respect for those who take up the fight, against all odds. Like the little man who shouldn't be able to win but gives it a go. It's probably there because we came from convicts and the bottom of the pack and had to fight our way up to remove the aristocracy. The Australian movie 'the castle' sums it up quite well if anyone overseas has seen it. http://en.wikipedia.org/wiki/The_Castle_(film)

      I've noticed recently our PM has tryed to make us a bit more racist and unaccepting, but I think now people are pretty bored of it and have settled back into normal life. In Melbourne it's pretty hard to be racist anyway, and I wouldn't worry about us become like London or Paris, we're miles ahead of them already. The mayor of Melbourne hardly speaks English and he's one of our most popular politicians.

      --
      Slashdot is powered by your submission.
    9. Re:"The lucky country" by RoLi · · Score: 1
      I think you'll find we have a population density of two people per square kilometer and live on quater acre blocks. It's not like we are running out of space.

      Space is not and never was the problem.

      The problem is to feed the population. I'm no expert on Australia, but rising oil prices will cause rising costs for fertilizers, fuels and pestizides - which will cause shortages in a lot of industrialized countries - even in some countries which are exporting food right now. In countries like the UK which imports half it's food today it may even cause famines.

      Nobody ever said anybody would run out of "space".

      And the average Australian is quite welcoming of foreigners, or at least here in Melbourne.

      I know for a fact that about 2/3 of people in the USA and western Europe are opposed of mass-imigration from the 3rd world. Of course there is a big difference between having a few immigrants in the city or being swamped by immigrants like in some suburbs in Paris for example.

      Also the big multiculturalists like Bill Clinton, Jospin, Blair, Jorge W Bush, Angelina Jolie and all the others all live in areas that are almost purely European. If they think that immigration is so great, why do all the multiculturalists avoid 3rd-world immigrants in real life?

      Here in Europe there is not much news about Australia, but I heard about the Lebanese gang rapes and the riots in Australia. So you seem to have the very same problems with the 3rd-world immigrants like every other target country.

      I've noticed recently our PM has tryed to make us a bit more racist and unaccepting, but I think now people are pretty bored of it and have settled back into normal life.

      LOL. The politicians are busy building their multicultural government with them on top - a bit like the aristocrazy in the middle ages. Or like Brazil or Mexico today. They hate a middle-class, they'd rather have dynasties (like the Kennedys, the Bushes, etc.) on top and some impoverished 3rd-world people on bottom. They look with envy at the leaders of Mexico and Brazil where corruption is so normal that it's accepted.

      That's why they are pushing immigration against the will of a big majority of people.

      Of course I don't know that much about Australia, but recently even the Australians made the news here:

      http://en.wikipedia.org/wiki/2005_Cronulla_riots

      And I for one salute you for it. You did something many are too afraid to do: To defend your country and not let it get taken over by 3rd-world criminals.

      If you compare that to cities like Detroit, New Orleans or parts of New York, London and Paris - where the original inhabitants have fled and the areas have become part of the 3rd world, the Australians seem to have much more backbone than many others, so my congratulations.

    10. Re:"The lucky country" by brajesh · · Score: 1

      "...hail the size of cricket balls"

      By any chance, is that you - Steve Waugh ?

      --
      95% of all sigs are made up.
    11. Re:"The lucky country" by malsdavis · · Score: 1

      I've also always found it amusing how a race of people who have lived in Australia for 45,000 years with extremely minimal (virtually non-existant) environmental damage can be deemed to live "unsustainable" lifestyles by settlers who within 200 years have cut-down virtually all the country's forests and rainforests, polluted (in some cases radioactively) thousands of hectares of land and managed to introduce foreign species which have decimated much of the indigenous wildlife. All in only 200 years, that is 1/225th of the time the aborigines have been able to live sustainably of Australia's fertile land, fat chance the Australian wildlife and ecosystem (or probably even us!) will still be around in 45,000 years time.

    12. Re:"The lucky country" by noigmn · · Score: 1

      Cronulla is near Sydney. There is quite a bit of racial segregation and racial violence in Sydney. Places like Redfern have also had riots. But this does not represent the common view of most people in Sydney or Australia. I think you'll find Sydney also has had the Gay and Lesbian Mardi Gras since 1978, so in terms of being unaccepting of people being different... And just because the PM lives in Sydney doesn't make it the only large capital city in Australia. Come to places like Melbourne and segregation only exists in the form of finding more italian or chinese restaurants on certain streets.

      To give an idea of the futility of your comment in Melbourne, here's a quote from wikipedia:

      "Today Melbourne is a diverse and multicultural city. Almost a quarter of Victoria's population was born overseas, and the city is home to residents from 233 countries, who speak over 180 languages and dialects and follow 116 religious faiths. In 2004, 43.5 per cent were either born overseas, or have a parent who was born overseas."

      In Melbourne most people can't cut out these countries as easily as you can. Because they have known people from them, been to school or university with people from them, and have realised how full of crap what you just said is. I don't know a huge amount about American cities, but could it be that because of your approach these people are left on the streets and tend to fall into earning a living the criminal way?

      --
      Slashdot is powered by your submission.
    13. Re:"The lucky country" by TapeCutter · · Score: 1

      As a white Aussie living in Melbourne for 40+yrs I find nothing in the riots to be proud of. I can attest to the fact that Alan Jones spent a whole week on Sydney's talkback radio inciting those riots with lies and half-truths. Had it not been for his tireless racist diatribe and his organization of the "take back the beach" protest, none of this would have happened. If we need defending from anyone it would be against the minority of influencial far right nutjobs within our own society.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    14. Re:"The lucky country" by TapeCutter · · Score: 1

      You are not alone with the droughts and deluge thing, the Atherton tablelands (up north) get about five meters of rain a year. The most severe downpour I have expenienced myself was about 25yrs ago in Eastern Victoria, 50mm in 20 minutes.

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    15. Re:"The lucky country" by RoLi · · Score: 1
      Come to places like Melbourne and segregation only exists in the form of finding more italian or chinese restaurants on certain streets.

      To give an idea of the futility of your comment in Melbourne, here's a quote from wikipedia:

      "Today Melbourne is a diverse and multicultural city. Almost a quarter of Victoria's population was born overseas, and the city is home to residents from 233 countries, who speak over 180 languages and dialects and follow 116 religious faiths. In 2004, 43.5 per cent were either born overseas, or have a parent who was born overseas."

      You didn't quite understand my argument. I specifically spoke about 3rd-world people, which of course is a generalization, but the point is that some integrate better than others into civilized society.

      If you put 1000 Europeans from 20 different countries and put them on an island you will get something like Ireland. If you put 1000 East Asians from 20 different linguistic regions and put them on an island you will get something like Taiwan. (In fact Taiwan was founded by Chinese immigrants from many different parts of China whose dialects are not all intelligible) If you put 1000 Africans on an island you get something like Haiti.

      Usually Europeans, East Asians and non-muslim Asian Indians are not a big problem. Those countries have a rich history of civilization and culture even if some of them (like East Europe, India, North Korea and China) are very poor. Of course any immigrant will raise population density and will cause pollution and an increased demand for fossil fuels, which of course causes global warming (topic), so overpopulated places like Britain, Belgium and the Netherlands would be better off if they stop all immigration immediately.

      But when it comes to criminality and assimilation, poverty is not and never was the problem. The Irish immigration wave was caused by the big famine in Ireland and most immigrants had literally nothing except their clothes. Today many Chinese immigrants in America are dirt-poor and are less criminal than the average White and Chinese as a group already have a higher average household income than the average white household in the USA. After WW2, Germany, Japan and Korea (after the Korean War) were completely destroyed and plagued with famine. There are hundreds of examples of hard-working civilized people who lifted themselves out of poverty without or only with little outside aid.

      On the other hand some people get one uplift-program after another and still are unable to integrate into civilization.

      You are Australian, so let's look at the Aboriginies. On intelligence tests they score at average IQ 62, their skulls are about 3 times as thick as Europeans and their brain weights 75% of that of an European, or to put in another way, a grown up Aboriginie scores about the same on average as an average 9-year old European on IQ-tests. And being Aboriginal, they don't even fall into the "43.5 per cent were either born overseas, or have a parent who was born overseas" you quote, so it quite clearly doesn't matter where you are born, now does it? Is it really surprising to you that Chinese immigrants who score slightly higher than Europeans (IQ 102 to 105 depending on source) will arrive dirt-poor but be able to build up a business or hold a job and integrate into society while Aboriginies will stay poor even with Affirmative Action and millions spent for uplift programs generation after generation?

      So when you have streets with "more italian or chinese restaurants", that's nothing really surprising. What is surprising for me is how you show your leftish pride in boasting how high-IQ foreigners integrated into your society while Aboriginals still live in poverty, even though they certainly are not "foreigners" at all, or are they, noigmn? Shouldn't you be ashamed instead? Or to use leftish rhetoric, shouldn't you be ashamed that you English took away their ancestral lands and now give parts of it to Italians and Chinese so that even less is

    16. Re:"The lucky country" by noigmn · · Score: 1

      Will the next post be finish with, Seig Heil?

      --
      Slashdot is powered by your submission.
    17. Re:"The lucky country" by RoLi · · Score: 1
      LOL.

      All my observations were based on facts, you know the European tradition (called empirical method, look it up) going back to such evil Nazis like Aristotle.

      A funny fact is that the Nazis (like most socialists) forbade all kinds of intelligence testing because Jews got too good scores on them, which contradicted their worldview. So instead of changing their worldview, they just forbade inconvenient facts. Like most socialists, the Nazis ignored many facts and pursued their own ideas which were not based on facts but on opinions.

      So if you want to forbid or ignore intelligence tests, brain size, genetics and brain chemistry because you don't like the results you are pretty much on the same side as the Nazis, which I personally think is hillarious.

    18. Re:"The lucky country" by noigmn · · Score: 1

      Nah, I was just bored with the argument and couldn't be bothered typing more.

      I wasn't debating the facts I was debating your conclusion that you and your view hold some form of superiority. I don't know this for sure, but I'm guessing if I left you in the middle of Australia without food or transport and with no roads in sight, the Aboriginal would be far superior to you. You were basing your 'facts' on a test designed for our form of society and deciding that other forms were a problem because they didn't fit the test. The view that society can't coexist in many forms is quite naive. Cultures mix quite well when they aren't taking a narcissistic approach to it. In Australia you'll find a lot of the time you don't know that someone is unless they tell you. Some of them still live in tribes, some are caught part way between western and tribal in places that are more redneck and don't accept them. But saying the can't integrate in these situations because of their brain size is like saying you won't see a black with money in New York because the government didn't give a shit about the people in New Orleans. It makes no sense. If you put people in a situation where they are likely to end up f**ked, they usually do.

      So as I said, it is the approach to the people, not the people that is the problem. And that is why I said that Melbourne is a long way ahead of these other places you decided are on the way to disaster. We have no Austrian superiority complex. We have tonnes of Africans already, we have aboriginals already, what will change if we have a few more?

      --
      Slashdot is powered by your submission.
    19. Re:"The lucky country" by RoLi · · Score: 1
      I wasn't debating the facts I was debating your conclusion that you and your view hold some form of superiority.

      Nonsense. That's just your interpretation. I never claimed objective superiority. What I do is claim that our subjective preferred way of live (with democracy, human rights, etc.) will disappear with too much 3rd-world immigration.

      Of course you may that the west is evil and does not have a right to survive, well then we have to disagree: I say that the western nations have a right to exist, to defend their way of live on their soil (not in Iraq).

      I don't know this for sure, but I'm guessing if I left you in the middle of Australia without food or transport and with no roads in sight, the Aboriginal would be far superior to you.

      Probably. Aboriginals actually have a larger visual cortex which helps them remember paths in vast deserts (which is why many of them are quite successful as pathfinders) and a couple of other evolutionary adaptations.

      You were basing your 'facts' on a test designed for our form of society and deciding that other forms were a problem because they didn't fit the test.

      Wrong. The tests are not the "basis" of the facts. The basis are the differences we see in the world everyday (New Orleans blacks shoot at rescue helicopters, Bulgarians, Rumanians, Central Europeans and Chinese don't. (And as a matter of fact, neither did New Orleans whites) Haiti has been transformed from a lush tropical forest land to almost barren rock. Blacks are about 5 to 10 times as likely to commit murder all around the world (be it the USA, South Africa or England). The "achievement gap" is real and documented.

      All those real world facts and events are the basis. IQ-tests, brain size, brain chemistry and testosterone levels are merely an explanation for those facts, not the basis.

      You on the other hand don't offer ANY connection between your hypothesis and the real world. While I constantly present numerous examples (New Orleans, Detroit, Haiti, Liberia, etc. etc.) you present nothing. Zero. Nada. Your hypothesis does not have any foundation in reality, it's merely a daydream, some kind of utopia which only exists as wishful thinking, not in reality.

      So as I said, it is the approach to the people, not the people that is the problem.

      You keep believing it, yet you have not a single example of the "correct approach" that actually worked and transformed a majority black or majority aboriginal area into a self-ruled and productive part of industrial society.

      We have tonnes of Africans already, we have aboriginals already, what will change if we have a few more?

      If you have a FEW more, not much will change.

      If you have a LOT more, a lot will change. Just look at Detroit or the infamous Paris suburbs as an example. There is not a single majority-black area that has been under black rule for an extended period of time you want to live in. (If there is, please tell me so. There are numerous examples of black-ruled places which have never been colonies (like Liberia and Ethiopia), have been independent for very long times (Haiti over 200 years).

      As a matter of fact, Africa produces many millions of refugees every year, so there is an endless supply and they will keep coming forever as long as either somebody stops them or the target country looks like Detroit or Haiti and is no longer "better off".

      Of course you are not honest enough to say that you want to get away from blacks/arabs/other 3rd worlders when you move to the suburbs. You will say that you want to get away from drugs and crime.

      If you really believe what you are saying, why don't you move to some area which is majority black and under black rule?

    20. Re:"The lucky country" by noigmn · · Score: 1

      I would more say my approach is productive and yours is just delaying the inevitable out of the fear of what 'might' happen. You obviously seem to have the view that I'm some radical leftist which may be why I have totally misinterpreted you and given you little credit. There is no Utopia except for the one you try to create. But you will find that addressing social problems in the long term usually ends better than throwing around stats and closing the borders. Closing the borders usually coincides with closing of minds and ending of freedom of speech. If I'm a radical leftist for valuing these things please tell me. Or am I one because I would enter a black area and say hi rather than hide under the table. If you viewed me like that I wouldn't like you regardless of what colour your skin is. That's the beauty of it. It's not special consideration for them. You don't need to give a shit about them any more than any white person. Just give them the same rights and same basic respect in society. I have no problem with you saying some of them are worse in some areas. They are. You get that with lots of races. Like if I said there are a large amount of italians in high profit drug trade. There are. But that doesn't mean we close the border to the rest of the italians. It's the generalising to all of them I have the problem with. I also have no problem with them screening certain areas more in immigration, because some areas are worse and have more crime. It is common sense to screen these areas and groups. The stats are there, if there's more danger, there's more screening. But to write them all of and not let in any because they are black or african is a massive generalisation. I don't compare you to the French because you are both European. And I don't write of one Austrian because of another. Most Austrians I've met are great people. But when you use stats to draw conclusions which obivously show a lot of naivity, I have to disagree. Have you actually seen the amount of work that goes into daily life in the average african country. And have you lived in a properly multicultural city where different races intermix. You use a million numbers here off paper and call it a reality. But you don't need stats and news articles to see the other side of it. If it is there, it is there. There is crime, there are places that have issues, but count what percentage they are of the normal city life here, and it isn't much. If someone get's murdered it is rare enough to make the news as the big story for the year. And what I said earlier about intermixing rather than segregation means you end up living in a mixed area not a black area. Remove the segregation and ghettos in a multicultural city and you'll find you don't have that problem.

      --
      Slashdot is powered by your submission.
    21. Re:"The lucky country" by RoLi · · Score: 1
      I would more say my approach is productive and yours is just delaying the inevitable out of the fear of what 'might' happen.

      Since you seem to be afraid of quoting me, I don't know what exactly you are referring to, so I assume it's the immigration policy.

      My opinion, summed up, is that the immigration policy should match what is best for the country. First that means that some optimal level of population density should be calculated, depending on the food and goods output and the preferred standard of living. If the country cannot survive without outside help (like the UK) allowing mass immigration is an act of massive stupidity. Of course thinks may be different in Australia, I don't know enough about the Australian food production to tell. Second it means to choose what immigrants you let in. I think a very good way of doing that would be to do an IQ-test and only let those in who surpass the average IQ (in that way immigration would raise the average IQ which is good for the country).

      But you will find that addressing social problems in the long term usually ends better than throwing around stats and closing the borders.

      Really? In New Orleans, Detroit and in numerous places there are hundreds, maybe thousands of places to "address social problems" in exactly the kind of ways you propose. What did it help?

      Quite to the contrary. While first generation immigrants do arguably well, the second generation has been conditioned to accept social handouts that they do WORSE than the first generation (at least that's the situation of Mexicans in the USA and Turks in Europe) and are more likely to be on welfare.

      That actually shows that social programs are actually counterproductive.

      Social programs mean stealing from the productive (with taxes) and giving it to the unproductive. You always get more of what you subsidize so it's pretty logical that you get more unproductive each generation. Before welfare reform (which was ironically done by Bill Clinton) drug addicted welfare moms had a very high rate of fertility.

      Even if you think that genetics is racist and everything depends on environment, giving crack mothers the incentive to make more babies is just stupid. Even you have to admit that a crack mother won't give a very good environment for child rearing.

      So basically it doesn't matter if you believe in genetics or not. Even if you don't, social programs don't make any sense the way they are implemented now.

      Now when we talk about low-IQ immigration, it doesn't cause these problems, but it clearly accelerates them.

      Closing the borders usually coincides with closing of minds and ending of freedom of speech.

      Actually some European countries (like France or the UK) are ending freedom of speech to keep the borders OPEN.

      Other European countries without many immigrants, basically Iceland and Finnland are under the most free countries in the world.

      Or am I one because I would enter a black area and say hi rather than hide under the table.

      That would make you suicidal. But just go ahead and try it.

      Just give them the same rights and same basic respect in society.

      LOL, that is actually a rightist, racist and "fascist" point of view.

      There were many initiatives in the USA (California and Michigan, probably other states) to abolish affirmative action and really give everybody the same rights. Everytime the media and people like you called these initiatives racist.

      I personally think that everybody should have the same rights, but I realize that that will not lead to equal outcomes.

      I also have no problem with them screening certain areas more in immigration, because some areas are worse and have more crime.

      That is called "profiling" (look it up on Google), another very racist thing (according to the press). Like so many lefties, as soon as the discussion touches some details, you seem to start to embrace views of the right, acc

    22. Re:"The lucky country" by noigmn · · Score: 1

      I'm not quoting cos i don't know how to use the quote function properly and it's slow :). Don't take any complement from it.

      I stand by exactly by what I said. Everything is in place to deal with these things. If people need help through welfare they get it. You don't need 'black' listed on the form. If an country has higher terrorist or higher risk activity, be it white or black, it should be screened. If an area in the city is causing more trouble in society, it should be looked at, but with the common sense you would use with anything else. Not the George Bush way of not finding what the problem is and blaming a group. Black is not a valid answer. And if people need help in society, take into account their background and everything you normally would. This in no way contradicts anything. Just uses some passages that your mind doesn't naturally follow. Group in a slightly different way. There is nothing racist or fascist or anything about taking into account where a certain group has come from in discussing a situation. It's just your perception of their race and their brain size should not be the first things on the table. History of oppression, former environment they lived in and their ability to adapt from that to the new one, etc. should be what you look at. Human psychology doesn't differ much around the globe. I don't know how much you've travelled, but if you'd travelled and met more groups rather than read articles about them you would know this. And discussing problems with the groups probably helps too. Rather than 'caring' and putting things in place that we would view helps them. Many of the places you mentioned like Southern U.S. don't have a good history of accepting people who are different either. So are not the best examples for arguing they cause social instability.

      I don't think either of us is going to convince the other differently. And I'm okay with having a different view to you. It's called diversity :). Think this has gone long enough though, and is starting to get boringly tedious and maybe become a flamewar.

      Think we've both stated our views. I'll give you the chance to have the last comment. Thanks for the discussion.

      --
      Slashdot is powered by your submission.
    23. Re:"The lucky country" by RoLi · · Score: 1
      If an area in the city is causing more trouble in society, it should be looked at, but with the common sense you would use with anything else.

      Yeah, but without control (measure objectively wether the actions actually improved the situation or made things worse) that is only effective in getting invitations to tea parties and generally feel good about what good deeds you have done.

      Not the George Bush way of not finding what the problem is and blaming a group.


      Are we talking about the same George Bush who said that Islam is a "religion of peace"?
      Are we talking about the same George Bush who passed the "no child left behing" act which could be straight from mid-20th century marxism?
      Are we talking about the same George Bush who said that "family values don't stop at the border" regarding Mexicans, even though Mexicans have higher illigitimacy, higher child abuse, higher domestic abuse, etc. than the average European-American?
      Are we talking about the same George Bush who wants to legalize over 8 Million illegal immigrants with his amnesty program?
      Are we talking about the same George Bush who wants to create a "guest worker program" which will lead to even more immigration?
      Are we talking about the same George Bush who increased government spending and amounts the highest public debt seen in all human history?

      Huh. George Bush supports EVERYTHING you said so far. He is one of the biggest multiculturalists ever.

      There is nothing racist or fascist or anything about taking into account where a certain group has come from in discussing a situation. It's just your perception of their race and their brain size should not be the first things on the table.

      Agreed. In a normal world all this would merely be a foot-note. When everybody is treated equally and we accept unequal levels of intelligence, discipline and commitment lead to unequal levels of success, there is no reason to even bring it to the table.

      However in our sick world in which unequal levels of success are used as PROOF for discrimination, racism and other evils it is neccessary to give evidence that inherent abilities and not discrimination are the main cause of unequeal levels of success.

      History of oppression, former environment they lived in and their ability to adapt from that to the new one, etc. should be what you look at.

      Funny, around the same time of the atlantic slave trade an even larger number of Europeans where enslaved by Arabs across the Mediterranean. Funny how "history of oppression" causes Blacks to drop out of school centuries later while it didn't have an effect on Europeans. How strange.

  52. are they mad !!! by fatcop · · Score: 1

    I certainly hope this is just to fire the proverbial rocket up the arses of the policy makers, otherwise this is insane.

    Its one thing to toy with nuclear particles in underground labs or swap super virii collections. But at least *when* mistakes are made they are relatively self contained within a small geographic area. Think about all the major industrial/mechanical "accidents" claiming countless human lives that could have been prevented in hindsight by humans.

    If someone in my local area/state/country is allowed to do those things I usually get some right of say. A vote, a protest or a chance to move away.

    But I think it is outrageous and unforgivable to allow a global experiment that can affect the entire human race. We have enough man made catastrophes affecting entire countries without deciding to take the entire world out. To simply add to a recognised problem is simply ludicrous.

    There is NEVER a guarantee a solution will work, no matter how well intentioned or thought out. Especially of this scale. But there always a very good chance it will have an adverse affect down the road. We always seem to justify its ok to fix something because we want it to work NOW, at the expense of LATER.

    Only repetitive testing gives you a level of comfort with an outcome that you are willing to accept something as safe. Pharmaceutical drugs go through many years of trials, and still sometimes they are withdrawn after years of common usage.

    Lifting the haze (pun intended) on all the media and political hype, global warming is not cut and dried. Even if it is 100% true (ie. a recent man made phenomenon), the earth, being the living organism it is, is healing itself the way it knows how. But if we go panicking and pouring more fuel on the fire, earth's backlash may be even more severe.

    From years in the software biz, the correct solution is ALWAYS to fix the ROOT CAUSE. Anything else is just denial.

  53. Whats wrong wioth this picture? by 3seas · · Score: 1

    Why don't they just suggest we kill ourselfs off as its certainly humans creating the global warming problem.

    I saw on PBS a show on the darkl ages of the 1500's that was likely a volcano explosion in teh indonesia area. It caused the darkening of the sky for some decade or three. Such that daylight was short and heavily masked by the cloud of sulfer covering the planet, It wasn't a healty or abundant farming time for humans.

  54. ObSimpsons by SinaSa · · Score: 1

    Principal Skinner: "Ah that's the beauty of the thing, come winter the Godzillas will freeze to death."

    --
    --
    The last digit of pi is four.
  55. Science is inexact by Anonymous Coward · · Score: 1, Informative

    Anyone who needs evidence science is an inexact science need only remember Carl Sagan and his wrong prediction on the Kuwait oil fires.

    Sagan famously predicted on ABC's Nightline in 1991 that smoky oil fires in Kuwait (set by Saddam Hussein's army) would cause a worldwide ecological disaster of black clouds resulting in global cooling. Retired atmospheric physicist and climate change skeptic Fred Singer dismissed Sagan's prediction as nonsense, predicting that the smoke would dissipate in a matter of days. In his book The Demon-Haunted World, Sagan gave a list of errors he had made (including his predictions about the effects of the Kuwaiti oil fires) as an example of how science is tentative.

    And that prediction explicitly about the effects of something on our atmosphere, ostensibly by one of our most noted intellects. The notion that we have any notion of what the effects of this effort would ulitmately be is indeterminant, and could introduce far more disastrous and devastating unforeseen results.

    1. Re:Science is inexact by flyingfsck · · Score: 1

      Yup - I actually lived in the Middle East during that war. The smoke was visible thousands of miles away, but the darkening of the sky that was shown on CNN, generally was just the sun going down. It was quite funny actually to watch the difference between CNN propaganda and reality.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
    2. Re:Science is inexact by Decker-Mage · · Score: 1

      The problem there was he was relying on the TTAPS ('Nuclear Winter') model which was fundametally flawed in that it was one-dimensional. Later, more refined models started incorporating three spatial dimensions, the temporal dimension, and known weather patterns. These refinements demonstrated, if the model is accurate, that there is a far higher threshhold for nuclear winter, and the effects that Sagan cited from the oil field fire pollutants, than previously thought. The model is still just that, a model, that may reflect the universe at large. The oil field fires gave us some lower boundary data to verify against but without upper boundary data (someone tossing a lot of nukes around) who can say what the threshhold is actually. Frankly I'd rather not find out. I know what they can actually do.

      --
      "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
  56. Re:Simulations by TapeCutter · · Score: 2, Insightful

    Good grief, where the hell have you been. I thought that level of ignorance was peculiar to the 1990's.

    Weather != Climate: Climate is the long term statistics of weather.

    Computer models: The computer chip that allows you to display your ignorance would not be possible without computer models.

    --
    And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
  57. Obligatory Futurama.. by Talonator · · Score: 1, Funny

    ... thus solving the problem once and for all.
    But-
    ONCE AND FOR ALL.

    Seriously though, wouldn't it be great if global warming happened but nuclear winter canceled it out?

  58. a dedicated nutter writes..... by ElephanTS · · Score: 1

    Ok, put on your tinfoil hats. I suspect this is already going on. It's quite an obvious solution when you think about but one which environmentally would never be supported.

    http://www.chemtrailcentral.com/

    I'm not saying that's the definitive website but I think it's worth thinking about. Ok, now reach for your -1:looney modpoints.

    --
    spoonerize "magic trackpad"
    1. Re:a dedicated nutter writes..... by flyingfsck · · Score: 1

      Nice photos actually. Aircraft can make beautiful trails if the temperature of the air is cold enough and the sun angle is low, therefore most of the day in winter, and early morning / late evening in summer. The more efficient the aircraft engines become, the more water vapour they exhaust, which turns into ice needles, so modern aircraft make better trails than aircraft used to decades ago. This generally only happens high up in the stratosphere, or in very cold climes like Canada in winter. Going for a walk when the temperature is around minus 40 Celsius/Farenheit (same temp!) with blowing ice needles is not nice - they sting - but the glittering air is very beautiful.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
  59. Global Warming on your own Laptop by HoneyBeeSpace · · Score: 2, Informative

    If you'd like to do some of the experiments discussed in the article yourself, the EdGCM project has wrapped a NASA global climate model (GCM) in a GUI (OS X and Win). You can add CO2 or turn the sun down by a few percent all with a checkbox and a slider. Supercomputers and advanced FORTRAN programmers are no longer necessary to run your own GCM. Disclaimer: I'm the project developer.

    1. Re:Global Warming on your own Laptop by God+Of+Atheism · · Score: 1

      I'm very interested in what this model predicts, but where is the gnu/linux version? Does the MacOsX version work on gnu/linux?

  60. This happens naturally, and for less. by PsiPsiStar · · Score: 1

    I've said this before, but not only would iron fertilization sequester tremendous amounts of carbon (100,000 K for every 1 K of iron used in the desolate zones) but cyanobacteria produce DMS which creates cloud cover. You don't have to distribute anything.

    --

    ___
    It's the end of my comment as I know it and I feel fine.
    1. Re:This happens naturally, and for less. by flyingfsck · · Score: 1

      Yeah, but that is too simple. How the heck are you going to get a government grant for that? You need to study something spectacular, like global cooling, global warming, global dimming, global photo-chemical fog, global ozone depletion, global nuclear (sorry, nukulear) winter and so on, with equally impressive solutions to get funding on a massive scale. Deflating the whole issue by poring a few bags of fertilizer overboard a ship isn't spectacular. Even worse, just sinking an old rust bucket of a ship would probably have the same beneficial effect, but we certainly don't want to know about simple solutions like that.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
  61. In the long run, it's a payoff to Arm and Hammer.. by CFD339 · · Score: 4, Funny

    ..as we alternate year over year with using Sulfur in odd numbered years and Baking Soda in the even number years. This would also enhance the general SMELL of the place, keeping it fresh and preventing food odors from mixing on a global basis.

    --
    The problem with quotes on the internet, is that nobody bothers to check their veracity. -- Abraham Lincoln
  62. Re:Actually, it is when you look at ALL the effect by Yartrebo · · Score: 1

    This hair-brained scheme is not endorsed by your average climatologist, which are more interested in studying climate than playing politics anyway.

    Throwing that much SO2 in the air is indeed asking for trouble. For starters, it won't save the Greenland and West Antarctica ice caps from melting (a planet with SO2 + CO2 will be much warmer at the poles and slightly cooler at the equator). There's probably plenty more wrong, but that alone should be reason enough shelve this proposal.

  63. Consider the ecosystem by the_REAL_sam · · Score: 1

    Great...who wrote the article?! I have some ideas.

    Blocking off the sunlight used by the ecosystem, global agriculture, ocean/forests, orchards, etc, in order to stop the side effects of industrial pollution (e.g. global warming) sounds like a bad idea.

    The world DEPENDS on sunlight: Sunlight feeds algae, algae feeds plankton, plankton feeds fish, fish feed US (as well as other fish, whales, birds), crops need sunlight, PEOPLE need sunlight...sunlight DEFINES the seasons.

    If everybody prayed and asked the LORD nicely, and thanked Him for what we HAVE, that global warming would just vanish. Who believes THAT? (I do, for one)

    --
    "Forgive us our trespasses, as we forgive those who trespass against us." -Jesus Christ The Lord's Prayer
    1. Re:Consider the ecosystem by Anonymous Coward · · Score: 1, Informative

      If everybody prayed and asked the LORD nicely, and thanked Him for what we HAVE, that global warming would just vanish.

      It might or might not. But I suggest you instead pray for the souls of your fellow man, instead of praying for the earth. This is a fallen world, and it will all eventually pass away. But people accepting or rejecting Christ will live with their decision for forever.

    2. Re:Consider the ecosystem by the_REAL_sam · · Score: 1
      If everybody prayed and asked the LORD nicely, and thanked Him for what we HAVE, that global warming would just vanish.

      • It might or might not. But I suggest you instead pray for the souls of your fellow man, instead of praying for the earth. This is a fallen world, and it will all eventually pass away. But people accepting or rejecting Christ will live with their decision for forever.


      Well, I suppose a person could say the same thing and use it as a reason to trash anything/everything and run hog wild, but I still do my laundry, make my bed in the morning, and throw trash INTO a trash can...AND I'm still against global warming.

      Love your neighbor as yourself...that includes not triggering flooding out everybody who lives on the "floodplain" of "within 3 feet of sea level." Do unto others as you'd have them do unto you, right?

      Christ said that what is asked in his name will be granted. Therefore it makes sense to ask that the world in which we live meets the needs of those who (have no choice but to) live within it. I've found that the LORD helps those who give thanks.

      I know that there's no controlling the future, but it makes no sense resigning the future to ruin and disaster. Fallen or not, (and, yes, I've SEEN the fallen) this is the world we live in, and I'm not going to adopt "who gives a damn" as my life-motto.

      I ask the Lord to help save souls AND pray for an improvement in the state of things. Jesus did take the trouble to feed and heal people. Those were real world actions he took, right? That indicates he was prepared to care for people IN THIS world.

      --
      "Forgive us our trespasses, as we forgive those who trespass against us." -Jesus Christ The Lord's Prayer
    3. Re:Consider the ecosystem by flyingfsck · · Score: 1

      Cool, asking the super powers for help would certainly be just as effective as any other suggestion.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
    4. Re:Consider the ecosystem by Bill+Dog · · Score: 1

      Nothing of what you say is wrong. We were instructed to be good stewards of this earth. And I think that suffices to answer the caricatures you felt the need to introduce.

      It's just not a black or white issue of being either for "saving the planet" or against it. There will be no saving the planet because God will destroy it. And He has the right, because He created it in the first place. Don't cling to the earth, cling to God. It's a question of priorities. And magnitude of consequences. The #1 goal is to get yourself and others saved. The consequences of this last far longer than any earthly matter.

      I'll close with offering a phrasing of a proverb, from a "translation" of ill-repute that I had as a kid, that I found to be very succinct and profound nonetheless: "Remember, no matter how long you live, you'll be dead much longer."

            Anonymous Coward

      --
      Attention zealots and haters: 00100 00100
  64. Thieves ... ALL of them :) by slightlyspacey · · Score: 1
    I made some tongue-in-cheek comments here on Slashdot about a year ago how we could tackle the problem of global warming and blame enviromentalists for causing the problem in the first place:

    ... so, how do we control the Green House Effect? There are two, separate distinct ways:

    a) Control the amount of Greenhouse gas emissions - the Kyoto protocol (boring)

    or

    b) Control the amount of sunlight entering the atmosphere, striking the earth and re-radiating as infared radiation (interesting possibilities)

    I personally like b) because we can shift the blame for global warming: .....

    1) We can blame the environmentalists for Global Warming. Those pesky clean air laws eventually allowed more sunlight to strike the earth. Allowing factories to continue billowing thick clouds of black soot would OBVIOUSLY lead to a reduction in the amount of sunlight striking the earth's surface - PROBLEM SOLVED.

    2) We can blame the anti-nuke crowd for Global Warming. The 1963 Limited Test Ban Treaty essentially outlawed atmospheric, underwater, and outer space testing of nuclear weapons. Nuclear weapons, among their many other wonderful attributes, kick up large amount of dust and debris into the atmosphere which PREVENTS sunlight from reaching the earth's surface. Remember Carl Sagan and his "Nuclear Winter" scenario? Regular distribution of nuclear explosions and carefully placed nuclear charges down volcanoes would keep Global Warming in check - PROBLEM SOLVED

    3) Another avenue to solve Global Warming is to change the albedo or reflectance of earth's surface. The more sunlight is reflected harmlessly back into space rather than absorbed by the earth and re-radiated as infared radiation, the better control we will have over Global Warming. Two Words: Large mirrors. Remember the Bond flicks, "Diamonds are Forever", "The Man With The Golden Gun", and "Die Another Day"? Those films made use of the ol concentrated-sunlight-leads-to-world-domination ploy. Same idea here but in reverse.



    NASA stole #3 and now a Nobel Prize scientist just stole #1. Wonder if there is still time to get a patent on idea #2, my personal favorite, before someone else steals it. Never realized before that there was a market for insanely stupid ideas. Time to write up that business plan ...

  65. Re: Simulations by fluffy99 · · Score: 1

    No not really. We only have accurate climate data back maybe 100 years, and before that most of it is just generalized references in written documents. The truth is that myopic folks are looking at a tiny, tiny span of data and ignoring that the earth climate is subject to forces and influences that cycle over thousands or even millions of years. Looking at the bigger picture, we can see that the earth has been slowly warming since the ice age. They are just now admitting that the "ozone hole" appears to be cyclical and is actually getting smaller despite the increase of CFCs which they claim caused the problem.

  66. Re:Simulations by mikec · · Score: 1

    This is just silly. What physics? The well understood effects of high and low clouds, changes in solar radiation, cosmic rays, heat flux into and out of the ocean, I assume? Oh, wait, we don't have a clue about any of that...

  67. Anyone read that headline as.. by Anonymous Coward · · Score: 1, Funny

    "Stop Global Warming With Song?" I did. and I'm not dyslexic. I guess the von Trapp really can save the world.

  68. Scienctists and politicians by Rhuken · · Score: 2, Insightful

    Dr. Crutzen, the atmospheric chemist that proposed the idea of deliberately spreading a layer of particulate matter in the upper atmosphere is himself "not enthusiastic about it," and that it was meant more for shock value. That's what is interesting about the scientific community. Sometimes if an idea could work it will still be suggested no matter how far out it seems. It's only a hypothesis that is placed on the table to be tested and researched if there is interest. Who knows, it could slow down our problem, it could speed it up.

    Politics, however, can drive some scientists to look for a question instead of an answer. They already have the answer they want. I like to think that doesn't happen too often. The greater mixing of science and politics here is, when a scientist (and hopefully a scientist that is actually a specialist in the field they are reporting on) reports possibilities to uninformed officials they can take one of the possibilities, or predictions, for prophecy. Science is never 100% certain. It can get close though.

    Yes global warming is real. The earth changes over time. We have not always been this temperature and we all know that. CO2 levels have also greatly fluctuated through time. (Similarities with our Present World URL:http://www.geocraft.com/WVFossils/Carboniferou s_climate.html) In this article (replace anywhere where it talks about continental drift with plate tectonics as that is more accurate) the author outlines atmospheric CO2 levels corresponding to global temperature in the "Global Temp. & Atmos. CO2 over Geol. Time" graph. We are today most like the carboniferous period with our temperature and CO2 levels. The mesozoic had all the dinosaurs and look at the CO2 levels. Large animals eat small animals that eat plants that thrive on CO2. Plant life was incredibly abundant to soak up all that CO2.

    The problem now is that we don't know what will happen next. We aren't sure if history will repeat itself as we are now getting warmer by getting incredibly more warm, or if this interglacial period will only continue into another full on ice age. Yes, volcanoes and other natural phenomena add to climate change (earth's interaction with the sun; and even though on average volcanoes only emit at most 3% of a years CO2, large single eruptions like Pinatubo can emit at least the amount of CO2 produced by the US in a single year: those volcano numbers are a little fuzzy so feel free to correct me on them), but we are adding to it with our industry. We've had to rely on fossil fuels till now because we didn't really have much better choices for the last few centuries. But now we have do. We can certainly change our ways and cause much fewer harmful emissions, but unfortunately it may come down to whether moneymakers think it is worth the effort and cost to switch away from todays fuels (which will definitely be a costly and world changing effort).

    So did we really tip the iceberg? or was the earth going to do this anyway. You tell me.

  69. If getting less sunlight is the goal by sillybilly · · Score: 2, Informative

    If you want to combat global warming by getting less sunlight on Earth, I'd much prefer the NASA way where they'd put a variable size dark disk in orbit at a Lagrange point between the Earth/Sun, because you can always click "undo" on that, or just tell it to shrink the umbrella to nothing realtime. Injecting more crap into our atmosphere will just make things more complicated, and taking the stuff back out is not at simple, let alone getting realtime control on the effects.

    1. Re:If getting less sunlight is the goal by sangdrax · · Score: 1


      While they're at it, they can block the sun when its night in the US. That way, the US is not affected. Not to mention the potentials for measures against non-US-friendly countries: they can simply be cut-off from sunlight. That'll teach 'm. Also, it allows everyone to keep fucking up our atmosphere 'because we have the disc, and that costed enough already'.

      Clearly, this sounds like the way to go.
      </rant>

      Maybe we should (*gasp*) get rid of our 'consume all you can culture' instead, acknowledging we need extra planets once the rest of the world caught up with the West's level of 'advancement'. But that would mean sacrificing anything on a personal or economical level. Can't have that. Rather have everyone else starve or a fucked up atmosphere.

    2. Re:If getting less sunlight is the goal by sillybilly · · Score: 1

      Or you can use a semi-transparent, semireflective, or variable angle fresnel lens umrella thing, where everyone on Earth gets equal treatment on Earth, to be fair. Of course it should eb done by the UN and not a single country. Anthing like multiple slow satellites with turnable reflectors orbiting Earth to provide light for the polar nights may be too much interference with the environmental equilibrium, and so is cutting "light" or hi freq radiation from the Sun that plants live on to compensate for the extra IR or lo freq that CO2 reflects, that might be too much interference, but what else are you gonna do? Tell people to stop fucking? Or stop eating, driving and heating their homes? Yeah, like that's gonna work.

  70. Please STFU! by RealGrouchy · · Score: 2, Funny

    Ack! Please stop talking about this! The last thing we need is ignorant, suburban SUV drivers thinking that they're actually helping the planet!

    Ozone in atmosphere = good

    Ozone at street level = doubleplus bad!

    I know this, you know this, but soccer dad thinks "oh, I'd better turn on the air conditioning to help global cooling!"

    - RG>

    --
    Hey pal, this isn't a pleasantforest, so don't waste my time with pleasantries!
  71. Re:Simulations by WhiplashII · · Score: 1

    The basic problem is this:

    1) Global warming is complex, and can not be undeniably explained to a normal person.
    2) Therefor: The only way to tell the veracity of global warming is to examine the messenger.
    3) The messengers all have huge biases, either for or against.
    4) Therefor: There is not enough information to act upon.

    Thing like this anouncement help fight against this, because you can't exactly call someone who is calling for world-wide polution a tree hugger.

    Well, maybe a tree hugger on (sulfuric) acid...

    --
    while (sig==sig) sig=!sig;
  72. Sun-Earth Screen by KidSock · · Score: 1

    I wonder how feasible it would be to send a space ship into orbit around the Sun such that it is directly in the path of light directed at earth. At that range a relatively small screen of reflective foil could block a considerable area on earth and could be used to regulate temperature by deflecting or concentrating light in different places. The ship would be powered by using the screen as a sail to catch solar radiation and position itself appropriately. It could also be used to cool oceans in the path of Hurricanes thereby decreasing their power.

    1. Re:Sun-Earth Screen by flyingfsck · · Score: 1

      Uhh, since the sun is so much bigger than the earth, your solar screen would do better the closer it is to earth. If you wish to deploy a screen close to the sun, it would have to be a-friggen-normous and would likely consume the total volume of several planets and still have little effect.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
    2. Re:Sun-Earth Screen by KidSock · · Score: 1

      Duh, good point.

  73. Use phosphate, not sulfate by primenerd · · Score: 1

    While I am not exactly sure about the whole "reflective clouds to cool the planet" idea, I do know that clouds of phosphate would be a much better idea than sulfate. Phosphate "smoke" (from burning white phosphorous with oxygen) is highly reflective and is often used as a smoke screen. When sulfate is dissolved in water you end up with sulfuric acid, the causative agent of acid rain. Phosphate in water does not form such a strong acid and is in fact a fertilizer. As the phosphate came out of the atmosphere we would end up with a slight increase in the nutrients in the land and oceans (though diluted over the entire surface of the planet the effect would be minimal).

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  74. global warming hysteria by timmarhy · · Score: 1

    considering the maths on c02 and global warming doesn't point to man made warming, it's fucking premature to be spraying sulphur into the air. they always like to quote 1998 - 2001 as the hottest years on record, what they don't like to tell you is that it's a fact that 40 - 60% of the extra heat was attributed to increased solar activity.

    --
    If you mod me down, I will become more powerful than you can imagine....
  75. An easy and cheap way to do it. by PsiPsiStar · · Score: 1

    Iron is the limiting factor in the desolate zones of the earth's oceans (which are all far away from shore.) Fertilize the earth's desolate zones with iron. 1K of iron is enough to fix 100,000K of carbon due to algae growth. Also, cyanobacteria produce Hydrogen Sulfide, which leads to cloud the formation of nice white puffy clouds. And it does it far out at sea where acid rain isn't a problem. This would kill two birds with one stone.

    Tests have already been done re: feasibility, but the possibility of trading carbon credits in a new market looked to be a huge source of funding for folks like Enron. And nations with less industry would rather not have to compete with the industrialized nations.

    --

    ___
    It's the end of my comment as I know it and I feel fine.
  76. Re:Simulations by MacDork · · Score: 1

    Climate models are not tricks. The physics goes in. The climate comes out. It's not a trivial curve-fitting exercise the way you seem to think.

    Really? Because last time I heard, random data goes in and hockey stick graphs come out. Yeah, it seems the climate models produce hockey sticks regardless of what you put in them, physics or otherwise.

  77. Re:Simulations by uncadonna · · Score: 1

    If we didn't have a clue, friend, the climate models wouldn't work.

    The climate wouldn't emerge from the primitive equations. Simulated rain wouldn't fall in wet places and would fall too much in dry places. The simulated jet stream wouldn't meander where the jet stream meanders. The simulated Gulf Stream wouldn't flow where the Gulf Stream flows. The simulated Antarctic Circumpolar Current would circumnavigate the Antarctic. etc.

    The Japanese are even getting simulated hurricanes with simulated eyes forming on primitive equation global scale climate models and following hurricane tracks.

    You have no business telling people what they don't understand and can't do when they can actually do it.

    --
    mt
  78. Sulpher + Jet Fuel = Global Cooling by CodeBuster · · Score: 1

    I seem to recall that a Russian researcher, Yury Israel, has done research to indicate that the addition of sulpher compounds to the jet fuel used by international airline flights, which fly at 60,000+ feet to take advantage of the jet streams, would result in particulate dispertion into the stratosphere and global temperature reduction due to reflection of sunlight. Perhaps not the best solution to the problem, but an intriguing proposal none the less...

  79. Re:Simulations by TapeCutter · · Score: 1

    "Oh, wait, we don't have a clue about any of that..."

    Just because you don't have a clue does not mean everyone else is similarly clueless.

    --
    And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
  80. Re:Actually, it is when you look at ALL the effect by RKBA · · Score: 1

    And eventually all those millions of tons of sulfur in the upper atmosphere return to earth in the form of sulfuric acid rain and kills all the crops.

  81. The problem with SO2 global dimming strategy by dobermanmacleod · · Score: 5, Informative
    First, the Nobel winning scientist who suggested seeding SO2 (sulfur oxide) into the troposhere was primarily being ironic. He intended to shock policymakers into grasping the unpalatable alternative to mitigating global warming by reining in anthropic greenhouse gas (GHG) emissions.

    Second, he did a further analysis of a practical mechanism to introduce SO2 into the upper atmosphere. I think he settled on balloons or artillery shells, and the cost was something like tens of billions of dollars a year. Since the stuff only stays up there for months, it would be a reoccuring cost.

    Finally, it has the unpleasant side effect (per earlier replies) of raining down on the planet in the form of acid rain. Since the ocean is already getting more acidic due to increased CO2 levels (which combined with water get you carbonic acid-i.e. soda water), this might be a fatal drawback. The one thing worse than global warming is an oxygen deprived ocean, which ironically leads to sulfur coming back up as hydrogen sulfide (which at least once killed over 90% of the life on earth during a particularly spectacular episode of runaway global warming called the "Great Dying.")

    Anyway, we probably won't have time or money to develop or impliment such a idea (nor another idea using a space shade to partially block the sun hitting the earth) because of abrupt climate change: when the climate is forced, it doesn't respond smoothly and gradually. Instead, proof in the form of ice core samples show that the climate at first resists changing, then abruptly changes to another stable state. In other words, it is predictable that within a decade or two our climate will abruptly change from the mild Holocene of the last ten thousand years, to a hotter dryer climate that has resulted in mass extinctions many times in the past. Here is a link to an article I wrote if you want a further explanation http://www.planetsave.com/ps_mambo/Independent_New s/Science/Abrupt_climate_change_predicted_within_2 0_years_200609117794/

    We won't have the resources to launch SO2 into the upper atmosphere, particularly repeatedly, especially if it didn't make an immediate dramatic difference. Furthermore, we aren't going to pull the hammer back by getting an "SO2" program all ready to pull the trigger if things get really bad. Instead, typically we'll wait until catastrophe hits, then we'll be looking for the silver bullet yesterday. Neither a SO2 program, or the space shade program will be seriously on track until after the resources are unavailable. Any resources will be used up for consequence management, not to institute some expensive technologically spacious global warming pie-in-the-sky program that won't have immediate results for years and years.

    On the other hand, I have an alternate suggestion (the advantage is it wouldn't need a great deal of resources, a large team of scientists, or a great deal of time to impliment):

    It is unreasonable to expect that mankind will so dramatically reduce their greenhouse gas emissions (GHG) fast enough to avoid abrupt climate change. A fast growing population combined with growing per capita energy use, plus trillions of dollars in fossil fuel infrastruction means we are on track to double our CO2 emissions by 2050.

    Furthermore, a warming earth means that carbon sinks will become carbon emitters bigtime. In other words, it is predictable that soon the earth will start emitting far more GHG than humans, at the same time it is able to absorb less of mankind's CO2 pollution. Nature absorbs about half of mankind's 8 billion tons of CO2 emitted each year. By 2030 it is predicted that nature will only be able to absorb 2.7 billion tons a year.

    The only solution for global warming is to remove the CO2 from the air after it has been emitted. I suggest using genetic engineering to improve nature's ability to absorb CO2. Perhaps seeding a GMO into the ocean.

    1. Re:The problem with SO2 global dimming strategy by Sloppy · · Score: 1
      Since the stuff only stays up there for months, it would be a reoccuring cost.
      So in other words, this is the solution to Global Warming that the contractors are going to enthusiastically lobby for (unless someone thinks of a way that's even more expensive).
      --
      As copyright owner of this comment, I authorize everyone to defeat any technological measure which limits access to it.
    2. Re:The problem with SO2 global dimming strategy by dobermanmacleod · · Score: 1
      By the time an elaborate, time consuming, and expensive program to pollute the upper atmosphere with SO2 is seriously considered, it will be too late to find the resources to devote to such a long term project. Besides, with global warming comes increased energy consumption, so I doubt any government(s) will be too excited to commit to such a reoccuring cost so mankind can continue to increase their fossil fuel consumption.



      The consumptive model doesn't always apply. Frankly, I think it is hilarious that an idea forwarded as the worst case mitigation strategy would be taken so seriously. Isn't it obvious that a SO2 program is an impractical way to enable mankind to maintain business-as-usual?

  82. If they're willing to try crazy experiments... by iSoph · · Score: 1

    Why not try for a nuclear winter to offset global warming ?

    They seem to suggest these kind of things based on a limited understanding of global warming issues and feedbacks, so why not add to the mess in a way we think we know will cool things down?

    Like someone above says, we're so good at adding to the mess, and it's much easier than doing less of anything.

  83. Re:Simulations by Decker-Mage · · Score: 1
    I probably know more about postive and negative feedback loops as applied to more disciplines than any man living and that goes equally well for the perils and pitfalls of modeling systems. We do not have an accurate model of the atmospheric feedback loops in earth's ecosystem as has been demonstrated time and again with almost every set of monthly journals that I receive or journey down to the university to read. If you have garbage either being fed into your model in the form of data and/or in the form of the mathematical structure of the model and its interdependent equations, you get garbage out and that is what we see to date. No model has been able to map previous climatological trends accurately on the basis of existing known inputs. Plain, simple, recorded scientific fact. What you have instead is faith in a model that does not reflect the modeled system at hand. Faith, not scientific method. I deal in facts and reproducible results that reflect the actual behavior of the universe. These people remind me more and more of the history of economics prior to the econometric revolution (and sadly still exists today in many corridors of academe and power).

    Bring me an accurate model that reflects past performance, then we can talk. I've dealt with chaotic systems before and while no cakewalk, it can be done.

    --
    "[I]t is a wise man who admits the limits of his knowledge or skill, and that pretending either causes harm." --Terry Go
  84. Pure [flawed] Genious by Timberwolf0122 · · Score: 1

    So we effectively reduce the sunlight hitting the Earth,
    which slows plant growth,
    we burn more fuel to compensate for the cooler weather releasing more Carbon,
    requiring more light to be reflected,
    goto line 1

    Truely it is mans ultimate dream to destroy the sun, I will do the next best thing by blotting it out. - Mr. Charles Montgomery Burnes

    --
    In the not too distant future, next Sunday A.D.
  85. WTO - ppms by kaysan · · Score: 1
    Well, the good news is, GWB doesn't necissarily NEED to make his mind up regarding global warming or the exhaust of all manners of unhealthy substances into the atmosphere. Utilizing the World Trade Organisation's values-related production and process methods, all of the world's nations that signed the Kyoto Protocol (Russia's signing of that protocol effectuated it) could simply take the US and the rest of the non-Kyoto world to the WTO courts.

    Just as the US and other nations have done on multiple occasions, Kyoto-nations could show some GUTS and legally force a ban on all goods produced by methods disregarding the Kyoto protocol (read: all goods produced with energy).

    How's that for a change?.. oh..and yes its not gonna happen, and yes its because the WTO is US-dominated, and yes that is a natural extension of historical power become institution, and no, i am not anti-US.

  86. On Action without knowledge by hicksw · · Score: 1

    Try telling that to the Kyoto supporters.

  87. Avoid the poles at all costs by ribuck · · Score: 1

    The last thing we need is for particles sent into the atmosphere to settle on the polar ice, thereby increasing heat absorption and melting the ice caps, raising the sea level and flooding most of our major cities.

  88. Deepthroat by brunes69 · · Score: 1

    Doesn't that old han end up swallowing A GOAT before then end of that song?

    I fo rone welcome our goat-eating wonder-esophagus overloads.

  89. We don't need information to act by mangu · · Score: 1
    There is not enough information to act upon


    Suppose you are riding in a car and there suddenly appears a lot of fog on the road. You ask the driver to slow down and he answers "I'll keep speeding because we aren't sure that there's anything dangerous on the road".


    If we do not have enough information on the dangers ahead, that's reason enough to reduce the emission of potentially dangerous greenhouse gases.

    1. Re:We don't need information to act by WhiplashII · · Score: 1

      Unfortunately, that analogy has the cart driving the horse. A propper analogy might be: your hourly rate driver is driving in normal conditions. He tells you, citing other hourly drivers that agree with him, that unknown and unseeable conditions make it dangerous to drive over 10 miles per hour. Everyone else on the road is continuing to go 60.

      It is more than slightly possible that the driver is inflating the danger. You can't know, you just don't have access to the information - but the fact that his interests are so well aligned with his message pegs your BS meter.

      It is the same with global warming for many people.

      --
      while (sig==sig) sig=!sig;
    2. Re:We don't need information to act by mangu · · Score: 1
      Everyone else on the road is continuing to go 60.


      Not in this case. Almost every important country in the world agrees that global warming is a dangerous situation, but not the USA. The "hourly driver" in this case is GWB, whose family fortune, based on Texas oil, would be endangered by a cutback in fossil fuel consumption.

  90. Please learn how simulations are done by mangu · · Score: 1
    When you program a computer model to raise the temp when you increase CO2, the computer program will tell you the temp will go up when you raise CO2.


    That's not how simulations are done, what you suggest would be a waste of time. You should first learn something about the mathematics of simulations, a good place to start is in this book.


    Then you should learn something about the physics, I suggest chapter 1 in this book to learn how to calculate the spectrum of the radiation emitted by a body as a function of temperature.


    Knowing all that, it's a simple matter to realize that sunlight is emitted by the sun at a shorter wavelength than heat radiated by the earth, because the sun is hotter than the earth. It just happens that CO2 absorbs less radiation at shorter wavelengths than at longer wavelengths, therefore heat from the sun reaches the earth surface, but heat radiated by the earth surface gets absorbed by the CO2 in the atmosphere.


    The rise in the temperature isn't programmed into the simulations, it's a result of the calculations, which use data that has been verified many times.

  91. Global Dimming is not a sollution by Seto89 · · Score: 1

    This is not a new idea. It's Global Dimming and it has been here for quite some time. But the reason why we haven't done such thing yet is not that no one figured out the precise plan. It's because we have a reason why we started filtering exhaust. One is medical, another is interference with rain clouds - Remmeber the famine of 1984? Guess what was the reason. For more information check the 2005 BBC's documentary about Global Dimming, it should answer all the question.. Still this is a better idea that putting a giant sunshade to space...

    --
    There are two kinds of people - those who are radioactive and those who have already decayed..
  92. But then we're stuck with the Gorillas! by jamesshuang · · Score: 1

    No, that's the beautiful part. When wintertime rolls around, the gorillas simply freeze to death.

  93. Taking Control of the Environment by JanWolter · · Score: 1

    The sane response to all proposals of this ilk is not "hey, maybe global warming isn't such a big problem after all." The sane response is sheer terror.

    Say you start putting particulates into the atmosphere so their cooling effect will counteract the warming effect of the CO2 we put into the atmosphere. Well particulates don't stay up in the atmosphere as long or spread globally in the same patterns that CO2 does. So we would be getting into a continuous process of deciding how much to insert into the atmosphere where and when so that not only the global weather is OK, but so that no huge weather distrubances are caused regionally. Gotta make sure the monsoons arrive on time in India, without setting off too many hurricanes in the Gulf. In other words, what is being proposed is that mankind take over active management of the world's climate.

    Yes, our understanding of global climate has advanced by leaps and bounds, and weather models are really fairly good these days, but not anywhere near THAT good. If you planted a four-year-old kid who had seen "There Goes An Airplane" in the pilot's seat of a Boeing 747 and turned off the autopilot, you'd be in approximately the same delightful situation.

    I suppose sooner or later we are going to be forced to actively manage the planet's weather, but we need to do everything we can to make it as much later as possible. The fact that there are lots of maniacs waiting in the wings, ready and willing to take over the management of the earth's climate if we screw up its natural balance enough should only be taken as more encouragement to cut CO2 emissions for all we are worth, as fast as we can. We need to invest in learning all we can about climate, in hopes that the maniacs will know a bit more about what they are doing when their turn comes, and we generally need to build international cooperation, because the geopolitical problems of managing global weather are at least as scary as the scientific ones.

    1. Re:Taking Control of the Environment by GigsVT · · Score: 1

      It's amusing that the very people that would oppose such management of the environment have a large overlap with the people that support the government interference in free markets.

      At least this proves they understand the idea of a self-regulating ecosystem. Bridging that gap might be difficult.

      --
      I've had enough abrasive sigs. Kittens are cute and fuzzy.
  94. Just trigger the volcano beneath Yellowstone by Junks+Jerzey · · Score: 1

    Sure, it will take out a good chunk of the United States with it, but it will have an effect on global climate for hundreds of years afterward. The magma chamber beneath Yellowstone is *huge*; we're talking something thousands of times more powerful than Mount St. Helens.

    And then of course there's the theory that the Earth's magnetic field will be almost nonexistent during the expected magnetic pole reversal coming shortly (starting within ~300 years). During the few thousand year transition, we're going to get hit hard by radiation anyway, so global warming may be irrelevant. And at least some of the CO2 will be swept away by solar wind.

  95. Re:Simulations by mikec · · Score: 1

    Sorry, you're wrong. The climate doesn't emerge from primitive equations. What emerges from primitive equations is nothing like our climate. After adjusting numerous fudge factors to "calibrate" the simulations, they do sort of act sort of like real climate. Or to put in another way, after adjusting numerous fudge factors to make the simulations act like our climate they (amazingly) act sort of like our climate. Unfortunately, that tells us almost nothing about what our climate would be like with different inputs.

    Google for "overfitting".

    -mike

  96. You get what you pay for.... by argStyopa · · Score: 1

    I think it's a matter of consistency.

    Here we've had Kyotovocates telling us for a decade that they KNOW their calculations are correct (despite questions), they KNOW the impact of X amount of CO2 and particulates output by country Y over Z years, they KNOW that global warming is going to have such-and-such effects to the TENTH of a degree over a century...

    So with the general public being slapped in the face repeatedly by such certitude, how ironic is it that OTHER people with OTHER agendas are claiming similar certainty with their 'global climate-changing' suggestions? Reminds me of Thomas Moore's comments about tearing down the law to attack the devil - if you justify global action based on theoretical mechanisms, you can't disupute OTHER people making use of the same mechanisms differently. That would be hypocrisy, and would (perhaps) reveal that your original goals were more political than scientfic, now wouldn't it?

    Because you cannot claim that YOU know precisely how a system works, and then assail someone else using pretty much the same mechanics to come to a conclusion YOU don't like.

    --
    -Styopa
  97. smog and global warming by WindShadow · · Score: 1
    One of my regular columns was on the politics of this, but based on the nuclear winter predictions. I satirically postulated G. Bush justifying bombing all the countries he didn't like in the name of preventing warming, then discussed the politics of floating a power plant on the ocean to boil seawater and create clouds to increase reflectivity. The downside would be a big increase in rainfall, which would be a political problem, although might actually be used to reduce lack of rainfall problems.

    Small payloads to deploy sulpher mist might be G-resistant enough to endcourage launch via magnetic rail gun, rather than rockets.

  98. Well at least it's something. by phrackwulf · · Score: 1

    I appreciate that this is designed to spur policy action as opposed to being a real solution but it points out the vested interest ecologists and climate change experts have in screaming about the sky falling and offering no engineering solutions. Yes, climate change is inevitable at this point. What we should be doing is talking about engineering solutions rather than ordering all economic activity to cease in the name of environmental salvation. The damage has been done. We need to implement effective engineering controls to limit the undesirable effects and if possible begin engineering our climate. Eventually that will mean barrier walls around major cities to prevent the ocean from coming in and probably underwater cities to support the growing populations but I don't accept the frankly stupid response of the NTS. Life is an uncontrolled experiment. Persisting in alarmism and rejecting any solution based on the industrial capabilities advanced economies have developed gets us no where. You can pray to Gaia however much you want and that will not stop the polar ice caps from melting. What is needed is a drive to perfect technologies that will adapt and preserve natural forms. These will take time and effort to design and implement and thus are exactly the type of solutions that environmentalists refuse to consider. They'd rather hug a tree than innovate.

    --
    What would Richard Feynman do, if he were here right now? He'd do some math and he'd follow through!
  99. Why sulfur? by Cedric+Tsui · · Score: 1

    Anyone know the answer to this one?

    Why inject sulfur dioxide into the atmosphere? Surely there is a mass produced gas that will preferentially reflect visible light that doesn't result in acid rain.

  100. Re:Simulations by uncadonna · · Score: 1

    There are some knobs that have to be twiddled to get the thing to work. But it does work. And the reason it is interesting is exactly because there aren't enough knobs to do the sort of overfitting you are talking about.

    The models have perhaps a few hundred degrees of freedom in their design and millions of degrees of freedom in their output.

    I'm not saying the enterprise is above reproach, but I am tired of blanket criticism from people who don't know anything about it. If you have something substantive to say, come out and say it.

    --
    mt
  101. I say we stop... by SonicSpike · · Score: 1

    ...global whining!

    --
    Libertas in infinitum
  102. Then why didn't it happen already? by Engineer-Poet · · Score: 1

    Pinatubo threw a lot more SO2 into the air than this scheme would require, and current industrial emissions are many times greater - the problem with our current emissions is that they're too much, too low in the atmosphere.

  103. Nobody said things would be perfect. by Engineer-Poet · · Score: 1
    Throwing that much SO2 in the air is indeed asking for trouble. For starters, it won't save the Greenland and West Antarctica ice caps from melting (a planet with SO2 + CO2 will be much warmer at the poles and slightly cooler at the equator).

    So you'd prefer considerably warmer at the equator and much, MUCH warmer at the poles? Until we can pull atmospheric CO2 (and other GHG's) back down, those are the alternatives. Not even space diffractors would alter the trend toward equalizing north-south temperatures.

    Of course, we do have some choice of where we put the sulfur. If we reflected a lot more light away from the poles, we might even be able to re-establish some of that lost difference.