If your using your tech devices whilst in a sunny tanning situation, wouldn't it make more sense to have a solar charging unit handy and run all day without even needing a refill?
Let the alcohol refresh you without wasting it on your laptop.
Well, since it was the first thing that came up when I searched google for DNA Chromosome code I thought it would do for a bit of a laugh, but its certainly not OT.
From the Nokia 770 site: The Nokia 770 Internet Tablet's software is upgradeable and currently runs on the Linux-based Internet Tablet 2005 software edition. There is a planned launch next year of an operating system upgrade - the Internet Tablet 2006 software edition - that will support additional services, including Internet telephony (VoIP) and Instant Messaging.
As for your second question, I would think that a "normal" user couldn't do it, but since as you point out the protocol is open, its down to whatever can be built for it.
I would imagine that the gTalk port won't need lots of private code, but to be sure find Chris DiBona and have a word.
The CRT tube is tuned to negate the magnetic influence in the hemisphere its designed for. If you take a Northern tube and go to Australia with it (or vice versa), the screen may need correction.
I sent a mail to CowboyNeal about this but as of yet haven't had any response, it would be good if we could select a couple of journals to track as slashboxes.
I have currently been finding out about updates to Taco's journal from digg and not from here as I would prefer.
I didn't mean to be so brash, but it felt like in light of the US data retention we are discussing, to say "well in the UK we only keep 6 months worth" seemed a bit like "nerrr nerr we only got 6 months". I'm sorry that I took your comments the wrong way.
And I have thought about capturing criminals before they commit a major offense, of course I'm not talking about going minority reportish and considering future crime.
Like in the case of MI5 knowing at least 2 of the London bombers before hand.
Following up on leads and determining that these guys were heading together as a group into London could have possibly prevented the attacks by monitoring and capturing them red handed with bombs and bomb making equipment rather than waiting until afterwards.
Its not everyday the government asks us to do dangerous things outside our work time especially doing things with hydrogen. I wonder if the other departments have been notified of this homework assignment?
Splitting the atom at work is fun, getting to take work home is just a bonus.
o what happens if I decide to ship my entire DVD collection (legally purchased) to another family member or someone who has purchased it wholesale, or am donating it to a charity or something? Its not just going to be illegal DVDs.
The biggest question is are they going after the sender or the recipient?
Hopefully they will go after the recipient, and I'll post thousands off to Tony Blair or something.
There is nothing this room can do that a decent set of VR goggles can achieve. The goggles would also have the benefit of being runnable on relatively standand class hardware.
I mean, this thing has to produce a spherical projection for every single point in the viewers space, its got to be crunching far too much data.
I personally don't see the benefits of this virtual magic carpet ride for the outlay required.
Actually, digg posts about Taco hit more than you would think. This recent redesign competion has caused his journal to be dugg quite heavily where we haven't heard anything about it here.
An additional thing your brain is good at doing is remembering the location of objects whilst you move. I'm guessing you find it easier to play darts after familiarising yourself by just moving your head around slightly? it may be subconcious now (and even be part of your normal routine as your walking to the podium) but it should be there.
Its like the flicker images we have seen around (like these) There is enough information in these images for your brain (and mine) to reconstruct the scene and get depth perception.
Stand in line for 90 minutes waiting for your ticket to be validated. Then when you get into the theatre just as the action hots up random people are ejected forcefully and then forced to stand back in line outside.
Of course they want it to be big, they always do. Its not like it will be the first movie to hit the spot. They are standing on the shoulders of such greats as Street Fighter, Tomb Raider, Pokemon and Doom..
Slashdot Mirror
If your using your tech devices whilst in a sunny tanning situation, wouldn't it make more sense to have a solar charging unit handy and run all day without even needing a refill?
Let the alcohol refresh you without wasting it on your laptop.
Well, since it was the first thing that came up when I searched google for DNA Chromosome code
I thought it would do for a bit of a laugh, but its certainly not OT.
(thought I know these comments are...)
Can somebody tell me how the fuck my comment is offtopic?
I linked to a site with the First 1000 lines of Chromosome 1.
Open source and all that.
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
Tape is a 3 dimensional object.
You need to know how deep the track surface has to be to store that amount of data.
Its no use holding 10 googals of data per square inch if the track has to be 100 miles deep.
If you know of one pissed up yob who would refrain from fighting just because of a camera up on a mast then please do tell me.
The biggest deterant has been big doormen and LOTS of visible police.
Regarding question 1,
From the Nokia 770 site:
The Nokia 770 Internet Tablet's software is upgradeable and currently runs on the Linux-based Internet Tablet 2005 software edition. There is a planned launch next year of an operating system upgrade - the Internet Tablet 2006 software edition - that will support additional services, including Internet telephony (VoIP) and Instant Messaging.
As for your second question, I would think that a "normal" user couldn't do it, but since as you point out the protocol is open, its down to whatever can be built for it.
I would imagine that the gTalk port won't need lots of private code, but to be sure find Chris DiBona and have a word.
The CRT tube is tuned to negate the magnetic influence in the hemisphere its designed for.
If you take a Northern tube and go to Australia with it (or vice versa), the screen may need correction.
See here for more info
Birds in the southern hemisphere already fly north for the winter.
That should tell you more than anything about birds:
They prefer to be warm and they don't give a damn about the magnetic pole.
(actually, you would probably confuse some birds, but its the warmth they are seeking, not a compass bearing)
On slashdot, the standard reply should be....
I gave up my cellphone because my mom found it easier to shout down to the basement to tell me dinner was ready.
I thought that was just as silly as well.
Heres a link for the curious.
Bonus, Thanks.
looks like we are all learning something about slash tonight.
I sent a mail to CowboyNeal about this but as of yet haven't had any response, it would be good if we could select a couple of journals to track as slashboxes.
I have currently been finding out about updates to Taco's journal from digg and not from here as I would prefer.
Yes there is.
Goto your preferences and Homepage tab.
Its the first entry on there:
Current Date/Time
Using saved preferences
17:41 11th May, 2006
Date/Time Format
[ComboBox allowing format]
Unfortunately this only works when you are logged in.
I didn't mean to be so brash, but it felt like in light of the US data retention we are discussing, to say "well in the UK we only keep 6 months worth" seemed a bit like "nerrr nerr we only got 6 months". I'm sorry that I took your comments the wrong way.
And I have thought about capturing criminals before they commit a major offense, of course I'm not talking about going minority reportish and considering future crime.
Like in the case of MI5 knowing at least 2 of the London bombers before hand.
Following up on leads and determining that these guys were heading together as a group into London could have possibly prevented the attacks by monitoring and capturing them red handed with bombs and bomb making equipment rather than waiting until afterwards.
Time, Duration, Source (Carrier,Number,GPS,Address,Type{Cell/POTS/VOIP}), Destination (Carrier,Number,GPS,Address,Type{Cell/POTS/VOIP}), Routing path, Billing Rate(s), Call Plan.
Thats what I can think of on the top of my head and I'm not in the telecomms business.
Theres plenty of information that will be stored per call.
You sound almost happy about that.
Too much data retention and not enough police work up front.
I would prefer they caught the criminals before an action occurs than picking up the pieces afterwards.
Its not everyday the government asks us to do dangerous things outside our work time especially doing things with hydrogen. I wonder if the other departments have been notified of this homework assignment?
Splitting the atom at work is fun, getting to take work home is just a bonus.
Now, where's my chisel?
o what happens if I decide to ship my entire DVD collection (legally purchased) to another family member or someone who has purchased it wholesale, or am donating it to a charity or something?
Its not just going to be illegal DVDs.
The biggest question is are they going after the sender or the recipient?
Hopefully they will go after the recipient, and I'll post thousands off to Tony Blair or something.
Use an old wax seal on an internal envelope.
Sometimes history gives us the most important lessons.
There is nothing this room can do that a decent set of VR goggles can achieve.
The goggles would also have the benefit of being runnable on relatively standand class hardware.
I mean, this thing has to produce a spherical projection for every single point in the viewers space, its got to be crunching far too much data.
I personally don't see the benefits of this virtual magic carpet ride for the outlay required.
Actually, digg posts about Taco hit more than you would think.
This recent redesign competion has caused his journal to be dugg quite heavily where we haven't heard anything about it here.
My apologies.
I was originally going to link to just a single one (without people) but then thought the mini galary would be better.
An additional thing your brain is good at doing is remembering the location of objects whilst you move.
I'm guessing you find it easier to play darts after familiarising yourself by just moving your head around slightly?
it may be subconcious now (and even be part of your normal routine as your walking to the podium) but it should be there.
Its like the flicker images we have seen around (like these)
There is enough information in these images for your brain (and mine) to reconstruct the scene and get depth perception.
Stand in line for 90 minutes waiting for your ticket to be validated.
Then when you get into the theatre just as the action hots up random people are ejected forcefully and then forced to stand back in line outside.
Of course they want it to be big, they always do. Its not like it will be the first movie to hit the spot.
They are standing on the shoulders of such greats as Street Fighter, Tomb Raider, Pokemon and Doom..