Well, it sounds nice, but i dont think its going to get far ahead as all the stuff they are doing has been done before
When they released the iPod there were already lots of MP3 players on the market, but that didn't seem to prevent them from making a success of it. There are lots of style-conscious people out there who will pay a premium for a cell phone with an Apple logo on it regardless of whether it has cutting edge technology or not.
BTW there are quite a few natural monopolies like gas, water, telco, cable, etc. Which usually don't get broken up until they start really abusing their customers. (I'm waiting for Rogers to get a bitch slap...)
True, but natural monopolies (like the utilities you mention) are normally regulated by the government (some like water are usually run by the government). These regulations are supposed to provide the restrictions that competition would provide in a non-monopoly situation.
BTW, Rogers got slapped in 1995 for it's negative option packaging of new cable channels. If the abuse of monopoly is obvious and enough people complain, the government will eventually act.
No matter how much RAM you have, Windows still seems to need a swap file that is constantly being written to (not to mention all the writing to the registry). Given that current flash technologies have a limited number erase/write cycles, I hope the flash-based hard-drive is replaceable (CF card maybe?).
In 30 years of buying Lego (first for myself and now for my son), I'm impressed that I only once bought a set (last year) that had a single missing piece. I called the 1-800 number on the box and the agent talked me through a long but obviously well documented process to determine exactly which part was missing. The part arrived in a couple of days and my son's T-Rex had it's tail joint. If only all companies had that kind of customer service.
As a kid, I had a Radio Shack Battery Club card that entitled me to one free battery a month. Of course, it was a useless carbon battery, but it kept my flashlight going.
I'm sure some brave Indian solders contributed to the winning of WWII but it's hardly equivalent. In 1812, most of the regular British army and navy had pulled out of British North America (i.e. pre-independent Canada) to fight the French in Europe. That's why the Americans thought the time was right to exercise their "manifest destiny" and expand northward (don't buy into the American history book cause for the war, that the British navy was shanghaiing American sailors; that's the 19th century equivalent of "we're invading Iraq because Sadam has WMDs"). The defense of Canada was left to mostly the civilian militia and their Native allies. Despite being outmanned and outgunned, they repelled the invasion and kicked some ass. Burning D.C. was not nearly as embarrassing as Detroit which was surrendered to a smaller force without firing a shot.
sure they would be born - they would just be born healthy now.
No, their parents would have had healthy babies, but they wouldn't have grown up to be the people in question. For all we know, their genius may have been linked to their disabilities, either directly or indirectly. It's not a coincidence that most "nerds" wear glasses and most "jocks" don't.
Perhaps I should leave you with an example, one that even a Christian might be able to tolerate. Imagine a future where you and your s/o collect your eggs and screen them for genetic defects, like Down Syndrome. Once a viable egg has been found (and you don't have to look up what the hair color or eye color will be, you could just leave that to fate), start screening some sperm. Produce a viable fetus which will grow up to be healthy.
Now imagine that you were one of those people who didn't do that for your kid. And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.
So in your perfect world, Stephen Hawking (ALS), Issac Newton (Epilepsy) and Albert Einstien (Aspergers Syndrome) would never be born? Do you believe genetically "flawed" individuals have nothing to contribute to society?
I would say that the "paper trail" addresses a media/news issue rather than a technical one.
This demand for paper backup is an odd hope that 100 year old cash register technology is the best.
Microsoft has not updated IE for years (other than security fixes). If that's their idea of a high-priority update, how long would a low-priority update take? (still waiting for Y2K support in Microsoft BOB)
Okay, but I'm fairly sure they're not paying $.02 per email. The principle that would make this work is that there is a proportional cost for sending emails. That's when it stops making economic sense.
But the spammers could easily adapt to such a system (even assuming it could be successfully and securely implemented, which it can't). Spammers currently send spam to every email address they can get there hands on. They don't care if it is unused or invalid since there's no cost involved. If they were charged $0.02 per email, they would have to get smarter about their lists, using only known active addresses and maybe linking in demographic data (eg. only send v1agra ads to males over 50). Rather than eliminating spam, the email tax would likely just force spammers to be more efficent and possibly even more effective than they are now (at least on par with snailmail "direct marketing" businesses who seem to have no problem dealing with a per-mail cost that is much higher than $0.02).
Since I wrote software that stopped working after SP2, I (or rather, my company) paid quite a bit for SP2. Valuable time spent rewriting software that was working fine. Support time spent with customers complaining that the software stopped working. The expense of sending out updates to customers. I don't have a dollar figure, but it is significantly higher than 'free'.
How do they check it you got it right?
on
The Next X Prize
·
· Score: 1
The current technology took over 10 years to decode one human gene set. At that rate, it would take over 1000 years to check the results for 100 people. I'm not willing to wait that long to collect my prize. And if they're not checking the results then here's my submission:
What they dropped was the A9 Instant Reward, the A9 Toolbar, the A9 Yellow Pages, the A9 Maps (including Block View), the user diary, bookmarks, and history.
It's a shame to lose A9 maps, the block view was a very useful feature. Google Map's integration of satellite photos is impressive but lets face it, most of us view the world from the ground not the from the sky, so the block view is helpful for seeing what your destination looks like. Unfortunately, they only got around to photographing the downtown core of a handful of major US cities.
To some extent it is also possible to measure even longer trends of several millions years using a few methods which have varying degrees (haha) of accuracy. Studying the geological effects on rock (i.e. calculating sea level height by erosion caused on rocks which were on the surface at a known point in time) is one of the most common.
I would think that plate tectonics would really disrupt any attempt to determine global sea level this way. We find aquatic fossils on mountain tops not because the sea level used to be higher than the mountain, but because the sea floor got pushed up to form the mountain.
A new attack vector! OpenOffice should not have plug-ins. Why copy Microsoft's mistakes.
There are a few things they can do to make sure OOo plug-ins don't turn into MS Office VisualBasicScript-type attacks.
1. Make it impossible to embed a plug-in into a document. Even if a document requires a certain plug-in, embedding it for quick installation (or even worse, auto-installing it) would be a very bad thing. The most it should do is pop-up a message reporting what plug-in is missing and link to the trusted site where it can be downloaded (see below).
2. Make it so plug-ins must be signed and/or can only be downloaded from trusted sites (at least by default). Firefox works this way now (sort-of), but it's a little too easy to turn it off.
3. Limit what plug-ins can do (read-only file access, write-access only to certain file-types, no internet connections, etc). Unfortunately, this also limits the usefulness of plug-ins. At a minimum, it should prohibit access to system files.
So witnessing racism is equivalent to experiencing it? I don't think so.
.
Umm, witnessing something is an experience so, by definition, yes. Perhaps you meant something else?
What was meant is obvious to anyone not using sophistry to prop up a weak argument.
Apparently it did not manage to teach you too much. In any case, whether or not it is the best book to teach a particular lesson is avery different question than whether it is appropriate to force that opinion on teachers, libraries, and young readers by banning it.
It is indeed a very different question, but it was in fact the question being discussed (try to keep up). Putting a book on a school curriculum IS choosing it to teach a particular lesson and removing it is NOT preventing anyone from reading it if they so desire.
I bet theres lots of black authors today that have experinced less racisim first hand than Harper Lee did. In the old days people could be very rasist in puplic so even if you weren't the race being effected you could still witness the hardships. And racisim was much harsher in America back then.
So witnessing racism is equivalent to experiencing it? I don't think so. As for racism being harsher back then (or at least more visible), that's part of the problem. We (whites) pull out a half-century old book like Mockingbird, so we can pat ourselves on the back for how far we've come and how enlightened we are compared to our grandparents. That does nothing to address current issues and instead makes it seem like we've already solved the problem of racism. I'm not denying that Mockingbird is a classic piece of literature, only that in terms of addressing social issues (as all great art should), it's time has passed.
Slashdot Mirror
When they released the iPod there were already lots of MP3 players on the market, but that didn't seem to prevent them from making a success of it. There are lots of style-conscious people out there who will pay a premium for a cell phone with an Apple logo on it regardless of whether it has cutting edge technology or not.
True, but natural monopolies (like the utilities you mention) are normally regulated by the government (some like water are usually run by the government). These regulations are supposed to provide the restrictions that competition would provide in a non-monopoly situation.
BTW, Rogers got slapped in 1995 for it's negative option packaging of new cable channels. If the abuse of monopoly is obvious and enough people complain, the government will eventually act.
No matter how much RAM you have, Windows still seems to need a swap file that is constantly being written to (not to mention all the writing to the registry). Given that current flash technologies have a limited number erase/write cycles, I hope the flash-based hard-drive is replaceable (CF card maybe?).
In 30 years of buying Lego (first for myself and now for my son), I'm impressed that I only once bought a set (last year) that had a single missing piece. I called the 1-800 number on the box and the agent talked me through a long but obviously well documented process to determine exactly which part was missing. The part arrived in a couple of days and my son's T-Rex had it's tail joint. If only all companies had that kind of customer service.
As a kid, I had a Radio Shack Battery Club card that entitled me to one free battery a month. Of course, it was a useless carbon battery, but it kept my flashlight going.
I'm sure some brave Indian solders contributed to the winning of WWII but it's hardly equivalent. In 1812, most of the regular British army and navy had pulled out of British North America (i.e. pre-independent Canada) to fight the French in Europe. That's why the Americans thought the time was right to exercise their "manifest destiny" and expand northward (don't buy into the American history book cause for the war, that the British navy was shanghaiing American sailors; that's the 19th century equivalent of "we're invading Iraq because Sadam has WMDs"). The defense of Canada was left to mostly the civilian militia and their Native allies. Despite being outmanned and outgunned, they repelled the invasion and kicked some ass. Burning D.C. was not nearly as embarrassing as Detroit which was surrendered to a smaller force without firing a shot.
No, their parents would have had healthy babies, but they wouldn't have grown up to be the people in question. For all we know, their genius may have been linked to their disabilities, either directly or indirectly. It's not a coincidence that most "nerds" wear glasses and most "jocks" don't.
Now imagine that you were one of those people who didn't do that for your kid. And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.
So in your perfect world, Stephen Hawking (ALS), Issac Newton (Epilepsy) and Albert Einstien (Aspergers Syndrome) would never be born? Do you believe genetically "flawed" individuals have nothing to contribute to society?
A bit off-topic, but when it comes to longevity, paper records are hard to beat (with the possible exception of stone tablets). Check out this interesting article :Paper Trail - Can Digital Media Match The Longevity Of Plain Old Print?
What a boom for the phone companies! If you want to register 1-900-SEX-TALK, you'll now have to pay for two different numbers.
Microsoft has not updated IE for years (other than security fixes). If that's their idea of a high-priority update, how long would a low-priority update take? (still waiting for Y2K support in Microsoft BOB)
Your analogy doesn't have enough animals; try this one. The problem is not with the sheep or the dogs, it's the pigs.
But the spammers could easily adapt to such a system (even assuming it could be successfully and securely implemented, which it can't). Spammers currently send spam to every email address they can get there hands on. They don't care if it is unused or invalid since there's no cost involved. If they were charged $0.02 per email, they would have to get smarter about their lists, using only known active addresses and maybe linking in demographic data (eg. only send v1agra ads to males over 50). Rather than eliminating spam, the email tax would likely just force spammers to be more efficent and possibly even more effective than they are now (at least on par with snailmail "direct marketing" businesses who seem to have no problem dealing with a per-mail cost that is much higher than $0.02).
Since I wrote software that stopped working after SP2, I (or rather, my company) paid quite a bit for SP2. Valuable time spent rewriting software that was working fine. Support time spent with customers complaining that the software stopped working. The expense of sending out updates to customers. I don't have a dollar figure, but it is significantly higher than 'free'.
atgactgactagctacacactcgatcatgcatatatttaaaacctactac cttaccttaaatttgggtactgagcgagaagctaactacgactacgcctc tagcatcgatcgtagcccatgctacgatgcatgcatcgatcgatcgatcg atcgatcgatcgatcgatgcactagcgcgcgtattatacggctagatcga tcgtagctagtcgatcgatgctacg
etc. etc. etc. I win!
The dark spot appears to be comprised of thousands of black monoliths that are increasing at a geometric rate and look something like this.
Federal Express, when it absolutely, positively has to be there at 23 times the speed of sound *
* Disclaimer: 23 X speed of sound service available between limited destinations. May be subject to 2000g so please wrap delicate items approprately.
It's a shame to lose A9 maps, the block view was a very useful feature. Google Map's integration of satellite photos is impressive but lets face it, most of us view the world from the ground not the from the sky, so the block view is helpful for seeing what your destination looks like. Unfortunately, they only got around to photographing the downtown core of a handful of major US cities.
So can I get one of these lasers for my car to blind the speed radar cameras?
I would think that plate tectonics would really disrupt any attempt to determine global sea level this way. We find aquatic fossils on mountain tops not because the sea level used to be higher than the mountain, but because the sea floor got pushed up to form the mountain.
You can download on YouTube too, if you know how.
There are a few things they can do to make sure OOo plug-ins don't turn into MS Office VisualBasicScript-type attacks.
1. Make it impossible to embed a plug-in into a document. Even if a document requires a certain plug-in, embedding it for quick installation (or even worse, auto-installing it) would be a very bad thing. The most it should do is pop-up a message reporting what plug-in is missing and link to the trusted site where it can be downloaded (see below).
2. Make it so plug-ins must be signed and/or can only be downloaded from trusted sites (at least by default). Firefox works this way now (sort-of), but it's a little too easy to turn it off.
3. Limit what plug-ins can do (read-only file access, write-access only to certain file-types, no internet connections, etc). Unfortunately, this also limits the usefulness of plug-ins. At a minimum, it should prohibit access to system files.
Electric eel generator, bird beak phonograph needle and dinosaur garbage disposal are already patented by Fred Flintstone.
.
Umm, witnessing something is an experience so, by definition, yes. Perhaps you meant something else?
What was meant is obvious to anyone not using sophistry to prop up a weak argument.
Apparently it did not manage to teach you too much. In any case, whether or not it is the best book to teach a particular lesson is avery different question than whether it is appropriate to force that opinion on teachers, libraries, and young readers by banning it.
It is indeed a very different question, but it was in fact the question being discussed (try to keep up). Putting a book on a school curriculum IS choosing it to teach a particular lesson and removing it is NOT preventing anyone from reading it if they so desire.
So witnessing racism is equivalent to experiencing it? I don't think so. As for racism being harsher back then (or at least more visible), that's part of the problem. We (whites) pull out a half-century old book like Mockingbird, so we can pat ourselves on the back for how far we've come and how enlightened we are compared to our grandparents. That does nothing to address current issues and instead makes it seem like we've already solved the problem of racism. I'm not denying that Mockingbird is a classic piece of literature, only that in terms of addressing social issues (as all great art should), it's time has passed.