Slashdot Mirror


Scientists Look at Martian Salt for Ancient Life

eldavojohn writes "Is there life on Mars? Maybe not, but a better question might be whether or not it has ever existed on Mars? Scientists are claiming that the best indication for this will be in newly found evaporated salt deposits on Mars which they can use to check for cellulose. Here on earth, tiny fuzzy fibers have been found in salt dating back almost 250 million years making it the oldest known evidence of life on earth. Jack Griffith, a microbiologist from UNC, is quoted as saying, 'Cellulose was one of the earliest polymers organisms made during their evolution, so it pops out as the most likely thing you'd find on Mars, if you found anything at all. Looking for it in salt deposits is probably a very good way to go.'"

95 of 116 comments (clear)

  1. Salt and astrobiology by Geoffrey.landis · · Score: 4, Informative

    Salt on Mars has been a topic of interest for a while-- I wrote about the implications of Martian salt for Astrobiology a couple of years back, in an article in Astrobiology

    --
    http://www.geoffreylandis.com
    1. Re:Salt and astrobiology by Chris+Burke · · Score: 1

      I wrote about the implications of Martian salt for Astrobiology a couple of years back, in an article in Astrobiology

      Wait, wait, was your article about the implications of Martian salt for the science of astrobiology? Or the implications of Martian salt for the publication Astrobiology?

      Inquiring minds want to know!

      --

      The enemies of Democracy are
    2. Re:Salt and astrobiology by Geoffrey.landis · · Score: 1

      Yes.

      --
      http://www.geoffreylandis.com
  2. Cellulose *variants*? by mfarah · · Score: 1

    I am no botanist, so I have to ask a potentially dumb question: are there any kind of cellulose-like variants that should be prospected as well?

    --
    "Trust me - I know what I'm doing."
    - Sledge Hammer
    1. Re:Cellulose *variants*? by Jodaxia · · Score: 2, Informative

      Well basically any carbohydrate would be good evidence of life, however cellulose just happens to be very stable. (Think cotton shirts, cows chewing cud, and metamucil.)

      --
      crowbar??
  3. Knock! Knock! Who was there? by jusDfaqs · · Score: 1

    The salt people!

    The salt people who?


    The salt people who left this solar system eons ago!

    :-)

    --
    There are only two steps in the gathering of ultimate knowledge. Open your eyes and, RTFM!
  4. Look for the Margarita glasses by UberHoser · · Score: 2, Funny

    D.E.L.I.C.I.O.U.S. !

    --
    Guns are for wimps... Use a crossbow.. this way you can pin them to their chair when you go postal.
  5. slightly inaccurate summary by cowscows · · Score: 5, Interesting

    The article summary says that the cellulose found in 250 million year old salt is the oldest known evidence for life on Earth. That's not true, there's ample of evidence of life for billions of years before that. The article states that the 250 million year old salt is the oldest biological substance known, which is pretty cool, but there are plenty of other types of evidence for life besides just finding dead tissue.

    --

    One time I threw a brick at a duck.

    1. Re:slightly inaccurate summary by Telvin_3d · · Score: 1

      Feel free to swing by any college library you like. They have an entire section.

    2. Re:slightly inaccurate summary by Gat0r30y · · Score: 2, Insightful

      Radioactive decay is a pretty well understood phenomenon. The strong force (and weak too) in the nucleus of radioactive elements isn't quite strong enough to contain all the protons and neutrons in there, causing alpha and beta particles to come flying out from time to time (causing decay to another element in the case of a proton, and another isotope in the case of a neutron). By measuring the ratio of isotopes, we can figure out when a rock was formed. And, it all fits quite neatly in our standard model.
      So you are left with a choice, believe that the standard model is pretty much right, and thus the Earth must be ~ 4.5 billion years old, or deny the standard model. However, if you choose to deny the standard model, I would most sincerely enjoy your recaboobeling of quantum mechanics to explain this discrepancy.

      --
      Prediction: The real iPhone killer is going to be sex robots from Japan. Think about it.
    3. Re:slightly inaccurate summary by Anonymous Coward · · Score: 2, Funny

      He can't do that. He's too busy at church.

    4. Re:slightly inaccurate summary by wgaryhas · · Score: 1

      I've never quite understood how that allowed them to find the age of things. How do you know that is when the rock formed? You know the age of the atoms the rock is made of, not the age of the rock.

      --
      "For every complex problem, there is a solution that is simple, neat, and wrong." - H.L. Mencken
    5. Re:slightly inaccurate summary by Chris+Burke · · Score: 2, Insightful

      Well, the way it works for organic tissue and radio-carbon dating is that new higher isotopes of carbon are being created all the time, and have a generally equal distribution in the environment at large. When an organism is alive, it will continuously take in new carbon from the environment (food, CO2 for plants, etc) and thus maintain the same ratio of carbon isotopes. When it dies, however, it stops taking in new carbon, and thus slowly the existing radioactive isotopes will decay and not be replaced so the ratio decreases and you can calculate the age.

      I only use the example of radio-carbon because I'm familiar with it. I'd assume it's somewhat similar with dating geologic formations, in that while say sediments are being deposited on a river it's being exposed to a constant influx of new material, but once the sediment is well buried it becomes 'fixed'. But like I said, that's an assumption.

      --

      The enemies of Democracy are
    6. Re:slightly inaccurate summary by MightyMartian · · Score: 2, Interesting

      Start here. It also includes all the necessary references for going to the primary literature if you think all those evil atheist scum in talkorigins.org are just making it up:

      http://talkorigins.org/faqs/faq-age-of-earth.html

      In fact, I suggest you probably spend some time at that site.

      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
    7. Re:slightly inaccurate summary by david.given · · Score: 1

      I've never quite understood how that allowed them to find the age of things. How do you know that is when the rock formed? You know the age of the atoms the rock is made of, not the age of the rock.

      Ah, but rock's not made out of atoms --- it's made out of molecules. The molecules only work properly if they're made up of the right combination of atoms. Let's say that the environment the rock's formed in contains Foonium. Foonium is unstable and decays into Barnium, which is stable. They're chemically different; Foonium forms Foonium Oxide, but Barnium's an inert metal. So, when the rock's formed in lots of hot air, it ends up containing lots of Foonium Oxide --- but no Barnium, because the Barnium's so inert it doesn't take part in the rock-making process.

      Millions of years later, some of that Foonium has decayed into Barnium. Since we know that the rock was formed with 100% Foonium and 0% Barnium, we can use the ratio to figure out how long it's been since it was formed.

    8. Re:slightly inaccurate summary by eonlabs · · Score: 1

      I know there are both upper bounds and lower bounds on the accuracy of radiocarbon dating. I would assume these are related to variations in atmospheric conditions and carbon intake by organisms and the length of a half-life of carbon. Does anyone know what the limitations are and/or why?

      --
      I wouldn't consider the mad hatter mad. Just reality impaired. He sure can make a mean cup of tea.
    9. Re:slightly inaccurate summary by jaroslav · · Score: 1

      14C half life is about 5000 years and a decent rule of thumb is that radionuclide dating is good within an order of magnitude either directions. So from 500 to 50,000 years old.

      Why? It's basically just a functions of the number of decays that have taken place and the number of atoms left of the original. Before 500 years the small number of decays makes the process inaccurate and after 50,000 counting the atoms remaining becomes difficult.

    10. Re:slightly inaccurate summary by eonlabs · · Score: 1

      Awesome!

      Can someone Mod the parent post up?

      --
      I wouldn't consider the mad hatter mad. Just reality impaired. He sure can make a mean cup of tea.
  6. Return Sample? by Gat0r30y · · Score: 4, Informative

    Wouldn't this require a sample coming back here? It looks like they needed a Scanning Electron Microscope to see the cellulose fibers. It seems to me they would have to return a sample of the salts in order to see anything. Are there any plans for a sample return mission to mars anytime soon?

    --
    Prediction: The real iPhone killer is going to be sex robots from Japan. Think about it.
    1. Re:Return Sample? by Tablizer · · Score: 2, Funny

      they needed a Scanning Electron Microscope....Are there any plans for a sample return mission to mars anytime soon?

      I hope not. The possibility that it may contaminate Earth with a Mars infection we have no immunity for is too high. Even a 1-in-a-million chance is not worth it. Would you want to take a 1-to-million gamble with all of humanity? (Please, no G.W.Bush jokes). We'd probably need to set up an orbiting or moon base lab for that so that any infected workers are incubated away from Earth for at least a few years.

    2. Re:Return Sample? by SatanicPuppy · · Score: 1

      You've been watching too much sci-fi...It's unlikely that something from such a wildly different evolutionary line would even be infectious to us. It's still pretty rare that diseases jump species here and everything on Earth is pretty closely related, genetically speaking.

      The odds of finding a living, viable, martian disease that likes people are about the same as finding a herd of giraffes roaming around up there.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    3. Re:Return Sample? by QuantumFTL · · Score: 1

      I hope not. The possibility that it may contaminate Earth with a Mars infection we have no immunity for is too high. Even a 1-in-a-million chance is not worth it. Would you want to take a 1-to-million gamble with all of humanity?
      I agree with your sentiment about gambling with the lives of all of humankind, but is there any evidence to suggest that 1:1000000 are reasonable odds given:
      • Unlikelihood that there is present life on mars
      • Unlikelihood that it will survive the sample return mission
      • Unlikelihood that it will escape the lab
      • Unlikelihood that said life could survive in a much different atmosphere, temperature range, and populated biosphere
      • Unlikelihood that said life could in any way interface with and affect (especially infect) any terrestrial life forms
      • Unlikelihood that that terrestrial life form would happen to be human
      • Unlikelihood that it would actually kill every single human
      I'm sorry, but I don't think we're talking million to one. I think we're a little closer to the number of grains of sand on the earth here, when all is multiplied together.
    4. Re:Return Sample? by Tablizer · · Score: 5, Insightful

      You've been watching too much sci-fi...It's unlikely that something from such a wildly different evolutionary line would even be infectious to us.

      1. We don't know that with any certainty. It may end up being a "contest" to see which side can evolve an advantage over the other first before immunities are built up by both sides.

      2. Mars life may be related. Studies suggest asteroids can blast spores betweens planets.

      It's still pretty rare that diseases jump species here

      But species jumpers also tend to be some of the deadliest. Livestock are notorious for producing whoppers.

    5. Re:Return Sample? by Tablizer · · Score: 1

      If even the first or second "unlikely" item on your list turns out wrong, it will cast doubt on our ability to estimate such things (assuming we trust them in the first place).

    6. Re:Return Sample? by SatanicPuppy · · Score: 3, Interesting

      I don't honestly think there will be any evolutionary pressure, simply because there is no vehicle for it. In the case of livestock viruses, those viruses are passed around the animal populations for huge amounts of time before one manages to jump the divide. We live in close proximity to the livestock, so there is a good chance, given enough time, that a virus will mutate in just the right way, and that that mutation will happen in the right time and place to find a suitable host.

      None of that applies to a theoretical martian virus that's got no growth vector and no suitable host animal that it's evolved to live in, that we like to hang out with. It would have to have us nailed the first time, no tests, no practice. That's pretty damn unlikely.

      The asteroid thing is of course possible, but again pretty unlikely. In that scenario, it'd be more likely that we've already been infected with martian bacteria and have built up immunity than it is that our whole ecosystem is parallel to theirs, and their theoretical hostile bacteria are out there now, waiting.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    7. Re:Return Sample? by Geoffrey.landis · · Score: 2, Interesting

      You've been watching too much sci-fi...It's unlikely that something from such a wildly different evolutionary line would even be infectious to us. It's still pretty rare that diseases jump species here and everything on Earth is pretty closely related, genetically speaking.

      Don't bother with that-- if Martian organisms are halophilic, they could not survive in a salt concentration as low as that in our bloodstream, or our oceans; they would literally fall apart.

      ...and if they're not halophilic, they wouldn't survive on Mars.

      --
      http://www.geoffreylandis.com
    8. Re:Return Sample? by MightyMartian · · Score: 1

      If there is life on Mars, and if it is related in any way to life here (those are two really big ifs), there is still billions of years of divergent evolution here. Other than the possibility that such life might belch out chemical compounds that might be poisonous to Earth life, I think the likelihood of something that could actually infect any modern organism is exceedingly unlikely. I'd wager that if there is life on Mars, it would likely find our oxygen-nitrogen atmosphere quite poisonous, and would probably die if brought here unprotected.

      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
    9. Re:Return Sample? by Tablizer · · Score: 1

      None of that applies to a theoretical martian virus that's got no growth vector and no suitable host animal that it's evolved to live in, that we like to hang out with.

      It may start out in say the antarctic, but spread (evolve) to other environments over time fairly quickly because it has no natural enemies yet. It's similar to invasive species that beat out the native ones and become pests (like rabbits in Australia or the loud tree frogs in Hawaii). Its not that the invasive species is necessarily "better" than the native ones, its that it just takes too long for predators etc. to catch up.

      Yes, it is a long-shot, I agree, but the penalty for being wrong is potentially very high also.

          risk = harm * likelihood

      Likelihood is very small, but harm is potentially very large.

    10. Re:Return Sample? by Tablizer · · Score: 1

      I'd wager that ...

      You can say that with a million-to-one certainty? I don't think so. That is being overoptimistic about human science. Even our top theories are not that strong.

      We couldn't even prevent the housing bubble even though it was partially forcasted by many. You are going to trust human life to the same buerocrats? Please no!

    11. Re:Return Sample? by MightyMartian · · Score: 1

      You can never say anything with absolute certainty. I can't say with any certainty that the minute you turn away from your computer that a meteorite won't strike you right between the eyes. I can say it doesn't seem very likely. Biochemistry is a finicky thing and while one can't say that there might not be some risk, billions of years of specialized evolution means that both ecosystems would likely be quite incompatible.

      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
    12. Re:Return Sample? by MightyMartian · · Score: 1

      The situations are not analogous. In the case of foreign invasive species, you are, in fact, dealing, relatively speaking, with closely related organisms. Rabbits can, by and large, eat the Australian plants, because only a few hundred million years of evolution separate the plants from an ancestor of the rabbit that could process the food.

      If there was a common ancestor between life on Earth and some hypothetical Martian life, that common ancestor would likely date back over three billion years ago, which is orders of a magnitude longer period. Many of the features you would identify with rabbits and plants didn't exist back then. It may even be possible (and by no means do I accept that living organisms could survive being scooped up in a meteor collision and then millennia or millions of years in space) that many of the features of modern life may not have even evolved at this early period.

      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
    13. Re:Return Sample? by primenerd · · Score: 1

      Not necessarily, there are several old-school biochemical techniques which can assay for cellulose (involving all kinds of fun acids!). Preparing a sample for EM is quite involved. Also, a heavy metal is necessary as a contrasting agent making sample preparation a decidedly destructive process.

      Personally, if I was going to design an assay for material of biological origin I would use the properties of chirality. All complex biological molecules have a handedness. Organic molecules of abiotic origin are a "racemic mixture" where chirality is random. If plane-polarized light is shined through such a sample, no optical rotation is observed. In contrast, a sample of biological origin which consists of a single chiral species (say, a sample of a left-handed amino acid) will rotate the light. These assays have the advantage of being able to detect many of the most important biomolecules (sugars, nucleotides, amino acids). Such an assay would require a light source, a chromatography system, a detector and two plane-polarizing filters. Considerably more portable than an electron microscope.

      Of course the surface of Mars is a severely oxidizing environment, so it is debatable how well such labile bonds as those found in cellulose would survive over millions (billions) of years. A salt pan is probably the best place as any to look, as water tends to destroy such bonds.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    14. Re:Return Sample? by Tablizer · · Score: 1

      Rabbits can, by and large, eat the Australian plants, because only a few hundred million years of evolution separate the plants from an ancestor of the rabbit that could process the food.

      Most living things on earth eat organic proteins and to a lessor extent sugars. It is somewhat likely that predatorial Mars life does the same. At least we cannot bet our safety on certainty it is different. "Probably" does not cut it.

      If there was a common ancestor between life on Earth and some hypothetical Martian life, that common ancestor would likely date back over three billion years ago

      Not necessarily. The "asteroid bridge" still exists.

    15. Re:Return Sample? by Tablizer · · Score: 1

      First off, it's "bureaucrats".

      Spell checkers have a hard time finding that one for some reason. I don't understand why they don't add Soundex to their algorithms.

      In response to your real question -- you know how the word "theory" means different things to politicians and scientists?

      It does not matter. Politicians make the final decision, not scientists.

    16. Re:Return Sample? by Muad'Dave · · Score: 1

      Oh noes! I iz Martian virus, infektin yur beaf jurky!

      --
      Tiller's Rule: Never use a word in written form that you've only heard and never read. You will end up looking foolish.
    17. Re:Return Sample? by lorelorn · · Score: 1
      You are inventing non-existent risks, supplying meaningless numbers to these non-existent risks, and then saying we shouldn't do important research work for fear of your made-up risks.

      You'll forgive us for ignoring you, it's the only sane response.

    18. Re:Return Sample? by Tablizer · · Score: 1

      You are inventing non-existent risks

      How do you know they are non-existent?

  7. 250 million? by Tablizer · · Score: 3, Insightful

    Here on earth, tiny fuzzy fibers have been found in salt dating back almost 250 million years making it the oldest known evidence of life on earth.

    Earth cellular life evidence dates back to about 4 billion years if I remember correctly. Even some trilobite fossils date to around 530 million years ago. Perhaps they meant "250 million years since the formation of Earth"? Its a trick to make me RTFA to find out what they really meant.

  8. No, not oldest evidence of life by mck9 · · Score: 4, Informative

    No, these aren't the oldest known signs of life on earth. There are fossils way older than 250 million years. According to the article, this fuzz is the oldest known **biological material** on earth. Not the same thing.

  9. 250 million years by zakeria · · Score: 1

    wtf? we can look at huge bones older than this?

    1. Re:250 million years by PresidentEnder · · Score: 2, Informative

      As others have said, the old cellulose isn't the oldest evidence of life on earth. It's the oldest biological material on earth. Fossils are just rocks, prettily shaped.

      --
      I used to carry a bottle of whiskey for snake bite. And two snakes. -Nefarious Wheel
    2. Re:250 million years by zakeria · · Score: 1

      your over stating ... so fossils are not evidence of life? ... ummm

    3. Re:250 million years by DMUTPeregrine · · Score: 1

      No, fossils no longer contain any organic material. They're just fancy rocks that USED to be organic. This cellulose still IS organic.

      --
      Not a sentence!
  10. oldest known evidence of life on earth? by PeelBoy · · Score: 1

    I thought Stromatolites were the oldest known evidence of life on earth?

    1. Re:oldest known evidence of life on earth? by CheshireCatCO · · Score: 1

      Actually, I believe that the oldest evidence for life is in the isotope ratios in rocks. It's indirect, but it also relies less on chance than fossilization. (Basically, biological processes tend to use more of one isotope than another, leaving the atmosphere enriched relative to the background. So this is a tracer for the presence of biological activity.)

    2. Re:oldest known evidence of life on earth? by mapsjanhere · · Score: 1

      Do you have a quote on that preferential absorption of isotopes? The reason isotope ratios can be used to date materials (like Carbon 14 for recent events) is not that biological processes incorporate C14 preferably, but that they incorporate it at all. So once the biological activity stops, so does the C-14 absorption.

      --
      I'm aging rapidly, I bought a new game and had no idea if my machine was good for it.
    3. Re:oldest known evidence of life on earth? by MightyMartian · · Score: 1

      I think the parent may be misremembering the Oxygen Catastrophe. That began well over a billion years after the first life appeared on Earth. I believe we know about this due to deposits of iron oxide, which could only form in the presence of oxygen, and point to a period when all those wonderful early organisms had farted enough molecular oxygen into the atmosphere to start the process (and probably poison a lot of organisms in the process).

      I imagine it is possible that in certain reactions, certain isotopes are going to be favored more than others, though I don't know off hand of anything that associates that with the evolution of life.

      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
    4. Re:oldest known evidence of life on earth? by CheshireCatCO · · Score: 1

      A quote, no. But I believe that Steve Mojzsis has published work on this, if that helps. He explained it to us in graduate astrobiology, but a) I'm an astrophysicist and b) it was almost a decade ago, so I won't swear to be able to quote stuff back to you.

      The gist of it, as I recall, is that heavier isotopes react more sluggishly than lighter ones.

    5. Re:oldest known evidence of life on earth? by mapsjanhere · · Score: 1

      thanks, we were obviously looking at vastly different time scales. I found a reference at http://ntrs.nasa.gov/archive/nasa/casi.ntrs.nasa.gov/19980037618_1998078057.pdf . Now I have to track down the references therein for the isotope enrichment mechanism.

      --
      I'm aging rapidly, I bought a new game and had no idea if my machine was good for it.
    6. Re:oldest known evidence of life on earth? by CheshireCatCO · · Score: 1

      Any time. I'll have to try to remember to check my notes from Astrobio when I get home from the office today. I may have recorded the mechanism in more detail. On the other hand, probably not: I take lousy notes.

  11. Bad Summary by algae · · Score: 4, Informative

    Here on earth, tiny fuzzy fibers have been found in salt dating back almost 250 million years making it the oldest known evidence of life on earth.

    What the article actually *says*, is that the fibers themselves are 250 million years old, making them the oldest known biologically-produced material. There's obviously older evidence of life to be found on Earth.

    While I'm nitpicking, "Earth" is capitalized, as it is a proper name.

    --
    Causation can cause correlation
    1. Re:Bad Summary by Punko · · Score: 1

      Earth is our planet, while earth is a substance. One is a proper name, the other is a generic term for soil. Having said that, parent is correct that when we say "found on Earth" is should be capitalized. If the phrase was "found in the earth" either version could be correct, depending upon context.

      --
      If only we could fall into a woman's arms without falling into her hands
    2. Re:Bad Summary by MightyMartian · · Score: 2, Insightful

      What the article actually *says*, is that the fibers themselves are 250 million years old, making them the oldest known biologically-produced material. There's obviously older evidence of life to be found on Earth.


      I don't think that's quite accurate either. Certainly banded iron formations predate all of this by a couple of billion years. I guess cellulose may be the oldest surviving organic materials, but the evidence of life leaving behind different materials is much older than that.
      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
  12. If there is life on mars... by mlwmohawk · · Score: 1

    I wonder what the middle eastern religions, the trifecta judaism, christianity, and islam, will have to say about it. Either the universe is teaming with life, or we are the only ones. I find it hard to believe we are the only ones, so sooner or later will find proof of life somewhere.

    1. Re:If there is life on mars... by pak9rabid · · Score: 1

      I wonder what the middle eastern religions, the trifecta judaism, christianity, and islam, will have to say about it. Either the universe is teaming with life, or we are the only ones. I find it hard to believe we are the only ones, so sooner or later will find proof of life somewhere. Heh, I've always wondered the same thing. I'm sure the quick-thinking clergymen will find a way to incorporate this into their religion. Hell, the Bible's open for interpretation, right?
    2. Re:If there is life on mars... by QuantumFTL · · Score: 1

      I wonder what the middle eastern religions, the trifecta judaism, christianity, and islam, will have to say about it.
      Religion has survived much more "dangerous" things than finding evidence that there used to be bacteria on Mars. I would imagine they will say something along the lines of "It is the glory of God to conceal a thing: but the honour of kings is to search out a matter."

      Either the universe is teaming with life, or we are the only ones.
      Or it could be anywhere in between. We have no idea what the true criteria for life is, nor what effect sentient life has on the galaxy as a whole.
    3. Re:If there is life on mars... by Tablizer · · Score: 1

      wonder what the middle eastern religions, the trifecta judaism, christianity, and islam, will have to say about it. Either the universe is teaming with life, or we are the only ones.

      Most religions don't really address that. But if they find life and it's not [fill in the blank sect], then its "of the devil" and will probably be zapped.

    4. Re:If there is life on mars... by pak9rabid · · Score: 1

      ...thus solving our problem once and for all.....ONCE AND FOR ALL!!

    5. Re:If there is life on mars... by icebrain · · Score: 1

      I seem to remember reading that the Catholic Church (at least) is open to the idea of life elsewhere. The big debate comes with intelligent life: are the aliens Saved?

      --
      The meek may inherit the earth, but the strong shall take the stars.
    6. Re:If there is life on mars... by Bartab · · Score: 1, Informative

      It will be a non-question unless/until other intelligent life is found. A life filled universe will not contradict any of those religions.

      --
      Any sufficiently advanced technology is indistinguishable from a rigged demo.
    7. Re:If there is life on mars... by jamstar7 · · Score: 1

      There has been evidence for evolution since Darwin, hell, since the pyramids were built. Religious conservatives are fairly famous for saying things like "I see your evidence. Show me different evidence, evidence that supports my opinions." Just ask Galileo.

      --
      Understanding the scope of the problem is the first step on the path to true panic.
    8. Re:If there is life on mars... by scotch · · Score: 1

      How do you figure? All estimates for the likelihood of life arising in the universe are hogwash.

      --
      XML causes global warming.
    9. Re:If there is life on mars... by Kymermosst · · Score: 1

      I wonder what the middle eastern religions, the trifecta judaism, christianity, and islam, will have to say about it. Either the universe is teaming with life, or we are the only ones. I find it hard to believe we are the only ones, so sooner or later will find proof of life somewhere.

      I doubt we are alone. The real question is, are we alone with regard to how we have evolved with regards to intelligence and communication. After all, life on a distant planet is nothing but a small curiosity for scientific journals unless we can communicate with it.

      Oh, and you mean 'teeming', not 'teaming'. Well, unless you really did mean that the universe and life are forming a organization for working or playing together.

      --
      "Alcohol, Tobacco, Firearms, and Explosives" should be a convenience store, not a government agency.
    10. Re:If there is life on mars... by KeensMustard · · Score: 1

      I can't see why those particular religions would be concerned by the discovery of alien lifeforms - after they all centre around our own relationship with God and don't really focus upon the relationship God has with other, non-sentient life forms - nor indeed other hypothetical sentient forms of life. I imagine the discovery of alien life forms could well be troubling for atheists though.

    11. Re:If there is life on mars... by mlwmohawk · · Score: 1

      I imagine the discovery of alien life forms could well be troubling for atheists though.

      I don't understand this statement, please explain. I'm an atheist and I can't imagine why it would be troubling.

    12. Re:If there is life on mars... by bryguy5 · · Score: 1

      Not really an answer to your question - mostly the big 3 don't address it. But I would reccomend reading C.S. Lewis Space Trilogy. This little fictional story does a neat job integrating extraterrestials and ancient pre-christian stories into a neat package. Gives a good example of something a quick-thinking clergy man might do.

  13. Slug! by Tablizer · · Score: 3, Funny

    So my fantasy about pouring salt on a giant Mars Slug to save the astronaut colony still holds hope.

    1. Re:Slug! by jamstar7 · · Score: 1

      Good news is, with the discovery of salt on Mars, you don't have to pack your own all the way across millions of kilometers. That's a looooooooong way to go to find a 7-11, you know...

      --
      Understanding the scope of the problem is the first step on the path to true panic.
  14. Cellulose is not the earliest evidence for life. by elyons · · Score: 1
    Stramenopiles (or heterokonts) have incredible supporting evidence as having been on the planet for ~3 billion years. Here is a recent article from Nature and their editorial summary:

    Stromatolites are living, layered structures formed in shallow waters by a combination of microbial biofilms -- usually of blue-green algae -- and granular deposits. They are rare today but for about 2 billion years, following their arrival in the fossil record 3.5 billion years ago, they are the main evidence of life on Earth. Modern stromatolites still look like their fossilized forebears. But are the modern microbes remnants of ancient ecosystems or just latecomers following a similar lifestyle? A metagenomic study of the bacteriophage communities in modern stromatolites and thrombolites (like stromatolites but with an irregular internal structure) shows that stromatolite-associated phages are very different from each other and from any other ecosystem studied so far. This finding strengthens the hypothesis that modern stromatolites are remnants of ancient ecosystems.
  15. http://en.wikipedia.org/wiki/Stromatolite by sofar · · Score: 3, Informative

    http://en.wikipedia.org/wiki/Stromatolite

    Quote:

    "The earliest stromatolite of confirmed microbial origin dates to 2,724 million years ago."

    1. Re:http://en.wikipedia.org/wiki/Stromatolite by dnrck · · Score: 1

      Perhaps wikipedia requires updating, there is ample evidence that Stromatolite's were present up to 3,235Million Years Ago. Ca. Birger Rasmussen, 2000 re: Filamentousmicrofossils in Western Australia's Pilbara. (and others)

  16. that's not the reason... by sofar · · Score: 2, Insightful


    The real reason we want to explore Mars?

            Because we can

    or, a variant after my favorite mountaineer (after the late Edmund Hillary):

            Because it's there

    Stopping us from dreaming will make humanity dull and suicidal. Even though none of us might actually come to live the day that humans walk on the surface of Mars, doesn't mean that it is wrong to dream about it and start planning humanities future today.

    Don't hide in your house from wonderful things that could be. Embrace the future and help make dreams come true!

    1. Re:that's not the reason... by MightyMartian · · Score: 1

      There's a real down-to-earth problem to this sort of attitude. Basic research, even in areas that may seem quite remote from anything practical, is absolutely key to advancement. You simply don't know in advance how basic research, whether it's some guy in the desert digging up dinosaur bones or lost cities, or a xenobiologist dreaming up new kinds of biochemistries, will ultimately aid humanity. To simply kill any research because one can't imagine an immediate benefit is a recipe for stagnation and lost opportunities.

      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
    2. Re:that's not the reason... by Simonetta · · Score: 1

      The real reason we want to explore Mars?

                      Because we can


      No you can't. It's millions of miles away. It's technologically possible to fire off an expensive rocket (hey, shit! it's not your money), but it's impossible to explore the place. The reports returned from the very expensive rockets that have been sent there indicate that the place is a dead dusty dry place. If it were 10,000 kilometers away from where you lived on earth, you wouldn't have any interest in it. So what makes a dead, dry place special when it's millions of miles away? Nothing!

        Nobody is saying that humanity should stop dreaming. Focus dreams into stories and movies. When someone takes public funds for 'dreams' of trillion dollar projects to develop a dead rock millions of miles away, they aren't dreaming, they're sckeaming to rip off the public treasury for their own profit and call it 'science'. Fantasy is not science, and spending money on space exploration is stealing money from important realistic projects that need to be now...here on earth.

          If you are serious about planning humanitie's future, then work on the problems of over-population, climate change, economic collapse, and environmental catastrophe that are happening now...here on earth.

          To talk about space exploration and ignore real problems is to talk like a thief and a fool. Both of which we have too many of already. Grow up already and enter the real world.

      Thank you.

    3. Re:that's not the reason... by ScrewMaster · · Score: 4, Insightful

      To talk about space exploration and ignore real problems is to talk like a thief and a fool. Both of which we have too many of already. Grow up already and enter the real world.

      Well, it's a damned good thing the Queen of Spain didn't think like you.

      --
      The higher the technology, the sharper that two-edged sword.
    4. Re:that's not the reason... by sofar · · Score: 1

      this is an absolute troll-like response, you're literally twisting his words around. Grow up.

    5. Re:that's not the reason... by sofar · · Score: 2, Insightful

      I've got news for you:

            We *are* exploring Mars and we have been doing so for a long time already.

      Check your tax return this year and see how much money you paid into extraterrestrial research. You'll be surprised.

            "To talk about space exploration and ignore real problems is to talk like a thief and a fool."

      I guess all little boys who want to be astronauts on this world are thieves?

    6. Re:that's not the reason... by ScrewMaster · · Score: 1

      The real reason we want to explore Mars?

      Because we can


      So, to put this another way, the best reason we can come up with for exploring Mars is the exact same one that dogs use to lick their balls?

      --
      The higher the technology, the sharper that two-edged sword.
  17. Re:So what else is new? No life on Mars. by MightyMartian · · Score: 3, Insightful

    If you want cold lifeless desert, go to Death Valley or Arabia or the Gobi. It's much closer. You get the same empty experience, and, most importantly, you don't cost your fellow taxpayers any money.


    None of these, of course, are actually lifeless.
    --
    The world's burning. Moped Jesus spotted on I50. Details at 11.
  18. Why? by rrohbeck · · Score: 2, Insightful

    What's the probability that life on another planet evolved the same type of chemistry and the same type of macromolecules?
    If they found cellulose, I'd argue that it is from organisms that originated on earth. Now if they found (micro)fossils that are completely different from anything we know I'd listen up.

    1. Re:Why? by MightyMartian · · Score: 2, Interesting

      I honestly don't know enough about complex chemistry to answer any question like that. I would suspect, however, that for any carbon-based life, carbohydrates are going to be an absolute requirement for releasing and utilizing energy (ie. ATP). In that case, you're likely going to find related chemistry (starches, cellulose, etc.) in such ecosystems, even if they are unrelated to or only distantly related to life on this planet.

      Now, of course, if life is silicon based, then you're right, you would have an entirely alien chemistry, and would have to look for very different things.

      --
      The world's burning. Moped Jesus spotted on I50. Details at 11.
    2. Re:Why? by hyades1 · · Score: 1

      There is ample evidence that meteorites found in Antarctica have their origin on Mars. I wouldn't be terribly surprised if, in the event that indications of life are found elsewhere in the solar system, it turns out to be similar in many ways to life on Earth.

      --
      I've calculated my velocity with such exquisite precision that I have no idea where I am.
  19. Re:So what else is new? No life on Mars. by grahamd0 · · Score: 1

    If you want cold lifeless desert, go to Death Valley or Arabia or the Gobi. It's much closer. You get the same empty experience, and, most importantly, you don't cost your fellow taxpayers any money.


    None of these, of course, are actually lifeless. Also, only one of them is consistently cold.
  20. Re:So what else is new? No life on Mars. by MightyMartian · · Score: 1

    You make a moronic statement, and then attack me as a pretentious twit. It's little wonder that such a fuzzy mind cannot imagine anything beyond his nose.

    --
    The world's burning. Moped Jesus spotted on I50. Details at 11.
  21. Re:So what else is new? No life on Mars. by Simonetta · · Score: 1

    You make a moronic statement,...

      Please be more specific about which of my many reasonable and rational statements you consider to be 'moronic'.

  22. Well ... by ScrewMaster · · Score: 1

    since there don't appear to be any Martians left, I'd say they weren't worth their salt.

    --
    The higher the technology, the sharper that two-edged sword.
  23. Re:So what else is new? No life on Mars. by MightyMartian · · Score: 1

    You made a clearly inaccurate statement about the locales you mentioned. That shows your ignorance. Did you honestly think such a stupid piece of rhetoric would pass muster around here? If so, then add that to the list of your stupidities.

    --
    The world's burning. Moped Jesus spotted on I50. Details at 11.
  24. Re:Do you KNOW what the QUEERS are doing to the SO by rk · · Score: 1

    Wow, I guess we have our answer. The Mods REALLY hate the Dead Milkmen.

    The lesson is learned. One must contain their pop-culture references to the approved Linux, Star Trek, Star Wars, Simpsons, South Park and Zero Wing canon. All else is anathema and must be labeled "Flamebait" so as to not taint the /. culture. If one questions this, one will get further modded Offtopic. By all means, don't fail to disappoint. Do your part and mod this down right away!

  25. Re:So what else is new? No life on Mars. by Simonetta · · Score: 1

    You made a clearly inaccurate statement about the locales you mentioned. That shows your ignorance.

    Well, excuse me... I'm not polishing my doctorate thesis here. I'm typing Slashdot comments.

    I said that the extereme regions of desert on the earth are essentially lifeless. What I meant is not that they don't have the occasional blade of grass or microscopic bug clinging to existence in a brutal environment. I meant that these places can't support human life. Which is the only type of life (if you are a human or a close equivalent) that counts.

    In other words, the possible existence of microscopic bugs or one-celled proto-life forms don't mean shit outside of theoretical or theological context, which, in the real world where human and close equivalents actually live, doesn't mean shit.

    And the allocation of public funds to investigate the remote possibility that some proto-virus or possible semblance of life might exist on a rock spinning in space millions of miles away is nothing more than a theft of public resources by anyone who would spend public funds (many billions of dollars of public funds) just to check this out.

    Since the only people who consider this subject important are so-called scientists who want to rip off public funds in order to fund their fantasies and theologians who believe that the possible existence of life challenges their particular fantasies, then let them pay for interplanetary exploration with their own money. Not public funds.

      And yes, you are a pretentious twit. Get used to it, because I'm not going to be the last person that points this out to you.

  26. We don't know by dreamchaser · · Score: 1

    We don't know how many templates there are for life or the frequency of them. For all we know life follows a very similar chemical pattern everywhere it ariese. Or not. That's the point. We don't know, but it's worth looking into.

  27. The real reason by techdolphin · · Score: 1

    It is obvious why there is no life on Mars. The men made all the women go to Venus so they could watch football. Once they decided they needed women, they could not find Venus and refused to ask for directions.

  28. Re:So what else is new? No life on Mars. by DMUTPeregrine · · Score: 2, Insightful
    They can't support human life. Yeah. Except, y'know, for the people that live there. Sure, they import water, but we could extract that at a higher energy expense from the air and deep watersheds. (Solar energy can provide that extra energy, while also providing shade under the solar panels to make cooling the water-storage area easier.) A self-sustaining community in an Earth desert is perfectly possible.
    If the mars polar caps do contain water ice a human community on Mars is possible.
    A self-sustaining human community would want to know about any possible infectious sources. A self-sustaining extraterrestrial human community is necessary to avoid probable pandemics, asteroid impacts, or other situations that would have extreme adverse effects on Earth-based population.
    Therefore this research is in the public interest, and only pretentious, greedy twits with no concept of the future such as yourself can't see even the basic potential listed above. And there's lots more that can come out of such research, but, as with you, I'm not writing my doctorate thesis here.
    P.S. Preview is your friend, as is

    </i>
    .
    --
    Not a sentence!
  29. Thanks for the reference by Mathinker · · Score: 1

    1) Thanks for the reference, I'd always wondered about that. What song is it from?
    2) I think the problem with your theory is that it was already (at least partially) flamebait in the original context. Flamebait is flamebait, even if it has a pop-cultural basis.
    3) "The Mods REALLY hate the Dead Milkmen." => You ignore Hanlon's Razor.
    4) Even insightful, informative comments which are unconnected to the topic of the article are fair game for Offtopic mods. That would, of course, include this comment.

    1. Re:Thanks for the reference by rifter · · Score: 1

      1) Thanks for the reference, I'd always wondered about that. What song is it from?

      It's called Stuart.

      2) I think the problem with your theory is that it was already (at least partially) flamebait in the original context. Flamebait is flamebait, even if it has a pop-cultural basis.

      No, it was +5 funny in its ORIGINAL context. The song (a story really) was meant to be funny, like all their other songs. If you want anti-flamer flamebait try some Republican party speeches.

      3) "The Mods REALLY hate the Dead Milkmen." => You ignore Hanlon's Razor.

      Not really. They don't like the Dead Milkmen and are therefore stupid. There I said it. :D Either way Hanlon's is irrelevant to the observation.

      4) Even insightful, informative comments which are unconnected to the topic of the article are fair game for Offtopic mods. That would, of course, include this comment.

      Wow. Just ... Wow. So a joke about martians is offtopic in a slashdot article about martians. Typical /. moderation logic; this only confirms point 4. :D

  30. They can't support human life by Simonetta · · Score: 1

    A self-sustaining extraterrestrial human community
        A human community on Mars could never be self-sustaining.

    is necessary to avoid probable pandemics, asteroid impacts, or other situations that would have extreme adverse effects on Earth-based population.

    These problems haven't destroyed human life on Earth in 50,000 years. They would destroy human life on Mars within months.

    Therefore this research is in the public interest,
    Any research could be called public interest by this vague definition. Allow me to give a more precise definition - any research receiving public funds must be directed to a specific solution to an immediate life-threatening problem. Mars work doesn't qualify.

    only pretentious, greedy twits with no concept of the future such as yourself ...
    I'm only telling the truth to the star-struck geeks. I'm said nothing about spending public funds on myself, and scientists have told us that the future in concept and reality holds over-population, climate change, and ecological disaster. Funds spent on Mars follies would not be available to deal with these real problems here and now. Besides, the US federal government is broke and living on borrowed funds, as are the American people who supply the government with these funds.

    And there's lots more that can come out of such research...
    Pass the Tang, dude!

    In conclusion, Slashdot space cadets MUST prepare themselves for the coming fiscal reality that gives nothing more than lip-service and trivial amounts of public funds to their fantasy projects. The country is broke and is facing massive problems that will shake the government to its core. The 20th century is over and so is the era of space exploration. At least we still have Star Trek.