Slashdot Mirror
Hilary Rosen Defeated at Oxford Union
yogi writes "Oxford University Students' Union had a debate last Thursday, titled This House believes that 'the free music mentality is a threat to the future of music.'. Ordinarily, not too exciting, but since it is the Oxford Union, they get Hilary Rosen to speak. She lost the debate, and had to have pictures like this taken. Read the writeup at NTK, or a more detailed one here. I especially like the bit where she asked all the file downloaders whether it made them buy more music."
subject sez it all.
Gee, from the title it looked like it was a military defeat, but I guess this will do ;-)
Free Java games for your phone: Tontie, Sokoban
Does anyone else start getting sick of this? The debate is getting so old and the only people saying free music is damaging is some of the artists and the RIAA. I guess it will end up being like open source vs. closed source - and I bet the artists who embrace allowing online downloads will be more sucessful in the end (of course when I make that comparison I also mean that the artist is signed up with a label because they need some form of money - but yet some artists still support downloading their music for free because they have read the research). Hope that all makes sense. What do you think?
My blog [.net, rants, general IT]
When is this freak going to suffer similar humiliation and defeat?
Hilary Rosen asks "Put up your hand if you download and burn music" (most hands go up). She then asks "Keep you hand up if you buy more music because of it" (many stay up). She gets worried and immediately asks some different and confusing set of people to put their hands up, causing everyone to look miffed, and everyone putting their hand down)
I call BS on this. What was the "different and confusing" set she asked for? I have a feeling it was the interesting part of this exchange... pop culture already tells us we should raise our hands for these first two questions.
I read the article :-)
http://www.geekstyle.co.uk/ntkmart.cgi#Corrupt
Keep the Classic Slashdot.
Just look at that binder she's holding - full of arguments and facts about why the evil music pirates are devastating the economy, yet she still gets beaten by a couple of punk college kids.
She deserves a pat on the back, for at least trying to defend the glorious RIAA's noble quest against piracy (also known as "fair use")
I really feel that the music industry has, quite simply, realized that they're on the out-and-out, so to speak. With the advent of faster networking technologies over the past few years, and the number of kids attending 4-year colleges (all of whom have broadband connections), the industry truly feels that they lose $0.20 with every *.mp3, *.ogg, and *.wma file that's exchanged via TCP/IP.
Here's some sage advice (from here originally): "If you really want a change, don't vote for either party -- vote Libertarian if you're on the right, Green Party if you're on the left, and independant otherwise. Both parties are in the pockets of big business, and that's bad both for those who advocate freedom from the government as well as those who despise deregulation.
The more we have third party, the closer we get to fairer, European-style representation."
If you celebrate Xmas, befriend me (538
It'd be nice if we could have this sort of debate and result happen someplace it really matters like Congress :)
This sig has been temporarily disconnected or is no longer in service
to go to a university only to face a crowd of filesharing student can either be pictured as stupidity or courage, so let's at least give her that: she was coureagous. She ran into the wolves house!
About the filesharing issue? Depends on wether you recognize intellectual property as a valid concept or not...
http://www.pageliberale.org
...why the debate is framed as free music v. the music industry. We can decide to dislike both sides, and still get free music -- by encouraging musicians to self-publish either samples or entire albums as freeware or shareware. For those without internet connections and CD burners, music stores could offer a write-your-own-CD services (and I think I've seen this in prototype?).
Up to now the recording studios have been like the cartoon syndicates -- a necessary evil because they control the production, distribution, and promotion of music, with staggering overhead. Why does a 25 CD cost $18, anyway, about what it cost when invented 20 years ago? How many non-geek consumers know about this profit margin, and how loudly would they complain if they did?
It should be pointed out that the Oxford Union :-)
(which is where the debate was) isn't the same thing as the Oxford University Student Union. Probably only really of importance to people in Oxford, who know this anyway, though
Hilary Rosen is a woman.
SpamNet - a spam blocker that really works
I agree. It's getting to the point that EVERYONE has chosen sides and the resulting debate has a decidedly religious flavor (ie, no one will ever switch sides from this point on).
Interesting analogy. I have to agree with you: there is so much conflicting data that everyone seems to have made up their minds on the basis of their gut feeling. I imagine there isn't any way of resolving this.
However, I would think that we (the pro-filesharing crowd) could use this ambiguity to our advantage. The **AA wants to limit a powerful technology and impose some dubious laws. And they don't have any iron-clad statistics to back them up. It seems that the burden of proof should be on the **AA to show that filesharing definitely hurts sales. If they cannot show this -- and I don't think they can -- then all their technology-limiting plans should be rejected by the lawmakers. I'm not so naive that I believe this is going to happen, I'm just stating that in a perfect world this non-provable postulate that filesharing hurts sales should be a victory to us. There will always be people who have a "gut feeling" that this is responsible for the financial woes of the music and movie industries, but that shouldn't be enough to enact laws!
GMD
watch this
Reassuringly, the motion that "This House believes that the free music mentality is a threat to the future of music" was resoundingly defeated by a hefty 256 "Noes" to 72 "Ayes"
This is more of a popularity contest than a true debate. The RIAA's position is never going to be popular with an illegal file-swapping crowd filled with university students.
Regardless, The RIAA has every right to pursue its goals (i.e., profit) using legitimate business practices.
The RIAA is perfectly allowed to sell music using any method they want. It does not matter if downloaders purchase more CDs due to free advertising. If you believe that start a new record company with free music from your site. Nobody has a right to force a new distribution method on someone else. I prefer the BSD license, but I don't go out and illegally change GPL software to BSD. People have the right to use any license they choose. Similiarly, artists have the right to release free music if they want. They are not forced to sign a contract with anyone. Plus, the distribution method of choice - the Internet - is perfected suited for free music.
If you go into a competition and everyone expects you to loose, but you don't loose as badly as expected then people will notice that and take more notice of you the next time.
Hilary may well have thought that they wouldn't out and out win a debate in such an environment but thought that it was still worth the effort. A strategic defeat perhaps.
Or...
This all reminds me of my old boss; 70+ yr old Jewish man from NYC who used Napster to download old speeches (Winston Churchill was his favorite) and such other things that were hard to find anywhere locally (library etc). He never once used it for music.
to go to a university only to face a crowd of filesharing student can either be pictured as stupidity or courage, so let's at least give her that: she was coureagous. She ran into the wolves house!
Disclaimer: because of the poor write-ups posted, I don't have a good idea of what actually happened at this debate and how fair it was. With that in mind, consider the following theory: Hillary figures she can 'win' no matter how the debate turns out. She has a chance to talk to the crowd that are the biggest filesharers. This is her chance to hopefully convince them that what they're doing is wrong. With a little luck, she'll be able to convince someone in the audience who happens to be in a position of power regarding the computer facilities of the school. She figures if the debate is 'fair' that she's got a reasonable chance to getting her message across. She won't be able to convince those whose minds are already made up, but perhaps she can bring a few students back from the Dark Side.
Now consider the case of an 'unfair' debate. If the debate is 'not fair', perhaps some students will realize that and sympathize with her. But even if she isn't able to convince anyone in the crowd that her position is right and the whole debate ends up being a crazy show, she can then take a videotape or transcript of the 'unfair' debate with her to other people (like politicians) and use that to convince swing-voters that the pro-filesharing crowd is just a bunch of hooligans. She willingly goes into the lions' den to gain sympathy from others when she shows them her 'scars'. "I tried to explain my position and look how they treated me? They're animals!"
This is just a theory. But to characterize her action as either courage or stupidity leaves out another very real possibility: calculating.
GMD
watch this
This summer, I had the opportunity to help officate at a debate held at the Oxford University Student Union. This was for an XML course that was developed by a consulting firm that was presented at the University. During the summer, Oxford hosts a significant number of for-profit and non-profit organizations holding conferences, seminars, and the like.
The city of Oxford and the University are stunning. If you've never seen them, you're missing out.
The debating hall is laid out similarly to the House of Commons, which us 'mericans sometimes get a glimpse of on TV.
At the head of the room is the debate chairman, who presides over the debate and makes sure that the rules are followed. To his left and right are the Union treasurer and librarian. Since this wasn't an "official" Oxford Union debate, all three of those roles were held by participants in the XML summer course. I sat to the left of the chairman, and helped decide matters of debate procedure and scope. (Don't laugh; there actually was one matter to review.On the main floor of the debate chamber is the Secretary's desk. The Secretary likewise assures debate procedure is followed and assists the chairman in doing so.
On either side of the Secretary's table are the proposer of the motion, and the opposer. Each of them leads a particular side of the debate.
Around all of them are the seats for the participants, arranged on both the main floor and a balcony surrounding everything.
Perhaps the most interesting feature of the debate hall are the doors. On the way in, they look like simple double doors. Only when you are inside can you see that over the right door reads a sign saying "Yeses", and over the left door "Noes." At the end of the debate all participants file out through those doors, their numbers counted by the Secretary as they pass. Then everyone files back in to hear the results read.
The Oxford Union is one of the oldest free speech organizations in the world, and certainly deserving of respect on that basis. The debating hall is a monument to civil society and free speech. The Union is also a completely private institution: a true union of, by, and for Oxford students.
Now, having said all of that, the fact remains that a debate at the Oxford Union is just a debate. It's not a UN Security Council resolution or a Supreme Court judgment. It's just the opinion of a bunch of people who happened to be in the hall at the time as to whether the proposer or the opposer made a better case for their side.
It's all good fun, and much needed at that. But let's not get all worked up about it.
This House believes that 'the free music mentality is a threat to the future of music
Well, "this house" believes that it is rampant commercialism that is actually a threat to the future of music.
She was in a room full of people who buy and listen to music.
This is definitely NOT the place for an RIAA exec to be. They should be with other executives and the occasional politician. That way they can avoid the whole issue of customers and business models, and focus on what's really important: new legislation.
Considering how online-centric we are now, how valid is it to ask about dirtworld CD sales without finding out what kind of behavior consumers would have, if it were easy to buy the music they like online, for digital download, with price-parity with CDs, adjusted for savings in fabrication and delivery costs.
They're asking us to pay for a distribution system we don't need, and that's what offends me as I'm struggling to tear off the stupid sticker holding my new CD's jewelcase together before I put the disc into the reader to be encoded to the only format I use anyhow.
Kevin Fox
does anyone other than me find it interesting that the chief exec of chrysalis is on one side ( Chris Wright ) and the co-founder ( Doug D'Arcy ) is on the other? I can just see the post-debate conversation :
...
Chris : Doug, you know, the board has been thinking about your future here with the company...
Doug : Yes, really?
Chris : Well, with the beliefs that you have espoused, and your stance on some matters, we've been thinking that it might be time for you to move on to other projects...
Doug : Remember those pictures of Hilary, you, and an inflatable sheep? Well, I still have the negatives...
Chris :
on a side note, is anyone really surprised by their defeat? they are wrong on most of these issues, and really have very little evidence other than FUD to back anything they say. no big surprise there.
PC moderators can suck my White pierced, tattooed dick. If you think pride == hate, s/dick/Aryan meat mallet/g.
I told the FBI about someone that is linked to credit card identity theft and presented the evidence. This person also told me he downloads mp3's of popular music, burns cd's, and sells them to friends, which I related to the FBI as well. Why has there not been an investigation?
Popular music is a joke and its thieves are even more of one. If it is such a horrible crime, why doesn't the FBI and RIAA start making some arrests?
So yeah, I'm gonna download songs from the album first before I buy the CD because I'm not paying $15 for 1 (one) song I liked from the radio.
Provided you know which track you want to keep, then download the song on Rhapsody ($1/track) or eMusic ($15/mo), which are legitimate sites that have licensed labels' catalogs.
Will I retire or break 10K?
You can always spot a poor debater when they ask a question they do not know the answer to. That is always the key: reduce the argument to only the points where you are unequivocally right and your opponent is not. Of course your opponent is trying to do the same thing.
And the big "raise your hand" thing doesn't prove anything. It is like "proving" someone has no business talking about African economics if they have never been there. It is all opinion and subjective, like those CNN polls.
In the end I just see this as broadening the rift. She now can be assured that most students out there are "pirating" music and thus beyond communication. Likewise everyone else here is treating this like it means anything. The RIAA will probably just go and get more federal signatures while we sit around feeling all good about this "victory". And its that sort of thinking that will probably mean we will never get the compromise we ask for.
Demanding total victory is asking for total defeat.
What is music when you despise all sound?
>> Regardless, The RIAA has every right to pursue its goals (i.e., profit) using legitimate business practices
Bribing Congressmen to pass a rampantly unpopular law that criminalizes fair use copying rights does not fall under the heading of "legitimate business practices". Neither does deploying technological measures to make it impossible to exercise said rights.
I'm disgusted by how many so-called libertarians are so quick to jump to the defense of the RIAA when it's obvious they have no interest whatsoever in playing by the rules of the fair market. The market has sent a pretty unequivocal message that they want the middle man out of the loop, so the middle man tries alternately to make it either illegal or impossible not to play by their rules. Bleh.
25% Funny, 25% Insightful, 25% Informative, 25% Troll
Hilary Rosen was a woman.
Not that I am personally interested, she isn't my type. ;)
Even if she was your type, I don't think she'd be interested in you. Look here. The person that she is married to, if she is in fact married, is missing something that most of us Slashdot readers have. (I won't go any further than that. I'm assuming most here are males and have not had some kind of freakish accidents).
It is good that these types of debates go on, but at this point how does this even matter? We all know Rosen is not going to be like, "Oh, I was wrong after all, music should be free for all." And nor is the opposite party going to say, "Damn, we are horrible people for stealing those poor people's livelyhoods from them."
No one is going to change their position. On top of that, this nice little debate is more or less useless. None of those students are congress people, and Berman is has shown his resolve. Nothing has changed in that exchange; we are still hurtling towards an unknown conclusion which this debate does nothing to address or even pretends to address. In the end, the students went and drank some beers and the 'big-wigs' went back home to their legal documents. This is an intellectual excersize and shows zero results other than some transcriptions and a couple webpages. We would be better off sending mailings to our representatives than listening to some nice, feel-good debate that made Rosen look foolish for a couple minutes.
"What can a thoughtful man hope for mankind on Earth, given the experience of the past million years? Nothing." -Bokonon
We all know that this is literally true. No one is forcing these people to sign contracts. I wish some of them would have been forced not to sign contracts, in fact. I'd have held the gun on Don Henley. If I'd have been alive then.
I'd have held two guns on Rod Stewart.
But on the other hand, if you want to be a music superstar, you have to sign a contract with a major label. Otherwise you don't get put on MTV/VH1, you don't get put on Clearchannel, you don't get put in the major record chains across the country who are penalized (by withholding of ad material and certain albums, or pushed-back release dates) for stocking music which doesn't come from a member of the RIAA.
So sure, no one is forced to, but you cannot "win" the game (assuming you are measuring success monetarily... at least it's a numeric metric) without signing with a major label.
"You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
As another Libertarian, I agree wholeheartedly with you.
In fact, I often find myself at odds with other Libertarian-leaning individuals on the whole copyright/piracy debate.
Certainly, Thomas Jefferson himself was not a fan of the ideas of patenting ideas or extending terms of copyright out to great lengths of time.
"It has been pretended by some, (and in England especially,) that inventors have a natural and exclusive right to their inventions, and not merely for their own lives, but inheritable to their heirs. But while it is a moot question whether the origin of any kind of property is derived from nature at all, it would be singular to admit a natural and even an hereditary right to inventors." - Jefferson
"He who receives an idea from me, receives instructions himself without lessening mine; as he who lights his taper at mine, receives light without darkening me." - Jefferson on Copyright
I'm an RIAA detective and my partner and I noticed that you were singing. May I please scan your universal id card. Enter your secret password, please and I remind you that refusing to supply your passcode is an offence.
It says that you are not licensed for singing. You haven't submitted the proper fees. Your cable bill is also overdue. I suggest that you take this summons and pay the fine and get these matters in order.
(There was music before the music industry and there will be music after.)
"You do NOT have the right to violate copyright"
I'm sorry, but I simply don't just see the law as right and prohibitions that I should take for granted. I have a mind of my own. If I want a law overturned the easiest way will be to show people how much better the world is without that law, i.e. breaking it.
Especially if the law was passed over my head, against my will and the will of my peers. If the law contradict our ethics and morals. How can we be espected to abide by it?
The geeks created the beauty of the p2p nets, decentralized infrastructures of information and art (and hot grits, but that's beside the point). Was it illegal? Possibly (the law is vague). Was it a Good Thing? Yes. It's beautiful. It's functional. It's practical.
We've seen no decline in production of free software and of free, alternative music, free books and free documentation.
Interesting times and I'm almost holding my breath with anticipation.
For more interesting debates like this, check out Radio EFF. The Lessig (Standford Law, EFF) v. Valenti (MPAA) debate mp3 is here.
Keep you hand up if you buy more music because of it"
Hmmm... heard Funker Vogt on shoutcast a few weeks ago.
Enjoyed it. Downloaded a few tracks via gnutella. Yup, this definitely is a group I like.
Went to Best Buy. WTF? No Funker Vogt. Went to CD Warehouse. Nope. Never even heard of them, let alone my fav Apoptygma Bezerk, VNV Nation, Front Line Assembly, etc. "Sure we have industrial..." as the salescritter points at the rap section (ugh... where do they hire these people from?).
So Ms. Rosen, how am I supposed to be a complying RIAA citizen when you won't even sell me the music?
As usual, it was off to cdnow.com, buy one of everything Funker Vogt, and wait for the UPS guy.
Conclusion:
1. I'm waiving money in your face but you won't sell product to me.
2. You can't seem to figure out how to distribute music worth a damn.
3. You keep signing a few worthless artists and pumping their music (while we still don't buy it), rather than understanding the market changed on you.
4. You and the radio broadcasters sign deals trying to limit airplay to the same crap you signed, but now the radio broadcasters can't find listeners and had to destroy Internet broadcasting before it destroyed them.
So, maybe there's another problem that explains why your sales numbers suck?
*scoove*
I've got a video clip of a guy trying to TURN HIMSELF IN to all levels of government, he starts with local police, they refer him to the mayors office. the mayors office refers him to the attorny general, and they refer him to the maker of the program he claimed to have been pirating (microsoft)... well, in the end, no one would send a police officer down the street to arrest this guy on software piracy charges, or even file some kind of report! the worst thing they told him was to either delete or buy it, but not once did they offer to arrest or prosecute him. he was even begging to be arrested, and they declined. i know piracy is illegal, but if you dont make profits on it, there's a VERY low chance of anyone getting in trouble from police... almost every cd that i've purchased i've discovered/previewed with mp3 downloading. i attempt to be one of the semi-honest music downloaders... downloading/listening to lots of stuff, but buying the good cd's. the RIAA is just scared that people wont buy CD's for 1 song anymore.. i sure as hell wont, i'll listen to almost 1/2 of an album before i'll buy it. same thing with many people that I know. I dont think I've met many people who have 400 CD-R collections of full pirated albums. also, couldn't mp3 recordings be considered "time-shifting"? time-shifting is the same principle that keeps Tivo's legal. you can either listen to crappy radio (or crappy tv/commercials) and wait for the good stuff, or you can just (record it with tivo) download it and listen to it repeatedly, or at your leisure. effectivly, both with tv and music, the conecpt is to record/obtain a recording of a show/song and view/listen to it anytime? just a few thoughts...
This may sound a little odd, but I feel sorry for Miss Rosen. She is, after all, merely trying to do her job of defending the recording industry and its business model. I think it would be fascinating to sit down with her over lunch and listen to her side of the debate without so much of the hype that seems to accompany this topic. I do not think she would convince me to see the world her way, but it would be an interesting way to spend my lunch hour. Who knows, she might just be a very nice person outside of the Internet music nastiness we are all familiar with.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
They need to understand that modern consumers, many of whom are now college students, are less and less frequently buying music by artist or genre. It is becoming far more common for consumers to acquire merely the songs that they like. Since the music industry refuses to accept this mentality, filesharing is the most effective way for consumers to acquire only the music they want. Until the music industry realizes that there is a lot of profit to be had in giving consumers exactly what they want, they're going to continue to suffer whatever losses they suffer now. Music distributors must have the authority and means to give consumers exactly the songs they want. If consumers can cheaply rip-mix-burn, there is nothing preventing music producers from doing so even more cheaply. If they do not make these changes now, when the university students become adult consumers, the music industry is really going to feel the pain they've been complaining about all this time. There's no reason why they should not take steps to prevent such discomfort, especially since doing so would probably increase their profit margin, since it would draw in people who currently avoid commercial music, for the inability to avoid the 6 bad songs that come with the 3 you like.
Virtue finds and chooses the mean.
Aristotle, Ethica Nichomachea
I'd also say that this was a stacked audience. Let's see, you have a bunch of college students that use p2p on a regular basis, many of whom were spreading anti-RIAA propaganda
I followed the discussions and preparations in the CDR, although I didn't go myself. I have to say that we were not at all sure that the debate could be won. Oxford is a very strange place, and Oxford Union is stranger -- a private members-only debating society which perhaps could be described as a little bit elitist.
As to why Hilary Rosen chose to go to an debate with students -- it is because of the prestige of debating in one of the oldest debating societies in the world. You have to dress up (black tie for men), you go to a special dinner with weird and ancient customs (if you've never been to an Oxford college, you have no idea!), and so on and so on. Take a look around the Oxford Union site.
Also, with a place like Oxford Union, this isn't some shallow debate. Rather it prides itself on getting to the bottom of the issue, with lots of intelligent minds on the job. If the RIAA's case stood on logical grounds, she would likely have won the debate. That is why this is a significant result! The truth of the matter is that even with all the conservatism of Oxford, Hilary and friends couldn't make their arguments stick.
Any government must get support of >50% of parliament, that is of the votes (since parliament is elected almost proportionally to the votes). So 2 or more parties must cooperate in a coalition; in practice it is seldom that one party gets a majority, so you get always coalitions.
This creates centrist policies, because the government partners must give and take, so you get more consensus based government style. In the U.S., while as single parties the republicans and the democrats may be closer than some parties you find in Europe (including the so called populists), any party has to give in so in the end the goverment is more moderate, and less susceptible to sudden changes after new elections.