Slashdot Mirror


User: displaytest

displaytest's activity in the archive.

Stories
0
Comments
62
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 62

  1. Re:From a headhunter... on Steve Jobs==Noah Wyle at Mac World · · Score: 1

    You must not know a lot of investment bankers, then. A lousy bonus (say $300K when they expect $500K) is the first thing that sends them out the door. And a 60 hour work week is pretty light for most bankers...

  2. iBook durability on New PowerBook G3 & the iBook · · Score: 1

    I held one for a little bit- it seemed relatively strong. The rubberized bits around the edges will definitely help with the overall wear and tear and may cushion the blow if it lands on its end. It seemed heavy enough that it could take some abuse, and the lack of a latch means one less thing to break, although I don't know how long the clamshell hatch will last necessarily. I guess I'm skeptical of any laptop's proclaimed durability, but this one did seem to be a little heavier and better protected than most- weight saving was obviously not the primary concern!

    You know, I wanted to make the first post to Slashdot from an iBook, but my boss held on to the damn thing so long I had to pass it along before I could load anything on the web browser.

  3. Re:How will this affect the parties in power? on Voting over the net? · · Score: 1

    Unfortunately for you, it's the right to vote.

    Let's check in with our friend, the 15th amendment:

    Article XV.
    Section 1. The right of citizens of the United States to vote shall not be denied or abridged by the United States or by any State on account of race, color, or previous condition of servitude.

    I don't see anything about "privelege" in there.

  4. jesus I suck on DNA Encryption · · Score: 1

    can't seem to learn the difference between submit and preview, can I?

    I'm assuming my inadequate HTML knowledge is screwing up my arrows, so I can't draw the positions correctly.
    That Gene B thing should be over to the right, with an arrow pointing to the left.

  5. correction of above post on DNA Encryption · · Score: 1

    that last bit didn't come out quite right- that'll teach me to preview!

    --Gene B
    3'TGACTAGTACGTCATGAAGTCAGAGGGTC5'
    5'ACTGATCATGCAGTACTTCAGTCTCCCAG3'
    Gene A-->

  6. Re:Scary on DNA Encryption · · Score: 1

    There is actually quite a lot of "unused space" in the human genome. The actual percentage of DNA triplets that code for amino acids in proteins is relatively small (don't recall quite how small) because lots of big strings of DNA actually get excised during RNA processing. Other big stretches of DNA are used as receptors for proteins that determine when the gene is expressed and things like that- other times, long sequences are used for structural changes in the DNA. What's more, there are also long long strings of pure "junk" DNA that's the equivalent of ABABABABABABABABABAB etc., with no apparent purpose.

    So actually, there's quite a lot of unused space. The kicker is, there's not a limit on how big the genome can be. As long as the cellular machinery can handle it, there's no reason that you couldn't just insert sequences of however long you want into the DNA in the bits that get excised out or in stretches of junk DNA. For a change in DNA to affect the organism, you need a lot of other supporting DNA to ensure that the gene gets turned on- otherwise, it's just like a big string of garbage characters in a book- you just skip over it, it doesn't make reading the book any different.

    Now, what's interesting is how compact viral DNA is. Viral DNA is so efficient (since so much information has to be packed into a tiny space) both "sides" of the DNA can be read to produce separate proteins. Normally, only one strand, the coding strand of DNA can be read- the non coding strand actually functions as kind of a check for errors. Viruses dont' care that much about accuracy, I guess... Here's what it looks like:

    --Gene B
    3'TGACTAGTACGTCATGAAGTCAGAGGGTC5'
    5'ACTGATCATGCAGTACTTCAGTCTCCCAG3'
    Gene A-->

    Fascinating, huh?

  7. Re:Interesting. What defines 'honor'? on Responsibility in OS Design · · Score: 2

    And there's probably a lot less honor in using exclusionary pricing practices to force competitors out of the market.

  8. Re:BK.. on Burger King to offer Internet Access · · Score: 1

    Because he's made so many bad posts that have been "legitimately" marked down that he now posts at a default level of zero, as Rob explained when he set up the moderation system. There was a brief period when the system was initially set up when people automatically posted at 2 and 3, because the thresholds for auto-moderation were set very low. As far as I can tell, he's currently the only registered user to post at a default level other than 1.

    I'd like to killfile him, since I think there's a lot of other good stuff at -1 due to ignorant moderators.

  9. Re:Is Compaq giving up? - Wait a minute on Compaq Cutting... Alpha? · · Score: 1

    What the hell made someone moderate down this article. The guy's absolutely right. I also really wish Cmdrtaco would read the freakin' article before he posts an alarmist headline like this. I respect his coding skillz and all, but I've begun to question his reading comprehension, or if he's not reading the linked articles, his attention span. Open-source news only works when people review the submissions.

  10. Satirical story on Grafitti Causes Paralysis? · · Score: 2

    I really hope Taco wasn't taking that at face value (viz. "from the that-ain't-so-hot dept.").

  11. Relevant piece from The Onion on The Price of Being Different · · Score: 1
  12. Sobering reminder on Geeks in Rolling Stone · · Score: 1

    I really liked this quote from the website:

    "Treason to whiteness has become a battle cry of devotion to humankind."