US Scientists Predict Long Battle Against Ebola

An anonymous reader writes: Despite recent advances in medicine to treat Ebola, epidemiologists are not hopeful that the outbreak in west Africa will be contained any time soon. Revised models for the disease's spread expect the outbreak to last 12 to 18 months longer, likely infecting hundreds of thousands of people. "While previous outbreaks have been largely confined to rural areas, the current epidemic, the largest ever, has reached densely populated, impoverished cities — including Monrovia, the capital of Liberia — gravely complicating efforts to control the spread of the disease. ... What worries public health officials most is that the epidemic has begun to grow exponentially in Liberia. In the most recent week reported, Liberia had nearly 400 new cases, almost double the number reported the week before. Another grave concern, the W.H.O. said, is 'evidence of substantial underreporting of cases and deaths.' The organization reported on Friday that the number of Ebola cases as of Sept. 7 was 4,366, including 2,218 deaths." Scientists are urging greater public health efforts to slow the exponential trajectory of the disease and bring it back under control.

Comments

+-2000 deaths?

[nospam007]

That's about the number of deaths measles cost us every 6 days and we've had a vaccine for that for over 50 years.

Re:+-2000 deaths?

[Noah Haders]

Yeah except last month it was 1000 deaths and the month before that 500 deaths and the month before that 250 deaths.

Re:+-2000 deaths?

[alen]

1918 flu killed 18 million around the world. figure around 50 million with today's population.
black plague killed 1/3 of europe and 1/3 of byzantium when it struck

point is to control it before it gets that far

Re:+-2000 deaths?

[fuzzyfuzzyfungus]

It's not really polite to say so that bluntly; but the difference is that measles deaths are basically optional(1st world anti-vaxxers) or just another bad thing that happens to poor people in poor and unpleasant places. By contrast, Ebola is currently just another bad thing that happens to poor people in poor and unpleasant places; but we've got basically nothing available to do about it if it spreads beyond the usual outbreak sites(yes, unlike the usual outbreak sites, we have limited supplies of high grade medical isolation gear and some interesting experimental drugs; but nobody has enough of the cool tech to deal with an outbreak of nontrivial size, especially if they want their medical and logistical systems to continue handling routine functions and care at the same time).

There are loads of places far less poor and squalid than Liberia and the other oubreak sites; but without any good options on the table it wouldn't take long to run through your supply of isolation wards and fancy positive-pressure protective suits even in the most upmarket first world locations with well regarded research hospitals and such, were the population to be affected.

Re:+-2000 deaths?

[rogoshen1]

can ebola, by it's very nature even *get* that far? It's significantly more lethal more quickly than the flu; and it's vector for spread isn't a flea on the back of rat.

(not to say there's no cause for alarm, this strain of ebola in a large, densely packed city is obviously a disaster.. but playing the pandemic card is a bit more far fetched)

Re:+-2000 deaths?

[sillybilly]

The cure is simple. Eat some black earth that smells fresh and is full of 4 billion years of evolution. They will read your thoughts. If you are good, they will fight the virus off in you. You can pray, or pet a cat, feed the birds, stuff like that. You tell me black earth is hard to come by in the desertifying Nigeria? Well, that's true, but it's not the Nigerians to blame the most, but global warming polluters around the world. It's still their kind, so them Nigerian black earth resident bacteria, or what used to be black earth, are obviously pissed at humans.

Re:+-2000 deaths?

[sillybilly]

The point is that there were always survivors. The death rate was never 100%. Not with anything non-human invented. According to Christopher Smart, even his cat Jeoffrey, he plays with the mice he catches, and 1 in 7 escape thus. A cat is a very efficient killer of mice, it can see in almost total dark, but even it allows some to make it.

Though it may be possible that humans do come up with stuff that gets 100% death rate in their biotech labs. But nature, so far, even during major extinction events, has not.

Re:+-2000 deaths?

[rmdingler]

Yes. Exponential doubling of mortality is a concern, especially since the virus has reached urban areas in Liberia, Sierra Leone, and Guinea.

For any who are tempted by the comforting thought that this remains an African Problem, remember that the longer the virus replicates inside a host species, the more chances there are for a favorable mutation to take hold.

Favorable for the virus.

Re:+-2000 deaths?

[Anonymous Coward]

Measles is stable and has been for a decade or two (and that stable level is far far below thirty years ago).

This Ebola outbreak is still moving exponentially and has been quite regular on that front. By February 2015 it will kill, in that month alone, more people than measles has in the previous 12 months. In just the month of March 2015 it will kill more people than Measles has in a decade.

By this time next year, we're all fucked.

This IS the end times.

Re: +-2000 deaths?

[Anonymous Coward]

Yes but unlike measels the Ebola outbreak could have been contained if it were not for the moronic actions and beliefs of the people its been infecting. Ebola is not easy to transmit. Measles is by comparison.

Re:+-2000 deaths?

[alen]

imagine 1/3 of the USA or the first world dying? that's not only a decades long economic depression that will follow, it will mean a huge impact onto your quality of life as people who make all your stuff from the food you eat to your electricity to gasoline die, you will have to learn how to survive on your own. grow your own food, etc

Re:+-2000 deaths?

[mod prime]

If we ever get to the point where we're getting over 500,000 cases of Ebola every year, but are only seeing 2000 deaths a week, then we'll talk.

Re: +-2000 deaths?

[dgatwood]

Ebola may not be easy to transmit, but it sure as heck isn't hard to transmit. It's not pedantically known to be airborne, but it is believed to be spread by droplets (e.g. sneezes). There's a very, very, very fine line between the two.

And yes, I can provide citations if you'd like, but it's not like they're very hard to find with a Google search.

Re:+-2000 deaths?

[Daniel_Staal]

All it takes is a couple of people who 'aren't infected, just look' (there are a few days of little-to-no symptoms) to bribe some official to get on some plane or past a border check. We're a significantly more interconnected world today than even a hundred years ago - you don't need rats to spread things widely.

It's not a pandemic - yet. But it wouldn't take much for it to be one, and it would be major.

Re:+-2000 deaths?

[davester666]

and yet, if it were to happen, humanity would not learn from it.

Re: +-2000 deaths?

[Noah Haders]

i did a google search and it said you're full of shit. want to see the link? search for it yourself.

Re:+-2000 deaths?

[Noah Haders]

you never know, ebola could mutate into some superhero bug that gives people big erections.

Re:+-2000 deaths?

[Kaenneth]

Competing consumers would also drop from the population. Less food/power/gas would be needed to match.

Re:+-2000 deaths?

[pitchpipe]

... ebola could mutate into some superhero bug that gives people big erections.

Just like your mom.

Re:+-2000 deaths?

[Anonymous Coward]

The number one problem in the world today is overpopulation. If 1/3 of the population was to die off those remaining would face some adjustments but in the end things would move towards a new equilibrium between population size versus the natural resources needed to support a lower population. There are 6 billion people on earth and the resources are already being pushed to it's limits and wars are being waged to secure those resources. How would things look if the global population reaches 10 or 20 billion? We are on the path towards breeding ourselves to death. After the survivors get over the profound shock of losing so many people the quality of life would recover and become better than it has ever been.

Re:+-2000 deaths?

[Daniel_Staal]

Possibly. But the short-term social disruption would not be something I'd like to witness.

And since the 'short-term' in this case is probably 'a generation or two', I'd have to be a witness. (Or dead.)

Re: +-2000 deaths?

[dgatwood]

Okay, here's a link to the research paper from 2012.

Re:+-2000 deaths?

[gringer]

Doubling time is closer to 50 days than 30 days:

http://i.imgur.com/trBhsa2.png

But the point still stands, you don't want to mess around when there's exponential growth at play. With 50 days doubling time, you get to the population of the world in about 2 years.

Re:+-2000 deaths?

[gweihir]

Indeed. The problem is collapse of civilization in the affected areas. Worst-case scenarios like planes having to be shot down because there is nobody left on the other side that checks who is getting on them may become a reality.

This thing is now a race between immunity (natural from survivors and pharmaceutical from vaccinations or effective treatments) and containment on the one side and its infection rate on the other side. Containment is basically out. Even a modern western state could not handle that in a large city.

Re:+-2000 deaths?

[gweihir]

This will not become a pandemic. If necessary, there will be nuclear cauterization. Human civilization cannot survive a pandemic of this stuff, the survival rate is 50% only with good medical care. With civilizatory collapse, it is more likely to be > 95%.

Re:+-2000 deaths?

[Anonymous Coward]

The problem is most certainly not overpopulation its that 10% of the planet's people use 90% of its resources. Go back to high school.

Re:+-2000 deaths?

[Anonymous Coward]

what is favorable for the virus is also favorable for us. if it grows more deadly and wipes out all life on earth, that would not be favorable for the virus. in fact, the reason this outbreak is so bad is that the incubation and 'dying period' are taking longer. so, some intelligent evolution should direct the virus to continue on that path - even longer incubation and 'dying periods'. the longer the host can live, the better off the virus is. but, that also gives us more time to develop treatments and vaccines (but don't tell the virus that!)

Re:+-2000 deaths?

[Anonymous Coward]

Re: "...it wouldn't take long to run through your supply of isolation wards and fancy positive-pressure protective suits... "

Well yeah, but so what? None of that is actually necessary here. It's striking that with no direct treatment at all (I'm discounting ZMapp as experimental and unproven), we can manage Ebola just fine. In some of the poorest places on Earth.

Supportive care. You keep the patient clean, fed (if possible, when possible), and watered. Survival rates go up. The important thing is that you have a cooperative patient and no goons or loons trying to "free" them. You can keep the patient in open wards if needed, so long as the beds are spaced appropriately. No need for all the NASA equipment which doesn't actually do all that much in this circumstance. Ebola does not travel without some help. You need direct body fluids contact, very much like AIDS. Which most places now have considerable experience with.

All the concern about Ebola mutating is theoretical at this point. The rates and likelihood of Ebola mutations are simply speculative and unknown.

I don't want to downplay the importance of squashing this outbreak. Lives hang in the balance. However Ebola is very controllable using ordinary public health practices. Technically we know everything we need to know to get this controlled. The problems with control are all political, monetary, educational, and social.

Re:+-2000 deaths?

[Anonymous Coward]

But wages rise, real estate prices fall, and traffic gets better.
Profit.

Re:+-2000 deaths?

[symbolset]

This will / has become a pandemic.

Re:+-2000 deaths?

[symbolset]

This strain kills 90%. There is a concurrent strain in DR Congo that kills 60% that survivors of this strain have no immunity to. Between the two that is 96% before you consider network effects and viral evolution. This could wind up being the big reset button that puts the global population down to 2 million, if it doesn't wipe us out altogether. Maybe we need to revisit the Great dying in this context. If we have time.

Re:+-2000 deaths?

[symbolset]

It takes three medical support people to keep an Ebola patient clean, dry, hydrated, fed, and disposed of when he dies. And three more armed and dangerous army types to defend you while you do it. Now look at the Monrovia metro area with 4.4 million souls. On a moment's notice where are you going to get 15 million health professionals, 15 million soldiers, and the materials necessary to ensure this virus "only" kills 70% of the population? You aren't.

Re:+-2000 deaths?

[gweihir]

No. Definitely not. Not by several orders of magnitude. Maybe look up some definitions before spouting BS?

Re:+-2000 deaths?

[Anonymous Coward]

The Plague increased wealth for the survivors by a lot.

Re:+-2000 deaths?

[geantvert]

There is no such thing as nuclear cauterization except in movies and video games.
A nuclear attack in a densely populated area would just destroy the medical infrastruture and would create thousands or millions of survivors most of them affected by radiations and so with a weakened immune system. The pandemic would spread very fast.

Re:+-2000 deaths?

[32771]

I have doubts, but if you look at which country has the higher probability of dying it is poor countries in Africa whereas the first world can fend it off easily. This leads me to think that as we get under pressure from net energy decline we will be far more susceptible to diseases like Ebola. Of course pandemics can have knock on effects, i.e. the global flow of things will get reduced due to countries barricading themselves in, but initially it were the conditions of people living in West Africa who were unable to defend themselves because they didn't have the means to do so.

If you assume the club of Rome was correct in discovering that exponential population growth cannot be supported by improving technology, our inability to fend off the killers of the past should serve as an indicator of how far we have gone towards the bottleneck. The spread of diseases is especially useful as an indicator since they spread faster with higher population density and higher transportation volume. Whenever we must let our guard down because we cannot afford it you should see something like Ebola getting out of hand.

So far this is happening at the fringes, if we have reached a number of 500000 cumulatively infected by March next year I'm willing to believe you though. But I'm certain that we have enough time to study our decline in great detail, even though it should get sketchy toward the end.

Re:+-2000 deaths?

[geantvert]

The doubling time looks like 30 to me (1000 at 110 and 2000 at 140)
According to the given formula e^(0.022x+4.591) it is actually log(2)/0.022 = 31.5
e^(0.022*0+4.591) = 98
e^(0.022*31.5+4.591) = 197
e^(0.022*63+4.591) = 394
e^(0.022*94.5+4.591) = 788 ...

Re:+-2000 deaths?

[gringer]

According to the given formula e^(0.022x+4.591) it is actually log(2)/0.022 = 31.5

Hmm... sorry, I got the wrong base. But I also got my millions and billions muddled up, so it's still about 2 years....

Re:+-2000 deaths?

[Eunuchswear]

All it takes is a couple of people who 'aren't infected, just look' (there are a few days of little-to-no symptoms) to bribe some official to get on some plane or past a border check.

Except that's already happened.

In the middle of a hospital doctors strike in the receiving country.

And the receiving country was Nigeria, not a country with a first world health system.

And we've had 21 infected and 7 deaths so far.

So don't panic yet.

Re:+-2000 deaths?

[Eunuchswear]

This strain kills 90%

Rubbish. Around 50% with rudimentary treatment.

Re:+-2000 deaths?

[swb]

Not sure if this matters, but I remember reading someplace that one of the "benefits" of the plague is that it drove up the cost of labor which ended up having a positive impact for ordinary people.

Re: +-2000 deaths?

[Anonymous Coward]

Pigs (infected intra-nasaly) transmitting virus to monkeys does not mean that humans, who are getting infected through mucosal surfaces, will transmit that way. There have been many chances for humans to spread the virus this way, but so far there is no evidence that supports this transmission route.

Re: +-2000 deaths?

[Anonymous Coward]

Any references for why this would become a major pandemic? Just a gut feeling or have you watched too many movies?
Anyway, "pandemic" has a very simple meaning. What exactly would separate a pandemic versus a "major" one? We don't need more hype about this disease than we already have. It is a problem, but that doesn't mean that it will bring about the end of the world.

Re:+-2000 deaths?

[Anonymous Coward]

of course that was back when for all practivcal purposes labor == people to work the land.
Since one person could only work so much land there was an obvious shortage og labor.

Most current jobs scale with population (except of course the bureaucracy), so...

Re:+-2000 deaths?

[Anonymous Coward]

Given time ebola probably will get that far, "not-airborne" is not such a significant impedment to virus spread as its made out to be. While at the moment ebola getting anywhere outside africa is very small indeed it keeps getting more and more likely as more people get infected. With number of cases doubling every 20-30 days likelyhood of ebola spreading to yet another country doubles as well.
I find the so-and-so many months of infections predictions mathematically disturbing. If current 4-5k infections cant be dealt with how in the world would anyone deal with 100k+ infections or why would the epidemic suddenly stop spreading then? Last 3 months have seen pretty much purely exponential growth, showing nil effect from containment efforts. As this trend continues it will only get harder to stop it, hopes of the epidemic ending before coming a true pandemic are getting slimmer and slimmer.
Exponents are scary

Re:+-2000 deaths?

[Anonymous Coward]

Survival rates go up? So only 70% of infected people die? Oh jolly good, no worries then.
Also every country has a limit of how many patients they can take care of at any time. While first world countries obviously have higher limits than say Liberia, there is still no country in the world that could handle say 100k-1M ebola patients at a time. Most countries would be helpless with 1000+ patients. Now imagine that current trend continues in West Africa - you will soon see hundreds of thousands to millions of ebola refugees and suddely lots of countries will be in this 1000+ cases situation. Rince and repeat for every country the infection starts spreading in. You run out of third world countries fast. Sooner or later first world countries will be in trouble too.

Re: +-2000 deaths?

[Anonymous Coward]

There is nothing else than rudimentary treatment for ebola; IV saline to keep you hydrated while you bleed and shit your guts out (hence why hydration through digestive tract doesn't work). Now, this strain might appear to be 50% death rate, but that's misleading; 2400 deaths for 4800 cases is more than 50% considering that the number of infected is leading by many days - they haven't had the time to go through the full infectious phase and, well, die. When the pandemic runs its course and stabilizes over the pool of potential infected, the final mortality will rather be 65-75%. Now consider what a few thousand infected will do to the healthcare system of any so-called developped country, and you'll realize that even your standards for rudimentary care are optimistic. The hubris in your opinion is palpable.

Re:+-2000 deaths?

[Eunuchswear]

It takes three medical support people to keep an Ebola patient clean, dry, hydrated, fed

Yes, but those same 3 can deal with up to 10-20 other patients at the same time.

And three more armed and dangerous army types to defend you while you do it

No. because not all the world is the one against all hobseian hellhole that the US pretends it is.

Re:+-2000 deaths?

[Eunuchswear]

imagine 1/3 of the USA or the first world dying?

That's the "happy end" of John Brunner's "The Sheep Look Up".

Re: +-2000 deaths?

[Eunuchswear]

When the pandemic runs its course and stabilizes over the pool of potential infected, the final mortality will rather be 65-75%. Now consider what a few thousand infected will do to the healthcare system of any so-called developped country, and you'll realize that even your standards for rudimentary care are optimistic. The hubris in your opinion is palpable.

So your contention is that the health systems of Liberie, Guinea and Seirra Leone were better prepared for this problem than those of first world countries?

Re:+-2000 deaths?

[eric_harris_76]

One appalling aspect of the Spanish Flu epidemic is that, due to wartime censorship, information about the disease was suppressed, including information about where it was, and how to avoid it.

Not in Spain, though. The disease was in a lot of places, including Spain. Spain wasn't in WW 1, so wartime censorship did not apply there.

Information about it was in Spanish newspapers, and that's how it got the name -- even though it apparently started in Kansas, and spread through overcrowded US military barracks and troop ships.

Re:+-2000 deaths?

[rmdingler]

One of the better sigs I've ever read here was the quote from Men In Black: A person is smart. People are dumb, panicky dangerous animals and you know it. I enjoyed reading The Hot Zone. Though watching Outbreak was difficult due to its implausible plot line, they got the civil breakdown right.

In the west, we have a difficult time living down a major football contest (win or lose) with no rioting, let alone a natural disaster. What advantage are we afforded by natural selection that makes the anarchy of crowds a sustainable genetic trait?

Re:+-2000 deaths?

[LordWabbit2]

Grow up, there is no way a nuclear cauterization would ever be condoned. Just because it's Africa and you don't give a fvck about it doesn't mean you can nuke it.

Re:+-2000 deaths?

[david_thornley]

From my reading, it's possible to be infected for two or three weeks without visible symptoms. This means that there's plenty of opportunity for somebody in Africa to get on a plane and go somewhere else, and then have ebola hit. I have no confidence in confining it to one continent.

Re:+-2000 deaths?

[WuphonsReach]

From my reading, it's possible to be infected for two or three weeks without visible symptoms. This means that there's plenty of opportunity for somebody in Africa to get on a plane and go somewhere else, and then have ebola hit. I have no confidence in confining it to one continent.

You need to go back and read again.

Until you are symptomatic, you are not infectious.

(And it's highly unlikely, as in lightning-strike odds territory, to become able to infect via airborne methods. It will remain a touch bodily-fluids and be infected virus.)

Nothing good...

[Anonymous Coward]

ever comes outa Africa.

Re:Nothing good...

[sillybilly]

Your ancestors came out of there around 200,000 years ago, when they climbed off the trees.

Re:Nothing good...

[umghhh]

exactly.

Re: Nothing good...

[Anonymous Coward]

Yea we car from Africa and we got the fuck out because it's a cesspool of disease and poverty. Yay us!

Re:Nothing good...

[istartedi]

[nothing good] ever comes outa Africa.

Drink some coffee, google around a bit, and get back to us.

Re:Nothing good...

[Anonymous Coward]

Coffee is shit.

Re:Nothing good...

[Anonymous Coward]

American coffee is shit.

Re:Nothing good...

[lister king of smeg]

[nothing good] ever comes outa Africa.

Drink some coffee, google around a bit, and get back to us.

I do like to drink my Columbian coffee, that according to you own link was probably indigenous to and first cultivated in Yemen.

Re:Nothing good...

[MildlyTangy]

Coffee is shit.

ooo, the Nonsense Game...lets play!

All Ice Cream is disgusting.
Chocolate is hideous.
Vegetables are the devil.
Soda tastes like a rotten corpse.
Water is ebola.
Sunshine is evil.

OK, your turn!

Re:Nothing good...

[kybred]

I do like to drink my Columbian coffee, that according to you own link was probably indigenous to and first cultivated in Yemen.

You should try Colombian coffee instead!

Re:Nothing good...

[Anonymous Coward]

Columbian coffee? You mean, from the Starbucks across the street from the White House?

That sucks.

[Anonymous Coward]

I don't want a long battle. I was hoping this was the beginning of a quick end. I wanted to see Ebola (or something) spread across the globe and wipe most of us out. It would have been fantastic.

Re:That sucks.

[symbolset]

Be careful what you wish for. Some wishes are granted.

as long as there are no zombies

[alen]

i'm not worried

Re:as long as there are no zombies

[BasilBrush]

You'd be worried if you had ebola. It's most likely to kill you, and it 's a very painful and nasty death.

3... 2.. 1.

[Anonymous Coward]

Begin comparisons to Orson Scott Card's Hidden Empire by combining this story + Justice Sotomayor Warns Against Tech-Enabled "Orwellian" World + DARPA Funds Harvard's Soft Exoskeletal Suit + politics

Good episode of Frontline

[Enry]

For those of you in the US, the PBS show Frontline had part of an episode dedicated to what's going on. While it is very hard to get, cultural problems there make it really easy (mourners touch the dead). People in remote villages are scared to tell doctors that they have symptoms since they'll be whisked off to the clinic, never to be seen again, just like almost everyone else that went to the clinic. In the larger cities, some nitwits are spreading the rumor that Ebola doesn't exist and the government is just trying to steal blood from the patients. So bands of people think that patents bleeding from every orifice needs to be rescued(!).

Re:Good episode of Frontline

[TubeSteak]

Liberia is/was classified as a "fragile state," despite being near the bottom of the failed state index.

Cultural issues exacerbated the spread, but the actual problem is the Liberian Government's inability to (or decision not to) mobilize resources and quarantine infected patients or infected areas.

People are already calling for the President's resignation and arguing that the her poor *handling of this plague has pushed Liberia back towards being a failed state.

*and a general inability to create a viable healthcare system during her 9 years in office.

Re:Good episode of Frontline

[Mashiki]

There's a simple solution then, we go back to doing what we had every time there was a serious outbreak of some disease. Quarantine and cutting that area off, eventually it'll simply kill the stupid people off. Something that most people don't realize is that many places outside of the western world, the understanding of the spread of infectious disease is where Europe was in the 900-1200's.

Re:Good episode of Frontline

[Enry]

No, far later than that. Slaves brought from Africa in the 15th and 16trh centuries came with Yellow Fever and Malaria. Since they either already had it as children or had better genes to handle the disease, they were usually okay, but Europeans who were in the colonies would get sick for a year and possibly die. They made a connection, but didn't do anything about it.

Re:Good episode of Frontline

[Anonymous Coward]

For those of you in the US, the PBS show Frontline had part of an episode dedicated to what's going on. While it is very hard to get, cultural problems there make it really easy (mourners touch the dead). People in remote villages are scared to tell doctors that they have symptoms since they'll be whisked off to the clinic, never to be seen again, just like almost everyone else that went to the clinic. In the larger cities, some nitwits are spreading the rumor that Ebola doesn't exist and the government is just trying to steal blood from the patients. So bands of people think that patents bleeding from every orifice needs to be rescued(!).

Let 'em die. We need to purge this sort of stupidity.

Re:Good episode of Frontline

[DigiShaman]

So I finished watching it. I had no idea is was that contagious just from exposure to the skin alone. If this thing becomes airborne, half the human population could be wiped out! Society collapse's from lost industrial specialization, and civil war / revolutions breakout all over the globe.

Re:Good episode of Frontline

[Solandri]

I know Hollywood has brainwashed everyone into thinking it's illegal to distribute any kind of video or music online. But Frontline and PBS are publicly funded It's ok to watch it online.

Re:Good episode of Frontline

[gweihir]

Almost nothing gets through healthy skin. But skin-contact is very hard to avoid when dealing with sick people. That is the whole problem of this thing.

Re:Good episode of Frontline

[Anonymous Coward]

A witchdoctor got ebola. The mourners touch the corpse. Re = 40 new infections.

Ebola is strong juju magic.

Civilization is a choice, make it soon.

Re:Good episode of Frontline

[symbolset]

While there is a certain amount of local ignorance or incapacity of hygiene going on here, that does not mean that areas with different unsafe practices are safe. In the US we have borders porous to immigrants, transparent to smugglers. We shake hands, high five, snort coke of unknown provenance and send our kids to school/go to work sick.

Re:Good episode of Frontline

[symbolset]

Ebola gets through healthy skin. This is one very nasty virus. Five virions on one skin cell is all it takes to be 100% certain the victim will be infected. One virion has a good chance. 90% of the infected die. One cc of blood from a terminal Ebola victim is more than enough virions to infect all mankind.

Re:Good episode of Frontline

[symbolset]

Civilization was us pretending for a while that we were better than we are. We aren't. We are dirty, nasty voracious animals with poor self control.

Re:Good episode of Frontline

[Anonymous Coward]

Liberia has some 4million people and borders are only lines on a map. So how exactly are you going to contain that? Ask 4mil people who are scared to death: "pretty please stay where you are and dont run all over the world"? Sure that will work.

Re:Good episode of Frontline

[Anonymous Coward]

Exposure to a handful of virons has been observed to infect cells when the virons were released into the intercellular matrix - We may safely assume it will take more than five nanites to get through the thick, dry layer of dead cells we call skin. Only a few Ebola outbreaks have fatality rates of 90+%. Despite being of that dreaded Zaire lineage genetically, this one has a CFR of more like 50%.

This thing is scary enough (I'll tell you, I was scared the first time I saw the log-plot was a straight line) without any addition FUD.

Re:Good episode of Frontline

[Anonymous Coward]

Ebola Outbreak (27:26) FRONTLINE reports from inside the deadliest Ebola outbreak on record.
We're sorry, but this video is not available in your region due to right restrictions.

Yay me.

Re:Good episode of Frontline

[Eunuchswear]

Liberia has some 4million people and borders are only lines on a map.

Both true, but -

Everybody in Africa knows that running into the forest is how you die - there is nothing to eat there.

People leave their villages when forced out at gunpoint or in face of serious problems like drought. Not a tiny problem like disease, which is omnipresent.

Re:Good episode of Frontline

[Eunuchswear]

90% of the infected die.

For values of 90 that are less than or equal to 50.

Re:Good episode of Frontline

[Eunuchswear]

While there is a certain amount of local ignorance or incapacity of hygiene going on here

By "here" you mean slashdot, right?

Because I've read a shitload of stuff in this discussion that makes the average inhabitant of Monrovia look like a qualified virologist.

Re:Good episode of Frontline

[Enry]

It varies by strain and number of people infected. Some outbreaks get to 90%, this one is closer to 60%.

Re:Good episode of Frontline

[Anonymous Coward]

> Five virions on one skin cell is all it takes to be 100% certain the victim will be infected.

Read that sentence a few times and think about if you really actually buy that (un-cited, of course) probability number. Ebola isn't a magical curse.

Re:Good episode of Frontline

[Anonymous Coward]

Ebola isn't a magical curse.

Well, I'm going treat it like one and stay as far as fuck away from anyplace or anyone that may have Ebola. It's a safer that way.

quick everyone board the escape craft

[ozduo]

Then nuke earth from outer space!

improper terminology

[Anonymous Coward]

It's not a battle. We are going to degrade and ultimately destroy Ebola.

Easy to contain

[Anonymous Coward]

Actually it would be pretty easy to contain, for the most part. Embargo completely those countries were it is currently at. No one in, no one out. Okay, fine if some doctors want to go in and try to help, fine, but if they catch it they stay there and die. No more of this "oh, this poor western doctor went in to help, and caught it; let's fly him back here where there isn't any ebola and see if we can help him" shit.

When people trapped inside do try to get out, kill them. Shoot down planes going out. Bomb migrating car convoys headed for the border. When the poor little children come up to the barricades to plead for food, shoot them.

See? Simple. But we don't have the balls to do what needs doing. Someone might fucking feel bad about it, after all, and it's better that all humanity die than someone anywhere fucking feel bad.

Re:Easy to contain

[Anne Thwacks]

You have obviously never been to west africa. People there can and do ignore the governments, which are mostly irrelevant to every day life on a scale American libertines and European anarchists cannot imagine. The whole concept of "they should do X" is laughable. There is no one who can or will do "X". Life is not like that.

Re:Easy to contain

[BarbaraHudson]

Kodos, is that you?

Re:Easy to contain

[Anonymous Coward]

He's not talking about African governments.
He's telling Europe, America and Asia to shut the borders before it spreads.
Also:
I love you Ebola chan.

Re:Easy to contain

[Rich0]

Did you read the post you replied to. He wasn't suggesting anything that required anybody to comply with government orders. He basically advocated putting a big wall around the infection zones and mowing down anybody who tried to climb over.

Completely sidestepping the huge moral issues, I'm not convinced that could actually be done at a national level. At least, not for countries in Africa - there is just way too much area to try to patrol. You really need geographic barriers if you're going to do something like that for anything bigger than a city (and even a city would require a HUGE force/effort to lock down). If all the infection areas are surrounded by some natural barrier then you could make that your line of defense - people can't easily cross open deserts/etc without vehicles and those could be easily detected and destroyed from the air. Anybody who manages to make it through could probably be spotted for days in advance. Africa itself would be able to be geographically isolated if you cut off all air and shipping to the continent.

I don't see any of this happening, however.

Re:Easy to contain

[reboot246]

At least you got the part about not bringing infected people back here correct. It's a mistake to do that. We will eventually have someone in this country who is infected with a mutated virus that spreads more easily than the current strain.

Re:Easy to contain

[X0563511]

That's the fun part about so many infections...

The more people with the virus, the more chances for mutations per given unit of time. The more chances for mutations, the higher the chance of a nasty mutation arising.

Re:Easy to contain

[Eunuchswear]

Embargo completely those countries were it is currently at. No one in, no one out.

A couple of weeks ago that would have included the US, the UK and Spain.

Blood immunity

[MrKaos]

Some people exposed to this disease will survive and develop an immunity.

Shouldn't we be developing vaccines based on human beings who have survived and develop that? The human condition itself is a remarkable platform for self preservation and we have science as a tool. Thinking this is not our problem or that it is a challenge of a particular country seems to be a great way to spead this disease.

Ebola is a human challenge, shouldn't we treat it that way?

Re: Blood immunity

[Anonymous Coward]

To bad no one in medical community has thought of something like that...

Of course folks are working on vaccinations and treatments for this, double so now that we are facing larger and larger out breaks in recent year... The reality is it isn't easy, hard to test, and can be difficult to manufacture at scale. ...it will be solved just not in the time frames currently needed by those in affected areas.

quarentine

[argontechnologies]

They must begin an exit quarantine of 30 days to prevent the spread. Taking someones temp at an airport will only find those already infected and showing symptoms. Ebola, has a 30 day incubation period.

Ebola, UN Super Weapon

[Anonymous Coward]

Ebola is the UN Super weapon of choice to kill humans and rid the planet of the Anthropocene Eon.

Quarantine with extreme prejudice

[Anonymous Coward]

Crater the airfields. Mine the harbors.
Snipers sans frontieres, At the borders.
Nothing leaves.

The cure for overpopulation is ebola.
The cure for ebola is napalm.

Civilization is a choice. Make it soon.

Re:quarantine

[Anonymous Coward]

The west must crater african airfields and mine its harbors and coasts so that nothing can leave. Isolation is the only thing that used to work (when Ebola was rural), it is still the only solution.

cggacacacaaaaagaaagaagaatttttaggatcttttgtgtgcgaataactatgaggaagattaata

not sure that we want it controlled

[WindBourne]

The truth is, that whenever the world has mass die offs due to nature, we do not get wars.
Right now, we have massive numbers of small wars popping up. This has gotten old. In addition, it could lead to a real war with nukes.

But, if the world takes a massive loss of life due to say Ebola going airborne, it would lower the likelihood of a nuke war.

Re:not sure that we want it controlled

[zippthorne]

The problem with a nuke war is the huge number of people who would suffer and die as a result of it, so I fail to see how the same number of people suffering or dying in a "natural die-off" would be any kind of improvement.

Re:not sure that we want it controlled

[32771]

I suspect this is a psychological problem, people probably can accept death through an act of god easier than through human action. The number of people suffering is probably not important to anyone else than politicians. Assuming that you can know around 150 people the number of dead in either case exceeds what you can grasp.

The difference between the two cases is that diseases affect poor nations that don't compete for resources as much. I would guess that Ebola spreading won't prevent resource wars because it doesn't affect the interested parties.

Re: not sure that we want it controlled

[WindBourne]

Assume Ebola goes airborne and hits all. Once it is through the population, it is done. OTOH, radiation is an environmental issue that would continue for centuries. Biological death is far better than nukes.

Always something new

[Tenebrousedge]

ex africa semper aliquid novi

"Always from Africa comes something new." Pliny.

Que haya no navedad

"May no new thing arise." Traditional Spanish benediction.

Ebola Spreading: Slums connected by Travel

[fraber]

Reading the last publications about the spreading of Ebola, I've got the idea that WHO tries to hide information, in particular about the different types of spreading. So I'm making this up from common sense, maybe somebody with access to privileged information might add details:

Spreading in slums: That seems to be the case in Monrovia ultimately. Inhabitants don't trust the public health system (with certain reason...) and believe in which doctors or conspiracy theories. Once >500 persons are infected, it becomes practically impossible to research the infection tree and to isolate contacts. In the last 3 weeks Ebola spread exponentially. Please tell me if I'm wrong, but I got the impression that Monrovia is probably "lost".

Spreading across the "pepper coast" via land connections: The area from Guinea to Ghana seems to be relatively sparsely populated with exception of a few cities. And these cities are now basically disconnected from international air traffic. Part of the borders are closed. The villagers along the land connections will become increasingly suspicious of travelers from the cities, so I would predict increasingly violent confrontations. Maybe this might lead to slower spreading (apart from disastrous consequences for the economy, obviously).

Spreading to Nigeria: Nigeria has 170M population, as opposed to 4M for Liberia, and Nigeria is well connected internationally. The recent cases seem to have been contained and tertiary and quartiary contacts have been followed-up. So apparently things work out better in Nigeria compared to Liberia.

So my understanding is: A Pandemic will start once Ebola reaches the slums of Nigeria and starts spreading to more cases than the MSF or others can contain (maybe some 200-500 cases). The pandemic will end once a vaccine becomes available in large quantities, which is supposed to happen in 3-9 months.

Re: Ebola Spreading: Slums connected by Travel

[Anonymous Coward]

I pray you are right, and that it stops with a vaccine.
Any hope of containment was lost several weeks ago.

Re: Ebola Spreading: Slums connected by Travel

[Eunuchswear]

Spreading across the "pepper coast" via land connections: The area from Guinea to Ghana seems to be relatively sparsely populated with exception of a few cities.

You somehow missed the Ivory Coast, population 20 million? Not all urban, the biggest city, Abidjan has a population of 4.5 million.

And these cities are now basically disconnected from international air traffic.

Monrovia currently has flights to Brussels and Casablanca.

Conacry has flights to Paris and Casablanca.

Freetown has flights to Brussels and Casablanca.

So, not quite disconnected.

Correction: CIA predicts long battle against ebola

[Anonymous Coward]

Correction: CIA predicts long battle against ebola

Are you really a transtesticle?

[Anonymous Coward]

I read you are here http://slashdot.org/comments.p... and seeing you keep a TomHudson sockpuppet account http://slashdot.org/~tomhudson... and this other of your many sockpuppets on slashdot too http://slashdot.org/~Barbara%2... also makes me believe you may be. Are you?

Silver kills microbes and ebola

[TheRealLifeboy]

Hmmm... and why are they not using their own research and solution?

A PDF of Janice Speshock and Saber Hussain's research at the US Air Force National Laboratory.

Before some anonymous coward yells some shill-inspired-drivel about the dangers of silver.... the US Defense Threat Reduction Agency (DTRA is part of the Department of Defense, created in 1999) confirmed the authenticity of this research.

So, will "medical science" aka big pharma and their marketing arm, the FDA, "allow" this potential cure, or will they just let thousands die, because "we have not cure" and won't have for a long time? There are too many african anyway, aren't there? is what they seem to be saying by their actions.