Slashdot Mirror
Human Genome Mapping Completion TBA
rit writes: "According to this CNN article, both The Human Genome Project and Celera Genomics, Inc., two groups who have been working on mapping the human genome, are scheduled to hold news conferences Monday in which they will announce the completion of the Human Genome. This should prove interesting, and makes me wonder: what will we do next?"
Mapping that region of space where that 1 sock escapes to from the dryer.
The Blaster Master Fighting for Truth, Justice, and Evil Pie since 1979
What abominations await my "raza" now that the human genome is in their sights?
Are you adequate?
What we do next ought to be obvious. Corporations/organizations/institutions must get together and figure out how to use this ethically. Surely, if we can cure multiple sclerosis, can't we cure [your_least_favorite_skin_color_here]ness?
That ought to be a high priority of all involved. Or if you mean, what will technology do next? Flying cars and colonies on Mars.
We haven't been back to the moon in decades. Is the human genome doomed to the same fate? Now that we've seen it, will it simply be filed away and taught to third graders?
Well. That is a bit ludicrous. Does anyone know what we actually can do with this information? Things like growing modified human clones (with, say, an eye in the back of the head) would never ever pass any kind of review board. What is the practical application of this work?
I predict that as these functions are identified, genetic research companies will patent tests for specific genes (if not the genes themselves.)
As a result, actually getting the benefits of these tests - like early warnings for predicting diseases etc. - will cost way more than it otherwise would, in order to pay the license fees the patent holders will demand (kind of like how brand-name drugs cost more than generics.) People with insurance that covers such tests will be fine, but people will find it harder and harder to get insurance as companies begin raising rates based on the results of such tests.
Some European countries will pass laws preserving individual rights to privacy which will prevent such behavior from insurance companies, but in the US it will take abuse from HMO's and insurance companies before Congress passes laws providing a weaker form of protection.
Of course, my crystal ball may be on the fritz. Check back in a few years and we'll see if any of this comes true... ;)
Finally, don't forget this is just a first draft - there's still a lot of donkey work required to map out tricky regions and to verify already covered regions.
"Just once, I'd like to meet an alien menace that wasn't immune to bullets." -- The Brigadier, Dr. Who
Celera and the government funded Human Genome Project are going to announce project completion simultaneously. Surely this is political. The question is, which one of the two is the "most complete"?
This project is probably equal or greater in scale to the Manhattan project in it's potential effect on humanity. For the next 50 years, we're going to be worrying how bio-genetics will be misused while reaping the benifits of a new revolutionary technology. I wonder what will be the equivelant of "duck and cover"? Hold your breath for as long as you can?
Humanity's revolution for the next two decades to be feuled by bio-genetic discoveries, not by advances in computing power (not that one didn't catalyze the other)
When the project started a few years ago, the world was excited by the possibility of knowing what every single gene in humanity did. After all, if we understood what is is that makes a human a human, perhaps we could cure genetic disease and maybe someday improve ourselves...live for hundreds of years, whatever.
What most people fail to grasp, however, is that the Genome project is only the first and earliest step in this process. Sure, we have mapped the human genome, but we still don't know what most of them do. There could be 40 different genes that affect height, for instance, and the only way we have used in the past to figure out which genes do what is to screw around with genes in an egg and see what kind of baby comes out of it, like in fruit flies or mice where thousands of genetic experiements have been done in the past. I hope it goes without saying that this research technique is not possible in humans.
However, we still want to learn the functionality of our genes eventually because, both medically and sensationally speaking, that is the supposed eventual goal of the fruits Genome project.
Now, I pose a question to slashdot readers. I'm primarily a web application developer and don't really know how far the field of computer modelling has gone in terms of biological systems, so now that we've mapped all the genes, how much longer until we can create a system to mimic the human body closely enough to try our genetic experiements out digitally? Because until that point, I really don't see what good the Genome has done for us.
Early next year you can start by gett ing your own genetic profile. Mail in a few cells and see what you're made of.
if its like any other sort of technological advance, well, if the hard work is done...ITS TIME TO SUE SOMEONE!
I know I'm jumping the gun a lot here, since we can't do much more sophisticated things than cloning a sheep and curing cystic fibrosis in lung tissue that is not attached to an organism, but...
It strikes me that genetics are a lot like source code, and that we've sort of reverse-engineered a template for writing this code.
So the big question is: when they start coming up with genetic enhancements to make us smarter, stronger, and more fragrant, are they going to be packaged in such a way that we can't tell what they are without doing the whole reverse engineering process over again (i.e. MicroSoft Harry), or are the specs going to be put out for all to see, so that we can all create our own personalized monkey-men (i.e. GnuMonkeyMan)?
I'm a little disturbed by my own post.
"Beware he who would deny you access to information, for in his heart he deems himself your master."
This is a fun time to be alive, and I'd love to see if there are any interesting results if one were to gzip DNA. I'm sure there are all kinds of interesting thing you could learn from just that.
Marxism is the opiate of dumbasses
The answer to "what will they do next?" is fairly obvious: they'll patent the human genome. Never mind the fact that it's laughably unpatentable; we all know that the USPTO is so screwed up that the patent will be granted, effectively freezing progress in this sector, potentially for decades.
--
Tired of FB/Google censorship? Visit UNCENSORED!
Merely mapping (which I don't think that they have, considering we don't even know when we stop mapping the human genome.. it's not like there is a big sign that says, "You have reached the end of the genome, thank you, now go home") doesn't achieve ANYTHING. At all, I wrote DNA analysis software to identify possible "interesting" strands as they went through the processor. The methods used to map DNA, if just stuck in there will contain A LOT of contamination and misreads, hence their so called complete map is one that would be analagous to that drawn of a third grader with a crayon. Granted, they are doing a significant amount of research and should be commended for it, but just mapping doesn't mean anything.
The thing that I really have a problem with is that Celera just dumps all their gene reads into the patent office and gets rewarded the intellectual property for said read. This is complete crap - they did not discover anything that should be worthy of a patent. Maybe we should branch off a new patent office for this type of work. The read should be forced to be open and free to use after 3 years maximum, this will stop someone who figures out the gene for cancer, obesity, intelligence, whatever from forming a monopoly screwing us out of healthy, slender, really smart people.
However, I know a lot of you think that this work would not be done if they didn't patent this work so they could sell it to pharmo's to make money. You are right, they should be able to have limited commercial rights to it. The ability to cure a plague upon humanity should be a non-commercial engagement.
Just my overly long $0.02.
nerdfarm.org
Dacels Jewelers can't be trusted.
I doubt it. That would imply that most people are actually concerned about the moral imperative. It's like the A-bomb, lets make it, try it, then decide it's wrong.
I need a TiVo for my car. Pause live traffic now.
Minority? What the hell are you talking about? I'm not in a minority! Hint: There's a world ouside your country where you would be a minority.
This technology will have to be tested on people before it can be used for the good of mankind.
Don't give me your talk about "for the good of mankind". Say it straight: "so some hotshot unitedstatesian millionaire makes a buck from the genetic deformation of third world peasants".
Instead, the technology is created by the highest bidder, who tests it on the lowest bidder. In the words of King Missile, "That's reality. That's the way it is."
Yeah, that's so convenient for unitedstatesians on top of the food chain like you. Don't be surprised if the rest of the world has a different idea.
I'd remind you that, as a group consisting largely of "computer people", we know better than anyone else that you learn twenty times more from your fuck-ups than from your successes.
You're euphemising with "fuck-up". Why don't you say what you mean: "We learn twenty times more from making Guatemalan women bear deformed children."
In conclusion, human testing is sometimes necessary, and we should force it upon the Amish.
You end up sounding like the Japanese would have said of Koreans in WWII.
Are you adequate?
The project was originally expected to take 15 years. That was what? 5 years ago?
:) I love this field; six months ago qualifies as ancient history.
Three months ago, I went to a seminar on Bioinformatics - and it was stated that the project would probably require another two years to complete.
Now, about that protein folding problem...
-- What you do today will cost you a day of your life.
We'll finally have the script to our bodies. Whether you believe in God or Evolution or some combination thereof, this is a landmark event. For the first time, a species will have the ability to view and eventually change its own blueprint.
My fondest hope is that our society will be able to catch up enough with technology, so we can deal with this the Right Way(tm). I think Gattaca had some very relevant messages, that need to be discussed as we move into this technology. We the public need to be very aware right now of what is happening with the patenting of genes. There is a great potential for abuse.
I'm glad that both the public project and the private sector will be announcing this together. The Human Genome Project immediately publishes their data on every night. You can be sure that Celera's downloads it every morning. It would be an affront to the scientists who did so much work in the public project if Celera tried to steal all the credit.
Be sure to check out the Charlie Rose show this week on PBS. He has been running a week long special on all this. I highly recommend it.
The more you know, the less you understand.
(We'll ignore the thorny issue of genetics-as-IP for the moment)
As I recall, large chunks (if not the majority) of our DNA is really junk information, stuff that doesn't really _do_ anything. Sorta like the bit-rot that accumulates on hard drives after a couple of years of use. That fragment over there used to be part of a tarball I deleted, that over there was part of my mail spool, and so on. Areas that once held information, but are now marked as "free blocks" and so unused.
It wouldn't suprise me to find little chunks of "how to grow a tail" or "how to put bright blue pigment in your buttocks" in human DNA.
So from the point of view of someone hoping to make money off the annotation process, you've got to hope you annotate something that's actually part of the program, instead of "how to grow gills and scales" or some such.
That strikes me as a lottery, not a business model.
BTW, can somebody in the know comment on how the annotation process works? How do you know what gene [foo] does without actually flipping it and watching the results? Do we have a good enough understanding of the inner workings of DNA that we could model it, and simulate flipping the bits?
Want to learn about race cars? Read my Book
Easy; the one from Celera. Why? Because the scientific effort didn't make any attempt to apply something like the GPL to their data. That means that Celera is ahead and always will be ahead because they can combine their privately generated data with the publically generated data to get a more complete picture. The result is the Celera will be able to make a big profit by selling data half of which was funded by government sources.
A strong license might have been able to force Celera to release data that incorporated the publically funded results under less restrictive terms. Instead they can grab all that public effort, combine it with their own work (which is admittedly pretty impressive) and sell it back to people. It hardly seems fair.
There's no point in questioning authority if you aren't going to listen to the answers.
Next up, the field I'm prowd to be working in! Bioinfomatics, people!
The nucleotide sequences don't mean anything unless you interpret them. That's where massive data analysis comes in. Protein sequences have to be isolated, the shape and folding of the proteins simulated and their interactions catalogued.
Additionally, there is gene expression data to combine with genomic data - there is no good in knowing what a gene is unless you know how much protein is being made from it. Here comes in the cDNA microarrays which measure just that. (cDNA microarrays work by figuring out how much mRNA (the template for proteins) for a given gene is in a certain type of cell, and do this for 5000 or more genes at a time)
With comprehensive parallelized databases of all the genes, with protein and expression data, we will be able to do much more with the genome than a bunch of letters.
it's life size.
(with a nod to Steven Wright)
--
+&x
It's odd to hear that *both* Celera and the HGP are announcing "completion" of the sequencing. Keep in mind that as recently as late last year, the HGP was loudly criticizing Celera for their reckless and largely PR-driven approach to human genome sequencing.
This could suggest a couple of things, IMHO:
1) Celera and the HGP have managed to reach some agreement on IP and the sharing of information between the two efforts, thus ending years of bickering, and providing a more complete map than either could accomplish alone (to date).
or
2) The HGP is racing (probably against the better judgement of its member scientists) to keep up with the steady flow of BS PR that comes out of Celera. For some reason (probably the cynic in me), I think this is the more likely case.
I've never been a fan of Celera--I've read their published data on the fruit fly genome (declared "substantially complete" BTW), and was amused to see coverage gaps big enough to drive a few hundred genes through. This concerns me a lot--once we allow corporate interests to drive science, will we see a degradation in the quality of basic research like this?
Let's try not to let fact interfere with our speculation here, OK?
As someone doing his PhD research in bioinformatics and computational biology, I'm surprised that no one here knows that what both Celera and HGP are announcing is not the 100% complete, every base is sequenced, here's the whole thing on a 3.2 Gb disk for you. They're announcing that they've assembled most of what they have into a reasonable approximation to the true sequence, with substantial sequencing errors and misassemblies left to be worked out over the next few years. Think of it as having finally finished scanning the pages of the complete works of Shakespeare, and running a first pass OCR algorithm on it - you've got the data, you can see where the plays start and end, and even alot of information about acts and scenes, but alot of cleanup and closer examination is necessary before you post it to ebooks.org
Unleash our legion of genetically-enhanced mutant killers!
"Get good cryptographers to look at it, see if they can find patterns"
...find a pattern that rought translates:
"Congradulations! You finally figured it out - signed, GOD"
or
"This code derived from original Andromeda strain implanted Sol+14097, Copyright Andromeda Bioengineering, Galactic Diversification and Colonization Corporation, all rights reserved."
ATATATATGGATATACTTATATGAACTCTCTCT
TATATATACCTATATGAATATACTTGAGAGAGA
try { do() || do_not(); } catch (JediException err) { yoda(err); }
So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't. Although HGP is attempting to sequence the geonome's of 4 different people in other to get this variation, this doesn't really capture the distributions across different ethnic groups. Getting that is problem that is even larger than sequencing a few geonomes.
Another problem I see is that even if we are able to sequence the genetic code for all the proteins, what are we going to do with them. Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?
The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation. With this sort of track record how are we going to do against diseases that are caused by multiple mutations or where different individuals with the disease have different mutations? And this isn't even considering diseases that are caused by interactions between interactions between the gene and environment/history of the individual or disease caused non-genetic inheritance.
It seems like alot of people see genetics as a panacea for all human ills. However this overlooks the fact that the environment is just as important as genetics. In some respects, the attention that whole gene therapy is getting resembles the hype that surrounded radiation in the early 20th century when radiation was going to cure anything and everything.
"When you sit with a nice girl for two hours, it seems like two minutes. When you sit on a hot stove for two minutes, it
Only part of the DNA is actual genes. Genes look 99% or more similar from one animal to another, and the major difference between e.g. a human and a mouse is in the other "garbage", outside of the genes.
Also, not all genes are necessarily in use. One key to understanding which ones are "turned on" and which ones are not, might lie to understand that "garbage" outside of the genes.Compare to a software application; the genes are the data, while the stuff outside is the actual instructions which tell how to read that data.
Celera is now about 1/3 on the way to sequencing the mouse genome. Being able to compare genomes from different animals might give us some further clues to understanding ourselves./P.
Given a sequence of aminoacids (which is exactly what this allows us to do), you can theortically predict what a protein or an enzyme will look like and how it will behave. We have only had slight success in modelling this on computers. My analogy is that it's as difficult as rolling 2 dice and predicting how they're going to land. Sure, if you know their starting position, and account for every physical force that is exerted on them until they come to rest on the table, then yes you can predict their behavior every time! That's a bad analogy, but it's a good way to describe how the slightest error in measuring the forces and location of stuff can throw the predicted results way off. Remember every electron counts at that scale! So if you build these models well enough, you can for example synthesise a new protein to be used as a drug, based on the knowledge that such-and-such a disease is caused by this or that problem within a cell. ie if you know what the problem is, you can mathematically crunch with brute force until you find a model to fix it.
Legislation can be passed to prevent this sort of BSD-ish corporate cannibalization. Whether or not Celera invested millions into their research is irrelevant in the court of public opinion, where some enterprising senator will likely spin the issue as 'selling humanity' and nail Celera's more nefarious profit motives to the wall.
It's too easy not to do it (start up a backlash against patenting parts of people, as it were). The religious right will be all over it like a rash -- for once I happen to be pleased that they're a force.
Venter is a great guy, and an engaging public speaker, but he has many reasons to be bitter towards the established academic community of molecular genetics. And that's why I don't trust Celera to resist compromising Venter's stated principles in pursuit of profits.
Remember that what's inside of you doesn't matter because nobody can see it.
Knowing the amino acid sequences is a big key to being able to figure out how things work. Some examples:
There's no point in questioning authority if you aren't going to listen to the answers.
Oh, you meant here on Earth, in the present. Oops.
Damn I'm bored.
--
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
> It wouldn't suprise me to find little chunks of
:)
> "how to grow a tail" or "how to put bright blue
> pigment in your buttocks" in human DNA.
Blue buttocks - oh hell yes! I could change my name to 'Smurf-Butt'. Most excellent.
Even better - it's time to haul out those interesting science fiction books of yesteryear and find out what other cool ideas we can mine, such as:
1) Distribute the function of the heart throughout the body in smaller 'modules'. Shot in the chest? Not as big a worry...
2) Faster healing
3) Ability to regrow lost limbs
4) Better senses
5) Gills for the water-freaks out there. Hell, that would truely be awesome. Guess what - lots more usable living space on the planet just opened up - it's a little wet, but that's no longer a concern, is it? LET my castle sink into the swamp! (but NO SINGING)
6) Harder bones
7) Built-in smog/cigarette smoke filters - or filters for anything toxic. Same thing for what we ingest - e. coli & other things filtered out - lead contamination filtered. Lots of possibilities here.
8) Ability to consciously control the melanin levels in your skin - lighten or tan right away!
9) TRULY change the colour of your hair and eyes.
10) Control hair growth patterns - want JUST a mustache, and only where you want it? No problemo. The final solution to shaving. Nice.
11) Grow your hair faster - or slower.
12) Body sculpting - fat loss, muscle building, etc. Of course.
13) Height/weight adjustment
14) Change the body so we metabolize *all* food - never go to the bathroom again! Time to change the exits.
15) Natural body/breath odor eaters...I remember a novel where a artificially-created 'pleasure' female was made so that it smelled like flowers when she farted. Heh. Good planning.
16) Stronger fingernails.
17) Better skin - better at resisting cold, heat, pressure, pain, etc.
18) Upgrade the information processing capabilities - make the brain work faster, make the eyes/brain bit faster so you can see more 'frames per second'. Better hearing range - have better hearing than animals! Not sure how much that might be desirable, but you'd get used to it. I remember another novel ('Telempath', I think, by Spider Robinson), where a madman releases a chemical/virus/whatever that gives humans a sense of smell equivalent or superior to dogs - most people go insane from sensory overload, and society is forever changed for those who survive. Interesting read.
19) Okay, I want cool eyes like cats. Those just look gnarly. *meow*
20) The above-mentioned tail could be quite handy! Good for picking up chicks, I bet.
21) Fangs. 'nuff said.
22) Claws. Sure. More like Spiderman 2099, less like Wolverine
23) Hey, speaking of Spidey - how'bout natural webshooters? Nice if you fall off a building or something.
24) Better control over vocal chords - everyone becomes a fantastic singer - well, everyone has the EQUIPMENT. Still gotta get some training.
25) Total control over reproduction - sex without sperm production and egg creation.
26) Colour me like a zebra! Or not. Maybe more like a white tiger.
27) Hey - maybe I could look like one of those dancers from Cats! THAT would RAWK.
28) Read another book where they re-engineer soldiers - harden the skin, better eyesight, CNS (central nervous system) implants for access to many things. Also made the penis & scrotum 'retractible'. Okay, weird, but I'd probably opt for that.
29) hey, let's make those fangs optionally poisonous while we're at it.
30) Tentacles! With suckers..."Hi, my name is Cala. Last name Mari."
31) Feathers. Or scales. Leaves? Hmm. Great camouflage possibilities here...
32) Ohhh...poisonous spines - like a porcupine! A whole new age in warfare...
33) Maybe 'Skunk Power'!
34) Okay, now wings would be interesting - even if they're just decorative. Perhaps visions of 'Angels' in the past were just visions of the future! Think about it...you could _really_ screw with the religious folks here...
35) Everyone has total recall! And I'm not talking about that bad Arnold movie, either...
36) Radiation-proof - good for interplanetary travel. Put your DNA in constant 'Diagnostic Mode' - any damage done is immediately corrected.
37) Abilities associated with idiot-savante's - lightning calculation abilities, etc.
38) Noone is ever tone-deaf. Ever.
39) Everyone hates country music. And disco.
40) Control over metabolizing alcohol - no more drunk driving with 'InstaSober(tm) Genes from RonCo'!
41) Control over sneezing, hiccupping, vomiting, etc.
42) Control your blood sugar. No more roadrage! No more Diabetes.
43) Adrenaline control. Caffeine industry is now gone. Nice knowin' ya, Starbucks. Same for the rest of the drug industries. Columbia becomes dirt-poor again. The drug cartels start investing heavily in Celera. Celera HQ is moved to Bogata.
44) No more need for computer-generated creatures in future science fiction movies. Actors can control their own forms and voices! Pixar and ILM go bankrupt.
45) Now that everyone is so smart, the world realizes that open source software is the only way to go! The Penguin enjoys new-found popularity at zoos.
46) Mermaids become reality! Mermen, too (Aquaman!)
47) Everyone now has perfect balance and coordination - sales of inline skates, surfboards, and other such products skyrocket.
48) Telco's are pressured by law to provide fiber-optic OC48 speed access to each computer - 56K modems are just too slow for the 'brain-enhanced' public of the modern era. People can read faster than 56K now!
49) 3D chess replaces regular chess in all major tournaments. Regular chess is just too easy - commonly played only in preschool.
50) Nictitating membranes. Oh yeah.
51) And Vulcan ears, too!
52) Women become much happier with new 'Nimble-Tongue'(tm) Genes for men.
53) the N.O.W. Genetic Research Centre funds 'Vaginal Teeth' genes...ouch!
54) Basketball baskets are quadrupled in height. Football fields are much bigger. Baseball bats are made out of much stronger materials (as are the baseballs, footballs, and other sports equipment).
55) Speed limits are abolished - everyone has reaction times sufficient to make them redundant. Traffic jams are mostly a thing of the past due to this, and transportation flows much easier.
56) Since people are now smarter, mass transit & renewable energy are now in much higher demand. Pollution is demanded to be reduced, plus it's easier for the smarter engineers and inventors to figure out how to do so.
57) Wars are ended. Religions are abandoned. The Taco Time 'Crisp Burrito' is finally given the praise it so richly deserves. Telecommuting changes the face of the world when it becomes the norm. Children grow up with parents as they're also educated remotely in the same dwelling where their parents work.
58) Life is so good, the 10-hour work week becomes feasible.
59) With all the new senses humans have, art and literature, movies and music, indeed ALL creative endeavours, reach new heights, putting the classical arts to shame.
60) the new 'SmartHuman' (Homo Genius?) recognizes 'Battlestar Galactica' for the brilliant show it really was. And Pops Racer finally figures out how to put a friggin' LOCK on the trunk of the Mach 5. No more stowaways. Spridle and ChimChim can now increase the sugar in their bloodstream anyway, so there's no need to try freaky plans to get candy.
61) the ISA bus and all legacy devices that attach to it, are _finally_ dropped from computers.
Okay, so the last one is a stretch. *shrug*
The problem with the genechips (and IIRC they normally look at mRNA, not cDNA) is that there's not that strong of a relationship between transcriptional level and translational level. If you really want to know about levels of protein expression (and more importantly, differences in level of expression) you're going to have to look at the proteins themselves. Good thing that's what pays my bills. Of course then you have to realize that the level of protein expression doesn't necessarily equate with protein activity and you have to look at post-translational modifications ...
There's no point in questioning authority if you aren't going to listen to the answers.
Genome 'Dark Horse' Comes to the Fore (BBC, 8 May 00)
Dot-Comming the Genome Race Wired, 8 May 00
For more, you can see our Biotech page.
A. Keiper
The Center for the Study of Technology and Society
Washington, D.C.
A the head of Celera himself said in recent Congressional testimony, "There is no example of the results of any genome sequence project being published in the scientific literature prior to meeting the established quality, order and completeness standards. It would be poor science policy and a terrible precedent for the young genomics field." (My emphasis.)
Of course, there aren't all that many published genomes altogether, are there? Those established standards for quality, order and compelteness are arbitrary, and peer review is sort of an odd process in a case that has seen so much public political ballyhooing. With the fruit fly genome, several minor errors were discovered and corrected - but remember that even very high accuracy (say, 99.5% accuracy) can mean many thousands of errors in a database this vast.
So the next few years will be spent tidying up and cleaning up the data. But the key areas will be ascertained first, and those will get the most attention. And then - even as we speak - people will be busy annotating, and trying to find correspondences between gene sequences and phenotype - that's the huge task of figuring out just what this vast porridge of G, C, A and T means.
For more, see our Biotech page.
A. Keiper
The Center for the Study of Technology and Society
Washington, D.C.
What we'll do when the human genome is completely mapped is being discussed almost daily among scientists. The post-genome era has become a big buzzword.
One very convincing idea goes like this:
- you have a problem that you'd like to tackle
- analyze sequence data in lioght of your problem
- filter out interesting trends/data points
- develop a high-throughput assay to test for what the sequence data implies
- analyze test data
In other words, start on the computer, end on the computer, work in the lab in between. Sort of like what we do with literature already. You can, of course, compare the genome and related sequence data to literature anyway. It simply has be be read and understood. (No that we know a lot about the latter activity, but that's another story.)
At a recent event I attended, an intersting example was given by Dr. Wei Hu, formerly of Human Genome Sciences, Inc.:
They were interested in prostate cancer and therefore looked at ESTs (expressed sequence tags) from tissue samples of various stages of prostate cancer, as well as several other unrelated tissue samples as controls. The analysis simply consisted of looking for sequence tags that consistently turn up in prostate cancer, but not elsewhere. Half a dozen or so sequences were found and most proved to be known markers for prostate tissue, especially cancerous prostate tissue, but one or two were new. This all was only a few hour's work.
Further research might then entail chasing these new markers, perhaps developing a simple and cheap assay for them, and voila, a new test for early stage prostate cancer. In practice this is of course not nearly as easy as it sounds, but you get the idea.
With the complete human genome available, one would of course compare the sequence tags against the genome to find where they are, with what other regions they are asociated, what gene they come from, etc. This would dramatically increase the information content of the simple exeperiment that was done and described.
The upshot IMHO is that biologists will dig much less in the dark, at least as far as sequence information goes. Checking the genome and other sequence databases will be just as mandatory and routine as a trip to the library is today. This in turn means that biologist will have to become much more computer-savvy, or that biologists and computer geeks need to develop closer ties.
One thing to keep in mind, though, is that the upcoming announcement is only for the mapping of the human genome, i.e. known markers will be placed along the genome in more or less regular intervals. This amounts to a lowres image plus many (most?) parts of a highres one. The actual full genome sequence is still a ways off as gaps need to be closed in difficult regions and other boring cleanup work needs to be done.
I hereby declare my own genetic code open to the public. Anyone may use, modify, and distribute any base pair sequences that are part of me.
Interested parties may obtain samples by sending cute women to collect them. Due to restrictions imposed by nature, and the fact that I hate needles, samples may only be collected in halves, through all-natural means. Putting these sample halves back together again is your own problem.
(Well, I thought it was funny...)
---
- Give a man a fire and he's warm for a day, but set him on fire and he's warm for the rest of his life.
Sure, having the human genome completely mapped will help devise treatment for illnesses caused by genetic irregularity (such as Sickle-cell anemia). But genes are only one of five causes of disease:
Having the Human Genome to work with will allow researchers to develop treatments/cures to many diseases, but at what cost? At the dawn of the nuclear age, the power of the atom was seen as the solution for all the problems the world faced. Fifty five years later, we are stuck cleaning up the messy legacy that nobody wants. Today's genetic scientists will likely use the genome to devise genetic solutions for health problems, when no genetic problems exist in the first place. What happens when some scientist creates a genetic therapy treatment for Scurvy, when the only "treatment" needed was to pick up an orange at the store?
see this page for some provacative ideas on being healthy...
Learn the rules so you know how to break them properly.
www.teslabox.com
Please note that "unitedstatesian" could also refer to the "United States of Mexico", the official name of our southern neighbor. Please do not confuse the readers.
:)
-Dean
After genomics, the science of genomes, the next level will be *proteomics*, the study of total the protein content of a life-form, protein interactions, and their chemistry. I have seen Craig Venter speak twice this year and both times he has indicated that proteomics is where his true interests lie. Venter started out studying proteins. If you want to understand anything in life, from what makes an arm shaped like an arm, to what makes a schizophrenic, to how a virus infects you, you have to understand proteins. Proteins catalyze almost all of the chemistry that goes on inside an organism. Studying them is quite difficult (it's the subject of my dissertation), but the rewards are boundless. (Side note: RNA can also perform chemistry, e.g. ribozymes) Take AIDS. There's a protein called "HIV protease". Chemists determined the precise 3-D structure of it, modeled it on a computer, and then screened a database of compounds to see what structures would "dock" into the business end of this protein and jam up it's ability to perform it's role in HIV. They came up with candidates, made a library of variations and viola! they made one of the first anti-viral drugs. Take superoxide dismutase. (SOD). This enzyme/protein helps scavenge toxic superoxide from your cells keeping them from getting damed by metabolism and such. If you take the gene for this protein and introduce it into a fly via a virus, you can double the life span of the fly! There is no limit to the impact of all of this, but the real exciting stuff is not the genes, but the proteins that they encode. And that is why Venter is working with PE Biosystems to make new machines that are suited for studying things like protein expression patterns. It's a wild time to be a biotechnologist. I feel like a physicist at Los Alamos. I plan to celebrate on Monday, but I feel like I'm celebrating the end of the world. O'Biquody
Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?
The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation.
That's about to change, big time!
A hack using a combination of DNA and RNA has been constructed, which zeros in on a particular site on the cell's DNA, clamps on hard (using the RNA portion of the composite molecule), and prompts the cell to make exactly the desired edit (apparently by convincing the DNA repair enzymes that there's work to do).
Not only that, but if you just put the DNA/RNA hacking molecule OUTSIDE the cell and temporarily tweak one parameter (pressure, I think it was), the cell takes up the molecule and transports it to the nucleus.
So you can edit cultured cells in the desired manner, then implant them in the patient. If the disease is, say, an enzyme deficiency, you're done.
Edit some stem cells and inject them, and they'll replace or gradually convert whole organs.
If you need to work on a lot of cells in some tissue of the patient at once, you might be able to just shoot him up with this stuff until his cells are swimming in it, then pop him into a hyperbaric chamber to get the cells to take it up. If that doesn't work, try using viral envelopes as nanotech syringes.
There's LOTS of possibilities. The revolution is almost upon us.
Bantam Dominique roosters crow a four-note song. Once you've heard it as "Happy BIRTHday" you can't NOT hear it that way
Once you've got one sample, you need to check it against others to find the variations (especially: to find the oddball stuff unique to the baseline).
But that's a LOT easier once you've got the baseline established. You can hybridize the baseline DNA strands with strands from the new target to zero in on the differences.
Meanwhile, you can work with the baseline to identify the location and function of each gene. You start examining the variants as they become available.
Bantam Dominique roosters crow a four-note song. Once you've heard it as "Happy BIRTHday" you can't NOT hear it that way