Slashdot Mirror
Breakthrough In Human Genetics
Many readers have submitted this story about a breakthrough in our understanding of human DNA: in particular, how much variation can exist between peoples' genes and how genes are involved with certain diseases. "One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically.
They said their new version of the human genetic map, or 'book of life,' fills in many missing pages and chapters to explain how genes are involved in common diseases.
The Human Genome Project mapped the billions of letters that make up the human genetic code. Scientists later refined the map by looking for single variations called SNPs or single nucleotide polymorphisms.
The CNV map gives researchers a different way to look for genes linked to diseases by identifying gains, losses, and alterations in the genome."
One person's genetic code can be 10% different from another's, and chimps are 98% the same as humans.
No wonder so many of you can't spell.
Instead of staying two people have similar car (say Honda Accord), they say your car is totally different from mine - mine has white seats while yours have black seats...
Looking at the writeup from Nature. They clearly state that these results point to maybe a 0.5% difference among individuals, or 99.5% identical. That's 20X less variation than this crap article would have you believe. The actual research deals with CNV's = copy number variants. So for a given stretch of DNA, different people in a population might have that region duplicated or triplicated which does not really allow them to make anything different, but it might alter the levels of expression of those genes. As this DNA is found in multiple copies it had largely been believed to have a low number of genes, as is the case of most highly repeated DNA, but the researchers have evidence that these repeated domains do contain a large number of unique genes. In a short summary/analogy:
Some people are 8 feet tall.
Some people are 4 feet tall.
Therefore, people vary in height by 200%.
It's obvious to see the failed logic in that case, that's the same thing here, just because 10% might potentially be variable, that doesn't mean any single person even exists at each extreme.
i remember reading that humans and chimps are 98% the same
and previous to this announcement, all people were 99.9% the same
the implication here is that people are actually as low as 99% the same
which means one crazy ass inference:
it should be possible to find two people and a chimp such that and person A is equally different from the chimpanzee as he is from the person B
no way
intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
No, no, no, no, no... this is all just a misunderstanding of scientifical facts. You see, it's only the darker folks, whom we are 10% different from, that are 2% different from monkeys. The world was made this way intentionally, presumably by some Great, Omnipotent Designer... whatever you want to call him. I know this to be true because I learned it in a museum. In Kentucky. It was right next to the exhibit with humans and dinosaurs living together.
Honestly folks, get it together already.
If there is so much variation between humans, how does this impact future genetic therapies? Wouldn't we need to map each person's genome, then study the impact of disease on each of the genes, to understand what gene therapies would work best for an individual? This article seems to suggest that the everyday "We've found the gene that causes " claims are only true for a subset of the population.
Crack - Free with every butt and set of boobs
"One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically." It doesn't call it into question at all. The simple matter is that how you define "different" and measure the percentages makes a big difference. The human genome is ~3 billion base pairs. You can have a singe nucleotide change in a gene of say 5000 base pairs. When you compare a given gene between individuals, do you count the whole gene as being entirely different? Or do you say that it is 99.98% (4999/5000) the same?
All that without stem cells?!
shocker.
Actually, using this metric, we would be even further away from chimps.
The old 98% metric (human to chimps) is based on the same old 99.9% metric... both of which were based on drafts lacking these regions.
If you included these repetitive elements, then we become even more genetically distant from chimps.
Decreasing the (human is % chimp) value will greatly please the red state creationists, most of which have a extra chromosome anyway, making them even more genetically distant from chimps by this measure.
Not trying to be mean. Christian fundementists are cute.... clutching thier big gulps to their ample folds, furrowing their brows in a pitiful attempt to understand.
It is always interesting to see how they ignore gene expression, the role of the extracellular matrix (where much of it happens), the importance of mechanotransduction (tensegrity, see Ingber) and thus posture (as a way to cope with gravity as a constant stimulus) when it comes to causes for deseases.
Well, salesdroids of the pharmaceutical industry, IMHO.
CC.
TaijiQuan (Huang, 5 loosenings)
haha from the simpsons. todd flanders - "daddy when was i a monkey"
If you mod me down, I will become more powerful than you can imagine....
Dude, I have no idea what you are bitching about. 1. Gene expression is one of the most active areas of research, pharmacagenomics is actively being researched. Have you even heard of Gleevec? Cures people with a specific mutation? 2. It is WAY easier/cheaper/more standard to measure gene expression than to sequence them. 3. How tensegrity plays into signal transduction / gene expression is still unknown. 4. The ECM is an active area of research and drug targets for cancerand clotting. ....And if you say tenesgrity, or porosity again, I shall be forced to apply sufficent pressure to your crainial area as to force it to rupture.
Soft matter people..... just want to bitch.
So how is parent Offtopic?
Chimps@Work
That DNA evidence was WRONG. I told you I was INNOCENT!!
Does anyone know what stance our major religions have on DNA? For example, how should a true Christian receive this news?
I know it's not entirely on topic, but seeing that the bible describes humans as flesh and blood and as one, it would be interesting to see what this up-to-ten-percent-difference would put science against religious belief.
Full Tilt
My brother is explained...
"Everyone on the earth is unique, ..."
except this one guy
Physics is like sex: sure, it may give some practical results, but that's not why we do it.
When Answers in Genesis can actually directly answer the fact that humans and other great apes share a vast number of retroviral insertions, then we can talk. Until then, they're just a pack of liars.
The world's burning. Moped Jesus spotted on I50. Details at 11.
That 10% is way off. There is on average a variable base (across all people) every 300 bases. So by my calculations, people are at least 1 - 1/300 = 99.7% similar. Not everyone can be different everywhere so that gets us back in the 99.9% territory. The copy number variation map has not changed those numbers that much...
:(){
1 million monkeys randomly typing typewriters = 1 shakespeare manuscript created
monkeys and humans 98% the same, and this new genetic analysis indicates human up to 10% different, or, only 90% the same
therefore, 98%-90% = 8% difference in monkey versus human random shakespeare manuscript creation
8% of 1 million is 8,000
therefore, 8,000 more monkeys than humans are required to produce one shakespeare manuscript
it's a scientific fact folks
(as well as all other "facts" gleaned from this 10% number in the article)
intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
Wow. That link took an interesting scientific report and then added a stupendous amount of stupidity. Here's the original source: http://www.pnas.org/cgi/content/abstract/172510699 v1
Here's why scientists believe two ape chromosome pairs fused into one human chromosome pair (which your link claims is ridiculous without any explanation): http://www.gate.net/~rwms/hum_ape_chrom.html
"The common ancestry scenario presents two predictions. Since the chromosomes were apparently joined end to end, and the ends of chromosomes (called the telomere ) have a distinctive structure from the rest of the chromosome, there may be evidence of this structure in the middle of human chromosome 2 where the fusion apparently occurred. Also, since both of the chromosomes that hypothetically were fused had a centromere (the distinctive central part of the chromosome), we should see some evidence of two centromeres."
Read the rest of the document to see how these two predictions made by the theory of common ancestry turned out to be correct.
And if you say tenesgrity, or porosity again ...
tensegrity
tensegrity
CC.
TaijiQuan (Huang, 5 loosenings)
Billions of letters? Billions of nucleotides, sure, but they're represented by four different letters last I checked.
How are sites slashdotted when nobody reads TFAs?
I knew it all along! What took the HGP (human genome project) so long? I mean, how else can you explain the difference between me and 'the others'?
My monkey tells me 8% of a million is 80,000.
I think he has been embezzling from me.
It depends on what, exactly, you are comparing. If you pick out a human gene and its chimp counterpart, and line up the sequenes, you find they are about 99.8% identical at the nucleotide level (and often 100% identical when you look at the encoded amino acids). These regions are presumably under selective pressure. If you do the same for corresponding non-gene sequences, ones which are not under selective pressure, you find they are 98.6% identical. However, now that the two genomes are essentially complete, we know that there are some large-scale duplication and deletion events, as well as variations in mobile elements, that make the overall identity between the two genomes somewhat less than the 98-99% identity between homolgous sequenes. So 95%, 98.6%, or 99.8% - all are correct answers in the correct context.
(IIABioinformaticist)
Right, because when I want the latest news on evolutionary biology, the first place I go and look for it is a creationist spew site. Just like how I get my facts on the safety of nuclear power from greenpeace, and my intimate knowledge of global warming from exxon-mobile.
Please, lets try and keep the lunatic fringe off slashdot.
doesn't mean anything unless it's 10% of the genome that's actually expressed, or if it is creates a functionally different protein. Working on the assumption that we do actually evolve, then we'd need to have sections of DNA that can alter without having an immediate effect - like a scribble pad where stuff could just be doodled.
Wot, they finally found the stupidity gene and how to eradicate it ??
So how is parent Offtopic?
Because it's a creationist site whose tagline is "Upholding the authority of the bible from the very first verse." While the source generally shouldn't be taken into consideration when considering the argument, in this case it's similar to asking the KKK for informed research on black people.
Want to improve your Karma? Instead of "Post Anonymously", try the "Post Humously" option.
OK, according to the Chromosome FAQs:e /posters/chromosome/faqs.shtml
http://www.ornl.gov/sci/techresources/Human_Genom
The X chromosome comprises ~5% of the genome while the Y chromosome is ~1%. Since women are XX and men are XY, men and women differ by ~6%.
If chimps are only 2% different from men, then men are more closely related to chimps than women. QED
Even if two genomes are 100% the same, that doesn't mean that the products of each will be the same.
Why? Gene expression can differ depending on environmental factors.
As a simple analogy, your DNA = a cookbook. While many recipies are cooked automatically by the systems in your body, other recipies are cooked or not cooked depending on the environment in which the organism finds itself.
I haven't read a good article on gene expression, really. Various mechanisms are alluded to in the literature, but it seems to be unclear how gene expression is or is not triggered. More specifically, researchers seem to know that this particular mechanism turns a given gene on or off, but how that mechanism is triggered is unknown (or not the focus of the article/research).
Also, I'd guess that environmental gene expression stars in the womb - that the fetus gets clues to the external environment from the nutrients and chemicals coming from the mother and adjusts itself accordingly. You could test that by somehow getting ahold of some in-vitro twins and implanting them at different times, I guess? But there probably still would be too many variables.
If we're only 3% different from chimpanzees, then 10% between humans is significant. It would tend to indicate that evolution is at play, which is something I've long suspected. Evolution doesn't happen all at once, it starts with a positive trait and then over time spreads out among descendants.
http://news.independent.co.uk/world/science_techno logy/article2007490.ece
This piece gets a few of the key facts correct where reuters went wrong, such as the already-mentioned "10% vs 10x" difference between individuals. It's a great read!
gtagcgtagatagctctagctagcttaggagcttagaggcgcttagatcg cgatcga
That should be 100%. 100% of 4 feet is 4 feet. 4 feet + 4 feet = 8 feet.
If something is overrated it simply means that it's been given "too much" credit. The idea here is that the moderation system _should_ be a sliding scale. Not every "good" comment deserves a score of 5. That doesn't make sense. That would basically create a system where all comments were -1, 0, or 1. Pretty meaningless, much like http://digg.com/'s. The ability to tune your viewing level is abhorrent.
Here(/.) comment scores garner recognition in the case where threads don't matter. Alternatively, if threads do matter the score doesn't. You shouldn't base your approval of a comment on whether it's popular, but I'm sure in some situations that happens (due to things such as anchoring and the general utility of status associated with a scoring system).
Anyway it's pretty clear that getting down to the basics again, the specific 'tags' of moderation aren't that meaningful compared to the numbers. I guess Funny is probably the most respected; everyone likes funny. Same with flamebait, troll. The usefulness of the rest aren't as big of distinctions, at least not in some cases.
You also run into the issue of how much should one be able to filter the content on the web. Theoretically one has the ability to filter much more than they do (even with a popup blocker). Still, it seems that if we are able to achieve 'tunnel vision' quality filters we may find a major disconnect in visibility of opposing views (not that there isn't one anyway; we seem to develop a natural blind spot to the arguments against our views).
At least it will make for some really interesting adverts, right?
Now that you mention it, that's wrong too. Because you should use the midpoint between the two extremes as reference point. Then the difference is only 2 feet which is 33% of the 6 feet you took as midpoint.
Humans have escaped the phenomenon of Natural Selection, for the most part.
All of us who wear glasses? We should have been culled. All these people developing diabetes from eating too much sugar? Selected against. Asthma? You get the picture.
Running with the idea that there is a higher power that created the world, I would say that Natural Selection is the method that higher power uses to figure out what works. But now with health care and a strong sense of altruism, errors in the genetic code are propagating throughout our species and wrecking havoc. In other words, we're playing god by saving lives that should have been selected against and allowing them to pass on their flawed genes.
I also contend that if we were created by a higher power, and that higher power enabled us with the ability to modify our genetic code, then it is our right (nay, our duty) to do so; otherwise, we would lack this ability. I believe that we should selectively erase genes which cause a predisposition to things like Down Syndrome or diabetes or cancer, etc. This would effectively select against all detrimental mutations.
This could also be the limit of Natural Selection as it tends toward infinitely fast; beneficial mutations in one human (for instance, the HIV resistance that elite supressors have) could be propagated throughout the species' genetic code in a single generation.
Perhaps I should leave you with an example, one that even a Christian might be able to tolerate. Imagine a future where you and your s/o collect your eggs and screen them for genetic defects, like Down Syndrome. Once a viable egg has been found (and you don't have to look up what the hair color or eye color will be, you could just leave that to fate), start screening some sperm. Produce a viable fetus which will grow up to be healthy.
Now imagine that you were one of those people who didn't do that for your kid. And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.
:(){
If there is this much variation between two individuals, does this finally disprove the whole "race" myth once and for all? Appearance only accounts for at most 15% of a persons genes. Since there are no "race specific" genes, and the science is basically saying that there is massive difference between two individuals, when will the religious ideology catch up to the science?
When are we going to classify people according to their genetic quality/type and not their appearance?
I wonder whether these statistical analytics give us much more in terms of _understanding_ DNA.
Would analysing the the statistical word distribution of worlds literature
tell you anything about its quality or meaning?
Would you better understand eg Dantes 'Hell' and Goethes 'Faust' or Wikipedia if you like,
by looking at the statistical occurrences of some letter combinations?
Probably not.
So this is squarely in the 'scientific news without value' department.
how the hell is this a troll?
moderator dislikes poster?
Clearly your humor gene is a mutation. That's your 10% difference with the rest of humanity?
(I actually got it,so I guess timezones do matter.)
Example of a 10% different human.
Beware: In C++, your friends can see your privates!
Very true.
Whenever I hear people talk about how we're "99% like a chimp", "45% like a fern", "76% like a catfish", etc. I just point out that we are not DNA. DNA is just the intruction manual on how to make us.
A more accurate analogy would be that the user manuals for a chimp and a human are 99% similar. Considering that the first 950,000 of 1,000,000 pages are about basic body structure, chemicals, etc, that's hardly surprising.
If I can get some gene therepy to customise my already fairly unique, I'll have created something new and can thus patent myself? Cool! That will stop those pesky cloners.
I want a list of atrocities done in your name - Recoil
I would argue that for many people 70% of the brain is air.
Yes, I'm left. You have a problem with that?
"Race is a social construct" -- well ok, it can be categorized via a laboratory test with 99.7% accuracy. And human biodiversity is simply a matter of a disappearingly small percentage of genes -- well ok maybe 10 times that amount and well, ok, ok, a significant fraction of the difference between humans and other great apes. And all of this "error" is biased toward the "genes don't matter" camp during the peak of boomer fertility when de facto polygyny (misnamed "serial monogamy" by the same academic authorities who biased things toward the "genes don't matter" catechism). The rational mind must wonder if there might have been some sort of genetic program at work in the primitive parts of the brains of these academic authorities, making certain ideas psychologically appealing -- ideas that would get young, nubile, impressionable, idealistic, coeds to avoid thinking too deeply about the consequences of their mate choices, as well as the consequences of technologically amplified immigration.
Seastead this.
I for one, welcome our speelling challenged, polymorphic bio-programmers.
How ironic, given your sig.
It's official. Most of you are morons.
Ah, nothing like 100% fact-free speculation. From what we can glean from shared environment / shared genome type studies (I.e. twin/adoption studies), genes do matter to a very significant degree.
Of course, this particular paroject isn't about determining actual real-world impact at all, but is rather primarily intended to map out different genomes among different population groups (I.e. races) that can then serve as a basis for further research.
If we think that natural selection just means survival of the strongest or fittest, then the humankind should have died a long a go. For almost its entire history humankind has been dinner in dishes of predators. If you put a human and a lion one against another, the lion wins. The key in success of man has been group work, working together to achieve common goals: hunting, defending against predators etc.. In this backdrop having a bad eyesight or asthma doesn't matter so much, individuals with these negative attributes could still specialise on some other talent form. And keeping in mind that there has always been more individuals wanting to join a successful group than there has been inner need in that group, has kept the competition going on and 'natural' selection has taken it's care.
;)
If we look at our current society where almost every baby is been saved and poor people have more children than rich, it could look like there is no natural selection going on, and thus one could think that degeneration of human genetic code is going on. I don't think that this is the case. It could be the case if there would be strong social barriers between different classes of society, but now there isn't, and people can mix and match on their own basis, selecting the most suitable partner for them. Also one variable to consider is that humans have developed very much information regarding how to live life and how groups should work, and thus the race is also going on in a cultural front. If we look a child, he/she gets very much cultural information from the beginning that influence ones later success in life. All in all I think that we are running in the right direction.
On a different note, I also applaud genetic screening for defects, but only on clear cases like the mentioned Down syndrome. Screening something like the 'criminal' or 'gay' gene, would not yield success and if used in a large scale would lead to a shift in society: there has to be enough aggressive people and people liking to dress pink
Survey research tool for commercial and scientific use
From the article in the Independent referenced elsewhere in this thread:
o logy/article2007490.ece
http://news.independent.co.uk/world/science_techn
"The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect."
In short, this research supports the notion that race is a useful and scientifically supported concept. Indeed, virtually all new data coming in on human genetic differences go against the fashionable yet not-very-well-supported notion that "race does not exist". How strange.
Epigenetics will probably be churning out answers to some questions like this in coming years.
Chimpanzees are smart, intelligent and sensitive animals. Please dont compare them to a mindless terrorist like him, its insulting.
Shouldn't the link be : Utter Rubbish ???
http://davesboat.blogspot.com/
>> ... anyone here ... ?
I don't know why your asking there's only you here.
OK. If you take that the Bible is a compendium, or codex, of books then the Bible as we know it is about 1800 years old. However some of the books, I only know about Isaiah were written substantially before Christs life. Isaiah is believed by Christians / Jews to contain many prophecies about Jesus / The Messiah and was written IIRC about 500 years BC.
Informative?
Cheers.
PS: http://en.wikipedia.org/wiki/Dating_the_Bible gives an estimate of 1500 years BC for the Pentateuch (first 5 books of Old Testament).
"The only strange thing I see in your post is that people of mixed ancestors aren't cited. So I guess in your world people don't mix at all and can be precisely determined what they are."
No, but it can be determined very accurately if people have recent (broadly speaking) ancestry in a particular part of the world.
"Do you live in Nazi Germany, 1940?"
Ah, the Hitler thing. How original.
"If they do mix, how "the research" identifies them?"
Using non-binary designations, probably. It's like colors - there is no discrete line where one color becomes another, yet people rarely go around proclaiming that "colors do not exist". Racial designations is a matter of utility and economy of information.
When it comes to "tagging" however, the old racial classificiations remain remarkably efficient - I.e. if you compare how people self-identify with their genetic makeup, a computer will usually sort them into their own self-classified category with a high degree of precision. Certain fashionable ethnic identifiers are far less effective than racial ones, however, I.e. "hispanic".
"My guess is that a lot of people in here or in science have a bias towards a racially segregated society, where people don't mix, just like the US and european countries."
Ah yes, scientists are all racists - that must be it. Interestingly, this kind of exchange is rather typical, I.e:
Scientists: "We have lots of new cool genetic data!"
Lewontinites: "Hitler! Racism! Hitler! Racism!"
etc. etc.
A trillion atoms bouncing around, randomly stuck together, formed a humanoid being and actually did write the complete works of Shakespeare! If that isn't evidence of Intelligent Design I don't know what is.
Deleted
I think your problem is that you are comparing the percentage difference in one gene (XX vs XY), then take the percentage difference of two whole genomes (Human vs Chimp)and presuming that the differences scale accurately. Someone should call the Analogy Police on this.
The simple truth is that interstellar distances will not fit into the human imagination
- Douglas Adams
1 million geeks typing and mouse-clicking not-so-randomly = slashdot effect
I doubt you could herd a bunch of monkeys together and do the same, unless Slashdot started posting articles about bananas
Fantasy based belief systems or Hero Worshipping Mythologies are not intelligently designed to embrace new discoveries in science.
But the deeper you go in biology the more you think 'How in the world does all this work?'
Looking at the living energy of a cell dividing or the power of the stars,
you don't need ancient writings of sheep herders to feel the
mystery and awe and privilege of living in such an amazing universe.
Enjoy the Wonder!
I'm starting to take that seriously, although technically, you mean men are more closely related to male chimps than to women.
From your numbers, male humans have about 1% of their genes that simply do not exist in female humans. If some genes truely code for behavioral modifiers, then there is a very good chance some of those are found on the Y chromosome. Women can't have those genes, by definition. Ergo, the conclusion should be: If genes sometimes code for behavior, men have a wider range of possible behaviors than women, and men really can understand women (at least on a statistical average basis), but women will never understand men.
(Males as a group have at least one copy of every gene females as a group have. Females may have two copies of some from having two X's, but can't have any copies at all of what's only found on the Y)
a. modern science has shown us why men are superior to women.
or
b. genes don't really code in any way that influences behaviors whatsoever.
or
c. by an extreme statistical fluke, no gene that affects behavior is found only on the Y, AND no gene that affects behavior is linked in expression to any of the genes that are only found on the Y.
Who is John Cabal?
Has anyone thought about doing a cyptographic analysis of the DNA code to find all the secret formulas the aliens imbedded there? This would be a great idea for a movie plot BTW.
Dave
Now imagine that you were one of those people who didn't do that for your kid. And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.
So in your perfect world, Stephen Hawking (ALS), Issac Newton (Epilepsy) and Albert Einstien (Aspergers Syndrome) would never be born? Do you believe genetically "flawed" individuals have nothing to contribute to society?
Support Right To Repair Legislation.
1. I am not an american and do not live in the US.
/ racial-data.htm
2. "That means absolutely nothing. How much recent is?"
Did you read the article I linked regarding the Hapmap? You can very accurately pinpoint ancestry by looking at a person's genome. This will, as the article points out, help forensic science, etc. a great deal.
3. "Without precise definitions and evidence backing it all, this "idea" is nothing more than wishful-thinking."
Again, did you read the article I linked regarding the subject of this entire post? It's not as if this is new, by the way - see for instance, from last year: "RACIAL GROUPINGS MATCH GENETIC PROFILES, STANFORD STUDY FINDS"
http://mednews.stanford.edu/releases/2005/january
4. "Do you anything about the world? Do you think this race centric view like in the US is the predominant everywhere? Do you think "black" in the US is the same as "black" in Africa or anywhere else?"
No, not entirely, of course - all designations and symbols used by human beings are non-discrete to some degree. Just as one can claim that "there are no races", one can claim that "there are no tables" or that "there are no knives". Reality is, in essence, one big mess that humans then try to make some sense out of using designations and symbols applied to different observed structures - it's in our nature to do so.
As the research above makes clear, however, the concept of "race" is not useless, as it can provide information even at a very high level of abstraction, I.e. "black", "white", etc. Thus, I believe it is a mistake to discount the concept of race - usefulness and the ability to convey information is after all the acid test for whether a concept is valid or not.
"What? If they self-identify didn't they provide the data previously? How sorting records would be difficult to a computer!?"
The computer does not use their self-identification, only their genetic profile. Only after the computer have sorted the subjects by genome is self-identification used to compare genetics to self-identification. See the link above.
"Nonsense. Hispanic is a marketing definition created in the US for americans, used to select meals by the number, to be able to deal with the latin american diversity. It's not used anywhere else!"
That was precicely my point.
Say, could you show the Slashdotters these calculations?
100% of these comparative studies are highly speculative. Take into account: 10% of the DNA codes for proteins (this DNA was sequenced in HUGO on which most comparative studies were based) 90% was named junk-DNA, but isn't really. It is now recognized that it is functional in the sense that it regulates the expression of other genes. This DNA can differ a lot more among individuals and species. The functions of 'junk'-DNA are only partially known, but it is clear that in addition to some proteins (expressed by the 10% DNA) 'junk' DNA is responsible for differences among cell types. Every cell expresses it's own subset of genes (produces it's own set of proteins, has it's own function). Since we barely know which cell expresses what genes, how can we even try to compare among species? It is the same as stating galaxy X is 90% the same as galaxy Y. What do these comparative studies want to prove anyway? If 90% of the bibles have the same content, tell me about religious people.
You can't expect them not to respond to something like this. The window in which superstitious fantasies like creationism exist just closed a little further; the fact of the myriad variations among humans and animals leans ever nearer to a mundane explanation, and further from the hand-waving vagaries of "soul" and "mystery."
The more information science puts on the table, the louder the screams from the superstitious will be. Right up until the day the last one lays down their book, crystal, bones, or tarot.
All we have to do in the meantime is keep these people from injecting their miserable dogma into our legal and social systems to the degree where it rolls back progress, like the recent push to get creationism into schools. That went well enough, the clueless were sent scuttling back to their caves; but as vigilance is the price of freedom, so it is the price of rationality. Keep a wary eye on your local mad hatters. They're plotting on you; count on it.
I've fallen off your lawn, and I can't get up.
Well I know that the general opinion of the genetic code has been some sort of simple weight of the 4 letters of the code or some pure sequencing data. Well now for the geeks on Slashdot comes a decent translation.
The genetic code of a person is like a computer program that builds and runs a person. It is the firmware and OS if you will. Without getting too complicated the old method of comparing the code would have been like counting all the instructions in a assembly language program. Then by adding up the sum of the times each instruction appears and weighing the number of them we compared programs. (obviously an idiotic way to measure how a program works) The new method its starting to find the sub routine loops and complex operations steps in the program. It still is far less than the final result but it is a long way along the way from where we have been. Remember the alteration in position of a single code item in a program may be minor or major depending upon position. Anyone who has chased down a missing period in COBOL should surely understand.
The comparison to firmware and OS is more solid than one might think. Yes your code gets edited from time to time. Yes you get updates. Did you ever wonder what comes in when you get a cold or the Flu. You are a much more fluid system than you might think. Yes mods... I do have the microbiology studies to back me up!
Never Politically Correct ~ I prefer the facts If you don't like what I say, get a life, or comment yourself.
nt
How did this get modded as insightful, now?
-1 Redundant
Slashdot readers are already known to be incapable of digesting an argument based on its merits.
They need to be told, using emotionally charged terms, which is the politically correct side of the fence that they should be sitting on.
(Are you sure you just didn't come from a KKK meeting yourself? You are using the very same tactics that they themselves use.)
Evolution is a fact. Darwinism is a joke.
Sure on the basis of single nucleotides you may find huge variation of the quoted 10%.
But everyone needs to realize that there is degeneracy in the genetic code. Many of these SNPS will make 0 difference to the protein which is finally translated.
Even if these SNPS code for a different amino acid, how critical is it? Does it change the interactions of the protein significantly? If not then who cares. The variation doesn't mean anything in this case.
There are cases where SNPs do change the amino acid and change the interactions of the protein significantly, but I would bet that this is not as common as the former two cases.
One would expect that mutated proteins which are essential for successful reproduction would almost never be functionally different even if they are peppered with SNPs.
When you look at species to species difference, then differences are more significant because similar genes are under different selective pressures.
It doesn't even deal with that. However, some people try to say it does because it sorts through people who won't listen to science, reason and logic. That gives the leaders a group of people who'll believe whatever they're told by their religion, and donate whatever is asked.
Most christians don't dwell on the trivial things that don't matter to their faith.
Well first of all in women one of the X chromosomes shuts down so at a gene level man and women have the same number of usable X chromosomes. Furthermore the Y is only .38% of the genome AND has a very low number of genes (even for it's size). Also chimps can be both male and female, the 2% comparison is probably using a full genome (X + Y + rest) so comparing a human male to a female chimp would have a larger margin.
A more accurate analogy would be that the user manuals for a chimp and a human are 99% similar.
Or that the memory images for cat and rm are 99% similar, because they each have a few megabytes of libc.
I hereby place the above post in the public domain.
Why would you choose either the max or the min height as the starting point?
Wouldn't it be more correct to say that the average person is 6 feet with a variation of 2 feet... So, humans vary in height by up to 33%?
Pat
Actually, that would explain the observed reality.
I guess that makes Starbucks a pretty smart company.
Race is based on appearance, if you are talking about location based genetics, all Americans are the same race. But if you are talking about the stereotypical definition of race, you as in appearance, appearance is only 15% of a persons genetics, which means there are more differences between two peoples brains, than the amount of difference between a white, a black, and an asian. In fact there is more genetic difference between two asians, than between a white and a black, or between two blacks than between a black and an asian.
I hope this proves the point. Genetically, if there is a such thing as race, it's likely not the same thing as how we currently define it, it's likely based on the locations your genes came from, which has nothing to do with race or appearance, it just says that gene X came from location Y and is popular among people whos ancestors came from location Y, even though all 3 races may have ancestors who came from location Y. This basically proves the 3 appearance types are NOT the true races. The true races are based on genetic similarity. Genetic typing, would mean two people who share a family disease are more closely related than two people who share a skin color, because often many diseases require more genes to manifest than any of the common human appearance traits, and these diseases are recent mutations.
If you believe in the concept of race, you are a racist, it's that simple.
If you can admit to being a racist, then you can discuss the social concept that is race. If you arent a racist and you are say, a geneticist, a transhumanist, or whatever, then you'll understand that appearance does not make up the majority of the genetic differences between two humans. This means the classic religious definitions of race have already been proven through science to be fake.
You want an example? Let's say homosexuality is genetic and is biological, are homosexuals a race? Sure they could be considered a genetic race, if you based it on gene science, but you cannot look at a person and automatically see their race as homosexual.
Want another example? Tall muscular people, giant sized people, these people could be considered a completely seperate race, they have many genes that the common population does not have, this is why they are so tall and big, these are basically new breeds of human, they play sports and stuff like that, but they are genetically different. Are they a race?
The problem with classical racists is that they classify race as only CERTAIN genes, they only judge race based on how people LOOK, which means there is no science at all, it's classic eugenics, it's as silly as studying the shape of the human skull to figure out the size and speed of the brain, it's as stupid as studying the box of a computer to try and figure out whats inside and how fast the CPU is. It's one thing you don't know what a computer is yet or wha ta CPU is yet, and you study the box, but once you KNOW what the CPU is, how it works, and everything, and you still study the outside cast of the computer, just out of laziness so you can put these computers into boxes based on the color of the case, well there is going to be errors.
Lets do it like this, you have the intel black box, and the intel white box.
You are going to end up putting pentium 4s in the same box you put pentium 2s, all because you are too lazy to actually open the box and see the difference between the CPU's. You might even end up putting AMDs into the intel boxs. Basically, what I'm saying is, if we applied the race idea to computers, the case your computer is in would define it's race. A computer that comes in a black case, no matter what the CPU inside is, it's going to be put into a box that SAYS it's a pentium x386, it could be a pentium 4 extreme CPU inside that box, but if it's in the black case, the lazy boxman is going to put all black cased computers into the pentium x386 box, simply because the case is black, it goes into that box.
Now, the white intel, this will be another box, it will be a x586-686, now lets assume the boxman is just as lazy, the cases are white, and all white cases automatically go into the x686 box, and in the x686 there is all this advertising about how state of the art it is.
But what if under the white case it's actually a x386 CPU, and because no one bothered to check, it goes into the x686 box? So all white intels will essentially be labeled 686, and all black intels will be labeled 386, no matter what the CPU or hardware inside the case actually is.
Now, when the consumer goes to buy the new computer, they buy the white intel thinking the white intel is superior, because it's white, and has good marketing, and good hype, and has a nice beautiful white box, so they go ahead and buy the nice hyped white box, they plug it in, and it runs slow as shit, it crashes all the time, and finally they open it up and they discover it's a fucking x386 CPU in an x686 box, inside of a white case,
This is why racism is wrong, Just analyze the metaphor, if we used racism to justify which computers we buy, we'd all be buying SHIT computers, we wouldnt even open the box to see what CPU is inside because the case would look so nice, so shiny, and so white, that we would not even bother to check the speed of whats inside.
The black intels wouldnt even sell because hey even if they are
"If you believe in the concept of race, you are a racist, it's that simple."
It is interesting to see how the concept of racism has slipped, but that is somewhat beside the point. If I'm a racist or not is irrellevant to the discussion at hand - this discussion is about the usefulness of race as a genetic concept.
"If you can admit to being a racist, then you can discuss the social concept that is race. If you arent a racist and you are say, a geneticist, a transhumanist, or whatever, then you'll understand that appearance does not make up the majority of the genetic differences between two humans."
No, but appearance is not independent of ancestry. And ancestry, via heredity, natural selection, genetic drift, geographical isolation and many other factors impact the makeup of the entire genome - not just the genes that code for appearance. Hence, appearance correlates with other traits, that are not related to appearance. This is also why race is a useful concept - if you tell me a person is "black" in the United States, I will be able to not only discern that he most likely has a darker than average skin tone, but is also more liable to suffer from sickle-cell anemia, and is far more likely to gain benefit from taking a race-specific medicine such as BiDil.
"You want an example? Let's say homosexuality is genetic and is biological, are homosexuals a race? Sure they could be considered a genetic race, if you based it on gene science, but you cannot look at a person and automatically see their race as homosexual."
Like I said above, most modern concepts of race are based on ancestry, not on some single genetic similarity. (For instance, there are lactose tolerant groups of humans in both northern Europe and certain areas of Africa - that doesn't mean that calling all lactose tolerant people a "race" is very helpful, unless we radically alter how most people percieve the concept of race).
Rather, it is much more helpful to concieve of race as an (extremely) extended partly inbred family. Indeed, most criticisms levelled at the concept of race can be aimed at the concept of family. Where does your family end?
"The problem with classical racists is that they classify race as only CERTAIN genes, they only judge race based on how people LOOK, which means there is no science at all, it's classic eugenics"
As I pointed out above, how people look tends to give a reasonably high (but variable, see Brazil example elsewhere in thread) quality estimate of their overall ancestry, and hence of the makeup of their overall genome. Also, this has nothing whatsoever to do with eugenics, except through an excessively long chain of somewhat tortured logic. (Which usually involves Hitler somewhere along the road...)
"This is why racism is wrong, Just analyze the metaphor, if we used racism to justify which computers we buy, we'd all be buying SHIT computers, we wouldnt even open the box to see what CPU is inside because the case would look so nice, so shiny, and so white, that we would not even bother to check the speed of whats inside."
Oh, I generally agree with this sentiment - which is surprising given that I am by default a "racist" because I do not discount the utility of race as a concept. (Which does not mean that I believe society should be based around race, or certain races discrimiated against).
Iirc, both X chromosomes are active during gestation*, and although one is disabled in a Barr body later, about sixteen genes of it are still expressed.
* Not very confident on that point.
I believe the reason this is a revolution in genetics is that the 98% figure for chimps and humans is now out the window. The idea, in part, is that we all vary in the number of copies of segments of our DNA - Copy Number Variants, or CNVs - and that having more or fewer copies of some nucleotide sequences result in significant phenotypic differences - for example people with more copies of one sequence might make more of a certain protein.
The result is that we may share 98% of our genes with chimps, but apart from the 2% that is just outright different, there are undoubtedly great differences in the number of copies of the sequences in the 98% that we share. The net result is that we are undoubtedly much more than 2% different from chimps.
Was Hitler right?
Slavery is the world's oldest profession. All religions practice eugenics. Their adherents are subjected to eugenic modification by control of their sexual selection. The object of this interference in the natural selection process is to create a race that is supportive of and subservient to their religious masters. Religions do this best because they can exert control through the long periods required to breed humans. Presumably, it would take just as long to breed their subhuman strains back to normalcy.
So. Was Hitler right? Is genocide the only solution to eugenics?
Heck, the human brain is 70% water, does that mean the head is "pretty much" like a 1/3 empty coffee pot?
;-)
I code for a living.
My head is very much like a 2/3 full coffee pot...
--Phillip
Can you say BIRTH TAX
Yes, thank you for persuing such a thought-provoking discussion with me. Most people react very negatively to what I say (OMG YOU WANT TO KILL PPL).
The health care point you bring up is excellent. I understand that we are on slope that's as slippery as a Pittsburgh street in the winter. This is why I believe the parents should choose what is and is not screened for. It's like keeping the government at the state/local level.
You are right, this Downs child would incur significant expenses, but if, say, half of our population chose screening, imagine the relief on the health care system. It would be much easier to devote significantly better resources to taking care of sick people when there are way fewer sick people.
You also bring up an excellent point about private health care. I believe that would happen in Capitalist Pigdog America. Don't mind me, I believe Capitalism is a major source of evil in the world (yes, I know, what do I suggest is better, blahblahblah, doesn't mean it's good to encourage humanity to be greedy). Personally, I don't mind paying some taxes to know that my fellow Americans are getting health care coverage they might not otherwise be able to attain. I'm sure there are other countries whose governments agree with me.
Again, though, for those situations where health care is still needed it will be available. If the child accidentally has it, or the parent chooses to have a child with a known flaw, again, the health care system will be there and it will be under much less stress if a significant portion of the population uses screening. I also find it hard to believe they could enforce prescreening, because people are still going to make babies the traditional way.
As far as "failing to fix it", I'm not saying fix it. I'm saying don't choose that sperm/egg to form an embryo. As to whether it is child abuse, I believe that knowingly creating a child who will be forced to suffer is child abuse in the same way that it would be child abuse to purposefully introduce this genetic flaw into a child. Again, though, who draws the line where? This is why I believe it should be handled at the state/local level.
And yes, it would create classes of screened babies and traditional babies and an associated stigma. Society would have to deal with this, painfully, like it did before the majority of people needed glasses ("Four eyes!"). From the standpoint of the human genetic code, though, it would be getting cleaned up, and the screened babies probably wouldn't even have to have screening when they have their kids. In fact, I think a mixture of no prescreening, light prescreening (no Down syndrome, no color blindness, less risk of heart disease), and full prescreening (chosen hair color/eye color/sex) is the right solution. In this way, everyone can have whatever they want. I honestly think most people would choose light prescreening, leaving the hair/eye color and sex up to fate, while ensuring that this child would be born healthy.
:(){