Slashdot Mirror


Antibiotic Resistant Staph Infections

LinuxGeek8 writes "There's a news update on a previous article about the first case of antibiotic resistant staph infections. The woman who has the infection is being kept up to 6 months in an isolation room. She is taking an antibiotic that is working, after many others did not. "In the scheme of public health threats, this has to rank close to the top," David Ropeik, director of risk communication at the Harvard Center for Risk Analysis, said of antibiotic resistance."

59 of 621 comments (clear)

  1. "hey mom" by Anonymous Coward · · Score: 5, Funny

    thanks for making me use all that anti-bacterial soap all the time. now i'm locked up in a room for 6 months.

    1. Re:"hey mom" by duncan7 · · Score: 5, Insightful

      Antibacterial soap doesn't contain antibiotics, as far as I know, and certainly doesn't contain Vancomycin.

      Now, "Hey, Mom, thanks for taking me to the pediatrician for antibitoics every time I got the sniffles," is another matter, entirely.

    2. Re:"hey mom" by NoData · · Score: 5, Informative

      What differentiates "antibacterial soap" from "soap"?

      One word: Triclosan.

      This is an antibacterial agent commonly used in all sorts of consumer products including deodorant soaps. If it's for your body and labeled "antibacterial" check the ingredients. It probably has triclosan. While it is certainly not an antibiotic per se, bacteria can grow resistant to it, producing more virulent strains. See here for a good discussion.

      A recent article (too lazy to google again) recently suggested antibacterial and regular soaps do an equally good job of cleaning you of bugs anyway.

    3. Re:"hey mom" by fishbowl · · Score: 5, Informative

      First of all, the strain resistant to vancomycian has been known since 1993, so sensationalism aside, it's hardly news. I myself experienced this in 1996, after getting the same infection from a stream in Missouri; and I *almost* lost a toe because of it. A more powerful antibiotic, that I wish I could remember the name of, took care of it. By the time I realized it was a serious enough infection to go to the hospital, it was almost too late. (I discussed it in a usenet thread way back then, perhaps I can google it back out).

      Now, to the "Antibacterial Soap"

      What gives "Antibacterial" soap it's antibacterial property is mainly the molecular structure of the soap. It is lipophilic detergent, which impedes the cell membrane (of the bacterium), essentially stopping it from passing water either way (study the Fluid Mosaic Model to understand cell membranes).

      I would imagine that olive oil has as much "antibacterial" properties as a grocery store "antibacterial" soap; so would a soap made from animal fat for that matter.

      My understanding is that what makes Triclosan so special is, it simplifies (economizes) the manufacturing process, because it is less expensive to formulate triclosan than the alternatives with similar properties. I'm not trying to say that it doesn't kill bacteria -- it DOES kill bacteria, but the WAY it kills them is through a simple physical process.

      I wonder if the patent has had any relationship to the sudden adoption of this chem in practically every personal care product on the shelf?

      --
      -fb Everything not expressly forbidden is now mandatory.
    4. Re:"hey mom" by _ph1ux_ · · Score: 5, Interesting

      one inmportant thing to know is that it is not good for you to use soap on your body every time you shower.

      you should actually use it more like twice a week. (a full body lather and scrub that is) even then it may be too much.

      and you should rarely use harsh soaps on your face. I ahve a friend who is always buying "anti-oil this" and other crap products and special soaps for her face. She claims that she needs them because she has really oily skin. and that she needs to wash with it every day. She washes her face in the morning - and before she goes to bed. I told her that the reason she is so oily is because she is using that crap. That what happens is the soaps wash off the natural oils and bacteria that your skin is *supposed* to have on it. But since she uses this toxic stripping soap on her face all the time - it causes her skin to over oil in attempts to compensate. The only time she should actually use soap on her face and whole body is when its actually dirty.

      For 99% of the time you can use a *hot* shower and a *hot* washcloth on your face and skin. This will get rid of most anything. you dont need to use soap on your face and body every time you get wet. its bad for you. the *only* reason they tell you to do this is to get you to buy worthless products.

      The cosmetics industry is a sham. Those designer shampoo (hence the name) products you buy use about 3 cents worth of the standard detergent Sodium Lauryle Sulfate. (which some people think cuases cancer - I have no idea if it does, I just know it gives me dandruff so i stay away from it)

      All the other ingredients in shampoos and conditioner are mostly garbage...

      Anyway - the point is that you have bacteria on your skin that your body *needs* and you should not use soap very often. Just use hot steaming wash clothes to wash your face.

      I have perfect skin, no oil and never any zits, and no BO. I almost never use soap. I use soap when I am actually DIRTY - like after paintball for example.

      The bacteria on your skin and the oils you produce will typically be in balance - unless you are doing activities that cause a lot of sweating in a dirty environment - or you dont shower every single day - then you dont need soap.

      (but you should wash your hands with soap - even though the crappy detergents ruin your skin)

      And you should avoid antibiotics like the plague - unless you actually have the plague, then they are a good thing (TM) :)

      (seriously - take these as rarely as ever possible)

    5. Re:"hey mom" by nurightshu · · Score: 5, Funny

      You're French, aren't you?

      --
      They that would sacrifice their .sig space for that cliched Franklin quote deserve neither.
  2. It does rank up there.... by i_want_you_to_throw_ · · Score: 5, Insightful

    What doesn't help is the way that antibiotics have been indiscriminately and thoughtlessly prescribed these last several years for even the slightest ailments.

    Then there's some research suggesting that feeding antibiotics to animals isn't such a great idea either since all the nasties associated with that can be ingested later by humans. Try googling for the info

    1. Re:It does rank up there.... by rodgerd · · Score: 5, Insightful

      Unfortunately, patients are part of the problem - Gps are often pleasantly surprised when I don't want drugs as the automatic response to a problem, because most patients are aggressive abour demanding them, and too stupid to use them properly.

  3. Re:Well that sucks.. by silvaran · · Score: 5, Informative

    West Nile is a virus. There are no antibiotics for viruses, only treatments and immune shots. Immune shots allow our own bodies to make antibodies against viruses, so they shouldn't be susceptible to a similar problem with viruses (although immune shots must be taken at least several weeks before exposure to the virus).

  4. Re:Irradiation is the answer by Viking+Coder · · Score: 4, Funny

    Watch, it'll become immune to radiation. Now THAT's a scary bug.

    --
    Education is the silver bullet.
  5. all the more reason by Maskirovka · · Score: 5, Funny

    to quit washing your hands! the more bacteria resistant YOU are, the less you have to rely on artificial crutches like antibiotics.

    1. Re:all the more reason by fishbowl · · Score: 5, Insightful

      You are probably joking, but there is some credibility to the theory that, when we started living indoors, sterilizing our environment, using lipid soaps ("antibacterial" is only new in the Marketing sense), taking antibiotics, and so on, we diminished our exposure to pathogens. Way back when, routine exposure to such things as polio and smallpox led to infant mortality rates that we would not tolerate today, but also bestowed on those who survived much more immunity to disease.

      --
      -fb Everything not expressly forbidden is now mandatory.
  6. this is disturbing. by Unknown+Poltroon · · Score: 5, Funny

    Luckily, i take my cipro once a week, so this shouldnt bother me.

    --
    All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
  7. Re:DNA Theft by egeorge · · Score: 5, Informative

    It is fairly common for many types of bacteria to swap genes. I don't think it is very common that you can observe such a concrete trait being transferred from one species to another.

  8. Re:DNA Theft by Professor+Farnsworth · · Score: 5, Informative

    It's not so much 'theft' as 'mating'. . .gene exchange is just one method by which bacteria maintain genetic diversity.

  9. It helps to read the article by burgburgburg · · Score: 5, Informative

    If you'd read the article as opposed to jumping at the opportunity to blame animal farming, you'd have read the vancomycin resistant staph infection (and it's presence in the Detroit area) is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users from the 1970's. They were attempting to avoid infections.

    1. Re:It helps to read the article by Anonymous Coward · · Score: 4, Funny
      is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users from the 1970's.

      Oh great, ANOTHER reason why I picked the wrong day to start using heroin.

    2. Re:It helps to read the article by jericho4.0 · · Score: 5, Interesting
      There are many reasons behind the emergence of drug resistant strains. I would think that the biggest one is over-prescibing by doctors, often in cases when the drugs will do nothing (viral).

      Along with extremely high antibiotic usage in the meat industry, there's also anti-bacterial soaps, drug-hoarding of precriptions, not finishing a prescription, and the hospital setting itself, that provides a wonderfull proving ground for infections.

      Some friends of mine work in medicine, and this is a big topic for them. And us soon, I guess.

      --
      "A language that doesn't affect the way you think about programming, is not worth knowing" - Alan Perlis
  10. Resistance or Darwinism? by MongooseCN · · Score: 5, Interesting

    Has the bacteria really developed a resistance? Or have all the non-resistive bacteria died off and now only resistive bacteria remain?

    1. Re:Resistance or Darwinism? by jonabbey · · Score: 5, Interesting

      Bacteria are very unlike higher animals. Bacteria aren't restricted to darwinian evolution. They sometimes just grab genes from things they eat and incorporate them into their structure. Some bacteria even take the presence of antibiotics as a sign to spew out copies of their drug-resistant genes.. such bacteria 'remember' that those genes helped them out, and share the wealth when they are attacked. Antibiotic-resistant bacteria are an obscenely dangerous threat.

      See Bruce Sterling's excellent article, Bitter Resistance for far more information than you wanted to know about drug resistance in bacteria.

    2. Re:Resistance or Darwinism? by mesocyclone · · Score: 4, Insightful

      Bacteria aren't restricted to darwinian evolution. They sometimes just grab genes from things they eat and incorporate them into their strucure.

      This is still Darwinian Evolution. After all, Darwin didn't know about genes at all - and certainly not DNA! How the genomic change occurs is not an issue with Darwinian Evolution. Darwin's insight (others had this too, btw) was how natural selection worked to produce variations and new species.

      Genomes change for in all sorts of ways. Mutation is one. Extremely important is gene exchange - typically sexual reproduction. This is very powerful or the high costs of it (please, no bad jokes) wouldn't be tolerated by natural selection. There are other mechanisms... bacteria can simply pick up DNA that is floating around in their environment - especially plasmids. Viruses can cause germ line changes - introducing new genes or modifying existing ones.

      --

      The only good weather is bad weather.

  11. Re:those poor pill pharms by runenfool · · Score: 5, Interesting

    Well, from science fiction land I'm looking forward to nanotechnology to save the day on this one. Hopefully about the time everything under the sun becomes resistent to antibiotics we will have microscopic robots running through our blood stream wiping out invaders.

    Does that mean we will be cyborgs? Kind of I guess ... but we are going to machines sooner or later .. this sounds like a good place to start.

    I wonder how much it will cost and how much control software companies will have over us then?

  12. Its more common than you think by CormacJ · · Score: 5, Interesting

    There are many strains of antibiotic resitant bugs out there.

    I used to work in a hospital and we had a lot of patients with MRSA (Multiple Resistance to Strains of Antibiotics) related issues. These patients were kept isolated and treated until the MRSA infection was cleared then they could be operated on.

    Quite often these bugs not dangerous until a person gets sick then they can be fatal.

    This is why people should not use antibiotics for viral infections (such as the common cold) and why if you do have to use anti-biotics you should take all the pills as prescribed until they are done.

    1. Re:Its more common than you think by Idarubicin · · Score: 4, Informative
      I used to work in a hospital and we had a lot of patients with MRSA (Multiple Resistance to Strains of Antibiotics) related issues.

      If you worked in a hospital, you obviously weren't a doctor or nurse. MRSA is Methicillin Resistant Staph(ylococcus) Aureus--a bacterial strain that is resistant to one of the antibiotic 'big guns' methicillin.

      There are few choices of antibiotics left to treat it (for example, vancomycin--though vancomycin resistant staph was observed recently, IIRC). A patient with MRSA is unlikely to survive the trauma of surgery coupled with a serious infection, because the drugs used to treat MRSA are often not friendly in their side effects.

      --
      ~Idarubicin
  13. or plague by myowntrueself · · Score: 5, Insightful

    with antibiotic resistance; though just wait till enough disease paranoid people start loading up on antibiotics with the 2 plague cases in NY... that should give plenty of bugs the opportunity to evolve resistance! ;)
    Heck, with things like this developing its a wonder anti-evolutionist 'creation science' people can show their faces in public!

    --
    In the free world the media isn't government run; the government is media run.
  14. Re:And this is by forevermore · · Score: 5, Informative
    Not just this, but there are a number of studies out (unfortunately, I have no links) that talk about correllations between overuse of antibacterial soaps and resistent bacteria strains. The thing is that the antibacterial soaps almost all use a form of the most powerful antibacterial agent out there, which used to be used only as a last resort (and thus bacteria weren't immune/resistent to it), but now that it's so prevalent in our sewers, etc., more and more resistent strains are showing up.

    So just use regular soap, sterilize things with alcohol or bleach, and don't eat meat (besides the antibiotics, there's all KINDS of other nasty stuff in that stuff)

    --
    Do you really need reason for beer? Wingman Brewers
  15. Re:DNA Theft by BitwizeGHC · · Score: 5, Funny

    In the article, it says that the Staph bug stole DNA from another bug already inside the woman to become resistant to vancomycin.


    Could the indigenous bacteria sue for intellectual property theft?

    What if a bacterium steals patented DNA? Do the pharmaceutical companies have a case against it?
    --
    N4st0r, trixx0r h0bb1tz0rz! Th3y st0l3 0ur pr3c10uzz!
  16. Re:And this is by aridhol · · Score: 5, Interesting

    No. This is the result of people "self-medicating". When a doctor prescribes medication for 6 weeks, if you feel better after 4 weeks, there are still bacteria in your system. The next two weeks work on killing them. If you don't kill all of them, the stronger ones that survived will evolve to be immune to the medication (gross oversimplification). When they spread to someone else, who also doesn't finish the course of meds, they will become more medication-resistant. And this is the reason we have drug-resistant bacteria.

    --
    I can't say that I don't give a fuck. I've just run out of fuck to give.
  17. A grain of salt by MacAndrew · · Score: 5, Interesting

    This spectre of super-bacteria (another writer correctly notes that antibiotics have nothing to do with viral infections) has been over-hyped by the press. There have been occasional examples of astonishingly resistant variations on common bacteria, but almost all have arisen in hospital settings with other complications present. They aren't whipping through the community, in other words. There are also special interests, such as the anti-antibiotics in animal feed people (a cause I tend to believe in), which have disingenuously used the problem to boost their cause, lacking any causal connection.

    There is good evidence anitbiotics are overprescribed and, much worse, misused by the public (always always finish your course of antibiotic correctly, the last mile really is important even though you may feel fine -- it sounds preachy but it's true). But this is a different issue; the super-bacteria appear in hospital setting where doctors are doing their utmost to fight infection. Vancomycin is still pretty nuclear stuff.

    I wish I had a good cite handy, but I can't dredge one up offhand; do take a look if you're interested, at NIH and CDC for starters. IMHO the superbacteria are kind of like the killer bees, long heralded but never quite arriving in force. I don't mean to make light of the potential trouble; it's just not here yet, and won't for a while, and it pales in contrast to staggering public health problems we have like HIV and smoking and unaffordable prescriptions and even West Nile virus. When you hear reports in terms of infections per 100,000 people, as opposed to isolated case studies, take heed. For now it merely makes for good copy, over and over.

    "I'm not a doctor but I play one onlin." :) Actually, I minored in biology and immunology, FWIW.

    1. Re:A grain of salt by jonabbey · · Score: 4, Interesting

      Well, that's the hope, that somehow the antibiotic-resistant genes will prove detrimental to the bacteria in the absence of the specific antibiotic. If a vancomycin-resistant staph bug is 10% less efficient at metabolism or replication, then there might be a degree to which the problem becomes self-limiting. This is also the idea behind letting older antibiotics 'rest' for awhile, in the hope that, in the absence of the antibiotics, the wild population will mutate back to the more efficient non-resistant configuration.

      I suspect that's not a terribly sturdy reed to pin one's hopes on, though. I'd again recommend Bruce Sterling's Bitter Resistance column for more on this.

  18. How long until AIDS swaps genes? by Blimey85 · · Score: 5, Interesting
    Yes I know that AIDS is a virus and not a bacteria but there have been cases of other things becoming airborne such as certain strains of Ebola. My fear is that somehow AIDS will become airborne.

    I think the main problem with infections and diseases becoming more resistant to treatment lies partly in a lot of people failing to use the medicine for the required amount of time. I had a skin fungus that kept coming back because everytime I cound't see it anymore, I would quit spraying the medicine on it. After a few times of this, the medicine was no longer effective and I had to get some much stronger (and much more costly) medicine to combat the problem. Using antibiotics for a short while until the problem is apparently gone and then stopping, may allow whatever it is that is being treated to adapt to the treatments. Then it gets spread to someone else and the process repeats itself until eventually, we have no way to stop even common ailments.

    --
    How is it that one careless match can start a forest fire, but it takes a whole box to start a campfire?
    1. Re:How long until AIDS swaps genes? by primenerd · · Score: 4, Informative

      Viruses such as HIV can swap genes, but only if two strains infect the same cell. This is why new influenza often comes to us from China, where swine, bird and human all live in close proximity and exchange viruses.
      The chief engine of genetic change in viruses is caused by antigen drift via mutation. This is due to the error-prone nature of virus replication.
      However, drug resistance is found in viruses. AIDS has shown resistance to some of the early retrotranscriptase inhibitors (AZT), not due to gene-swapping, but good old fashioned natural selection.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  19. And the creationists will say? by myowntrueself · · Score: 5, Funny

    How are they gonna explain this in classrooms in Alabama? (or wherever the heck it is that evolution is banned in classrooms)

    "Well kids you see God just recently gave the staph bacteria a gracious gift; antibiotic resistance. Of course staph didn't *evolve* this resistance since theres no such thing as evolution, children.
    We just have to wonder at Gods great plan where he makes these changes in living things just to make life harder for us God fearing folk. Praise the lord.
    Ok now children all lne up for your lobotomy operations; you won't be needing independent thought with God looking after things."

    --
    In the free world the media isn't government run; the government is media run.
    1. Re:And the creationists will say? by xenoweeno · · Score: 5, Informative

      In the creationist's mind, this is an example of "microevolution" and not "macroevolution". The latter of these two is the one that Goes Against God's Plan(TM), etc. They'll go along with staph becoming antibiotic-reistant, but not with staph mutating into an entirely different creature.

      This ignores that micro and macro are in reality the same thing to educated people, of course.

  20. Obviiously by Unknown+Poltroon · · Score: 4, Funny

    you have never met teh bacteria and mildew in my bathroom. THe view soap as fertilizer a this point. Chlorox merely annoys them.

    --
    All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
    1. Re:Obviiously by Cervantes · · Score: 4, Funny
      you have never met teh bacteria and mildew in my bathroom.

      Actually, we have met it occasionally, but normally it posts as an AC. Don't forget to say hi to Steve, the thing that lives on the crap in your keyboard, for me.

      And yes, for my sugar-starved brain, this is humour. And for the brain-starved mods, this is not troll nor flame, though perhaps flaming trolls could clean his bathroom...

      --
      If I knew the wedgies I gave you back in 6th grade would have resulted in this . . . I might have taken a moments pause.
  21. welcome to denial by shren · · Score: 5, Insightful

    If giving antibiotics for every single illness is a bad idea for humans, then it's likely a bad idea to turn every single cow's bloodstream into an antibiotic river.

    --
    Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
  22. Antibiotics not the only option by jblsys · · Score: 5, Informative

    The Russians have been working for years on alternatives to antibiotics. Phages are viruses that target bacteria and have been shown to be successful in targeting what would otherwise be very resistant strains. http://www.phages.org/PhageHistory.html

  23. Just when you think by CableModemSniper · · Score: 5, Funny

    That we've licked staph, along comes some guy with $6Mil. "We can rebuild it. We have the technology. We can make it better, faster, stronger."

    --
    Why not fork?
  24. Not the first time. by xenoweeno · · Score: 5, Interesting

    Not only is this not the first time, but antibiotic-resistant strains are already resisting brand new classes of antibiotics designed to beat them when all others fail.

    All I'm sayin' is that I'm funneling down the vitamin C like Pez. :-|

  25. phage therapy by soundofthemoon · · Score: 5, Informative

    There have been rumblings in the news for over a decade that profligate use of anitbiotics in both medical care and factory farming would lead to just this sort of problem. After years of warnings, no one should be surprised by this development. DNA swapping among bacteria species is a well-known phenomenon, and I read years ago that biologists were concerned this very thing would happen.

    What's the alternative? Virtually every species of bacteria has one or more virus species that have evolved to prey on it. These bacteriophage (or phage for short) can sometimes be used as treatment for bacterial infection. They were supposedly the Next Big Thing about a century ago, before antibiotics stole the show. Now there is renewed interest in this approach. There was also a recent development of a technique using only a phage-produced enzyme to fight bacterial infections.

    Google "phage therapy" or "phage enzyme" for some good reading on the subject.

  26. Antibiotic resistance by Cipster · · Score: 5, Informative

    I have actually worked in S. aureus research and it is a very scary bug. Some of the strains we had collected were resistant to 12 different antibiotics and even Arsenic. The main reason S. aureus becomes so easily resistant to new antibiotics is because it easily picks up circular strands of DNA called plasmids which carry resistance genes on them. The most likely source of the resistance gene is not cattle but other bacteria present in the hospitals. Enterococcus, a cousin of S. aureus which lives in a person's gut is highly resistant to Vancomycin and it was expected that sooner or later this will be passed to S. aureus. There have been cases of this happening in Japan a few years ago. The best place to pick up a nasty germ is in the hospital since most patiets there are on antibiotics so the only bugs around are highly resistant to a wide range of drugs.

  27. Re:And this is by number11 · · Score: 5, Informative

    And this is the reason we have drug-resistant bacteria

    Unfortunately, the answer is, "all of the above". Overprescription, failure of patients to complete the course of treatment, use of antibiotics in animal feed as a preventative and growth inducer, inappropriate self-treatment (I'd never heard of people mixing antibiotics with heroin, but that would certainly qualify), over-the-counter sales (mostly in third-world countries, but you'd be surprised at what's available at farm stores), heavy advertising by the pharmaceutical industry to encourage more sales. Every time an antibiotic is used, there is a small but finite risk of promoting antibiotic-resistance.

  28. Some Thoughts from Med School by md2b · · Score: 5, Informative

    VRSA (vanc. resistant s. aureus) is some scary schtuff. S. Aureus is one of the most virulent organisms we as humans get infected with; aside from the whole being sick in general, it can cause septic shock (death if you're not in a hospital at the time) and VERY rapid failure of your heart valves (called acute bacterial endocarditis). Vanc was once the last line of drugs. If it failed, we had no treatment. Since then, two more classes of ABs have been invented, and we deliberately avoid their general use so they'll be useful in just such situations; some doctors, sadly, don't use this guideline near as much as they need to. Sadly, S. Aureus is also a bacteria which is astoundingly well adapted to take up genetic change. These little buggers actually have "bacteria sex" and share their antibiotic resistance.

    Here's some suggestions to help you avoid these problems:
    1) Most MDR (multidrug resistant) bugs are found in hospitals (med word: nosocomial). You're relatively safe from this stuff when you're out in the community.
    2) TAKE ALL OF YOUR ANTIBIOTICS AS PRESCRIBED. Taking just enough to feel better is the worst idea ever - all the bugs left have now been genetically selected for greater resistance.
    3) If the doc says you don't need an antibiotic, don't push too hard - ABs can cause serious side effects and drug resistance in YOU. Remeber - a normal health human has 10x more bacteria than they do human cells - most bacteria are there to help!!!

  29. SA by zogger · · Score: 5, Interesting

    --long time ago I had an SA infection, it is TRULY sucky, incredibly hard to get rid of. took me six months or so to beat it. At the time I was put on erythomycin (sp).

    With that said, past few years been using colloidal silver on external wounds/infections, works quite well. I was skeptical at first until I tried it. Still using it when needed. Much better than any store bought/prescription antibio cream I ever tried. The only bummer is, it's very inexpensive. You can make it yourself easily or buy it cheaply pre-made, variety of places. People have this ingrained almost religious belief that stuff has to cost a lot of money and come from the medical deity to be effective. (Almost like the almost religious belief that software has to come from an expensive closed source place to be any good). You don't get that "full" satisfaction of paying mucho dinero for it so you know it'll work, like big pharmco products.

    Yes, I know there are some issues with taking it orally by the 55 gallon drum, I'm not recommending that at all, but for some reason those silver particles will sure kill the cooties. No idea if effective or not on SA, but given that the medcos are stumped, well????

    Not to be construed as medical advice, closed track, illegal where void and like that there.

  30. Re:Irradiation is the answer by Dannon · · Score: 4, Funny

    I'm not so sure that spam-the-mail wouldn't survive as well. I've a sneaking suspicion that those e-mail mass marketers have got to be some sort of subspecies of cockroach.

    --
    Good judgment comes from experience.
    Experience comes from bad judgment.
  31. obsessive-compulsive by MacAndrew · · Score: 5, Informative

    Not to push you over the edge, but the antibacterial soaps are controversial; many studies show they are little more effective than regular soap. Some contend the antibacterial ingredients can cause problems all their own.

    Most bacteriocides that you'd be willing to put on your skin take a while to work, more time than you'd have the soap on. The most effective treatment is a good scrub, which physically scrapes the bacteria away -- not glamorous but effective. Most of us do a lousy job at handwashing -- it needs to be thorough and repeated during the day, as the bacteria multiply on your skin -- myself included, and I have two of those little disease vectors called "children."

    Only 40% of people wash their hands exiting public restrooms, one study showed (imagine being the data-taker); the problem there being the encouragement of the fecal-oral route of disease transmission from the non-handwasher to others. I'll let you visualize what fecal-oral involves. So be a good citizen and lather up.

    Oh, and the next time the press reports someone getting sick from beef tainted with E. coli, note that "coli" means colon, where these bacteria were discovered. These E. coli come from careless slaughtering practices and, stated frankly, mean that "there's manure in the meat." (quoting the muckraking author of the excellent Fast Food Nation)

    It's a microbe's world after all.

  32. Re:And this is by Jace+of+Fuse! · · Score: 5, Insightful

    and don't eat meat

    Nearly all nutritionists will tell you that not eating meat at all is doing as much harm to you as it is doing good.

    The proper advice is to avoid eating TOO MUCH meat. Even if you don't think you are eating too much red meat, you probably still are. You should never eat more red-meat than you can hold in the palm of your hand. Really, that's all you need in a single meal. Fish is an excellent food source, and turkey (or chicken when cooked properly) is also an excellent alternative to red meat.

    So you can get your meat without pumping yourself full of the nasty crap that comes from it.

    I myself don't even eat meat every day.

    --

    "Everything you know is wrong. (And stupid.)"

    Moderation Totals: Wrong=2, Stupid=3, Total=5.
  33. Dirt is good for you by TamMan2000 · · Score: 5, Interesting

    There is even recent research that even suggests that children exposed to pets (and the inherent uncleanlyness) have lower incidence of asthma and allergies down the road.

    --
    "I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
  34. FYI: Colloidial Silver Not So Good ... by Kostya · · Score: 5, Informative
    Check out this link for some more info. I'm not saying it didn't work for you, but there appears to be heaps of evidence for why you might be a little concerned about regular use. Apparently the US FDA "has concluded that the risk of using silver products exceeds any unsubstantiated benefit."

    And for my own favorite test, just like chiropractric, colloidal silver users make some wide, sweeping, and exagerated claims for what silver "can cure". I mean crap, that's a huge list of things it will cure or alleviate. You just have to wonder when you see that many claims of a miracle medicine/tonic.

    --
    "Doubt your doubts and believe your beliefs." -- Switchfoot, Ode to Chin
  35. Argyria: I'm blue, ab a dee ab a dye... by RobertB-DC · · Score: 4, Informative

    Hey, great plugs for "Colloidial Silver". It's natural, right? And anything natural must be a Good Thing, right?

    Yeah, kinda like Hemlock is natural.

    Check out these links before you hit the natural foods store:

    Rosemary Jacob's Argyria Pages -- her skin is a fetching shade of blue-grey, somewhat like the robot on Futurama.

    Politician turns blue from drinking 'health' solution -- the Libertarian US Senate candidate from Montana would have had the distinction, if elected, of being the only Blue member of Congress. (I'm a Green, myself).

    --
    Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
  36. Re:And this is by Jace+of+Fuse! · · Score: 5, Informative

    Think about this: If I get shot in the arm

    No, think about this...

    Bacteria is everywhere. It's always growing, reproducing, and constantly mutating. So, if you take a sample of any given group of bacteria, it is easy to assume they won't all be of the same breed, and even those of the same breed won't all be of the same genetic line. The fact is, being simpler lifeforms they evolve and mutate faster.

    Now, let's say you manufacture a chemical that will kill bacteria "X". You take a dish full of bacteria and since they're very obviously not all the same it is highly possible that a few of those millions will be immune to your neat little chemical. You pour it in and you take a count and let's say only a few dozen live. Well guess what? When they reproduce you're left with a colony of bacterium that is immune to your neat little drug. Next time it gets a good growth pattern going, your antibiotic may not be as effective.

    Fortunately, our bodies fight infections on their own, so antibiotics aren't a "kill all" type of attack, but more like a "kill most and let the body take care of the rest". For this reason it is a good idea to ALWAYS take all of your prescribed antibiotics, assuming of course you actually needed them in the first place. You are basically helping your body help it's self.

    This too is a gross over-simplifaction but...

    --

    "Everything you know is wrong. (And stupid.)"

    Moderation Totals: Wrong=2, Stupid=3, Total=5.
  37. Like allergies by phorm · · Score: 5, Interesting

    Sometimes this works backwards, but I used to have some really bad allergies to animals: cat fur, feathers, etc.
    After toughing it out in clean fresh air, coupled with visits to the chickens in the barn, etc, most of my animal allergies went away. I was still allergic to cats, but got rid of that after we got three of the shedding creatures.
    In reverse cases, sometimes the allergies chip away at the immune system, causing gradually increasing sickness. But in most cases I've heard of, low exposure over time builds tolerence.

    *Note: That's low exposure, stuffing a kid with allergies in a house of 50 cats is probably not recommended in the short run...

  38. MRSA actually means.. by chazR · · Score: 5, Interesting

    (Completely agree with parent post, minor correction, then rant)

    MRSA actually means Methicillin Resistant Staphylococcus Aureus.

    Now we have VRSA. Vancomycin Resistant Staphyloccocus Aureus.

    There are no "wonder drugs" in the pipeline. We're reaching the end of the road for antibiotics. It won't be sudden, but it will happen.

    Many diseases we currently think of as relatively trivial are going to become real killers again. Millions of people are going to die.

    It won't be the young, fit and healthy as much as the very young and the very old.

    But let's keep feeding the antibiotics to farm animals. It makes them more profitable. Got a slight viral cold? Demand antibiotics. It's your right.

    It's the tragedy of the commons again.

    Crazy question for microbiologists: Is it possible that resistance to a specific antibiotic costs an organism enough that it could no longer out-compete it's non-resistant cousins? Would it be worth infecting someone who has a resistant strain with a non-resistant strain in the hope that the non-resistant one will 'win'? Then, (if the patient still lives), treat that with antibiotics?

    Or are you going to get so much genetic transfer that it's worse than dangerous?

  39. Inevitable, worryingly by salimma · · Score: 4, Insightful

    The hospital that my father works in has had similar cases in the past: infections that would only respond to the latest antibiotics.

    This is rather worrying, especially when you think that the main cause of all this resistance buildup is GPs prescribing antibiotics copiously (at the behest of patients, true, but what's wrong with giving placebos? Probably will get them lawsuits for misleading the patients, hmm) and commercial farming where antibiotics are used liberally to stock up the animals..

    --
    Michel
    Fedora Project Contribut
  40. Not quite. by wilgamesh · · Score: 4, Informative

    Multiple anbitiotic resistance in bacteria is documented. I can refer you to a brief article which shows that the med community is aware of it.

    * Tenover FC, Hughes JM. The challenges of emerging infectious diseases: development and spread of multiply-resistant bacterial pathogens. Journal of the American Medical Association 1996;275:300-304.

    Also, we can consider this from two points of view and see why it's reasonable:

    1.) bacteria can transfer genes from one to another by plasmid - a plasmid is a small circle of DNA that's not part of the bacterial genome. so one plasmid can code for resistance to antibiotic A, and another plasmid can code for resistance to antibiotic B. this modularity just from the molecular biology of bacteria makes bacteria well-equipped to deal with multiple assaults. a bacteria doesn't have to independently develop resistance, it can acquire it easily from another bacteria, mix and match etc.

    2.) the nature of darwinian selection of the survivalists means that, while it is *unlikely* for any particular bacteria for develop resistance, *once* it does develop resistance, then it will likely survive and multiply under heavy antibiotic environments.

  41. Another reason why GMO antibiores markers is bad by SysKoll · · Score: 5, Insightful

    Vancomycin-resistant staph is really bad news. Vancomycin was the last line of defense among antibiotics that have been tested. Its successors are very recent and might have side effects that haven't been detected yet. Not to mention that they are very expensive.

    That's one more reason why it's a bad idea to use antibiotic resistance genes as selection markers in genetically modified organisms (GMOs). The process goes like this: A researcher wants to splice, say, a sheep's wool-producing skin gene into common corn so that the GM corn will have wooly fibers (cheaper wool, great!). The researcher prepares thousand of modified cell cultures. The gene splicing has succeeded in only a small percentage of them. How does he select the cells with the spliced gene? Easy: He also splices another gene, coding for antibioresistance (ABR), and looks for its signature in the Petri dishes, using standard reagents.

    Then when the wooly corn is marketed, all its cells carry the same ABR gene. Eat the corn, and the bacteria in your guts get a chance to acquire the ABR gene from exposure to it. Then you get sick. The doctor prescribes antibiotics. All the E. Coli in your guts are killed, except the infinitesimal fraction that acquired this ANR gene. Then the surviving fraction repopulates your intestine. All your E. Coli population is now ABR. They will transmit the gene to some pathogene sooner or later.

    Understand me, I don't really think that GMO are evil. Some GMO are actually very good ideas. The problem is that implementation of the idea with selection through ABR is very dangerous. Look it up for yourself.

    -- SysKoll
    --

    --
    Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/

  42. Non-antibiotic staph cure by freejung · · Score: 5, Interesting
    I live in the tropics, and I and many others in this area have recently contracted a highly antibiotic-resistant strain of staph. It responds to antibiotics to some extent in some people, but in others antibiotics seem to have little effect. I know a guy who has had it for a year or more, his leg is half gone, he's been in and out of the hospital several times and he can't seem to get rid of it.

    I and many others have cured ourselves without antibiotics, and I want to tell you how. This by no means qualifies as official medical information, it's just what happened.

    Disclaimer: I am not a doctor and this is not a scientific analysis. This is just my story. It worked for me. If you have staph you should seek medical attention immediately. It's no joke, and even the doctors may not be able to help you.

    OK, if you have a weak stomach, stop reading now.

    First I should explain how staph attacks you, typically. Usually what happens is that you get a nick on your lower leg, and it just won't heal. Soon you have a festering infection which grows rapidly. It's amazingly efficient and agressive. It eats a sizable hole in your leg, and then starts to spread. You start getting pimples on other parts of your body which quickly grow and soon your are covered with round, dime or quarter-sized oozing festering holes. It's pretty horrifying. If you don't do something about it, you will end up with serious problems.

    I was infected for a couple of months, but I recovered without antibiotics, and many others have by using similar techniques. I have thought about the whole experience a lot, and I think I can identify the core elements of a successful staph cure. These elements can be divided into two main categories. First, you must have some kind of internal defense to prevent the spread of the staph through the bloodstream and the intercellular fluid. In the usual cure this is done by antibiotics, but these are losing their effectiveness. But fortunately your body comes equipped with an immune system for this purpose, but you must do everything you can to strengthen it and give it the advantage over the bacteria. Secondly, you must have some sort of external attack. This is the really horrible part. The staph burrows under the dead flesh it kills, making it extremely difficult to attack from the outside.

    Internal Defense

    • NO SUGAR!!! You must avoid sugar, starch if possible, fat, alcohol and cigarettes at all costs. Your life may actually depend on this, so don't try to cheat. This is the staph diet, and the staph will rigorously enforce it. Staph appears to feed on the sugar in the intercellular fluid, mostly in the fatty tissue just under the skin. When your blood sugar goes up, it goes crazy. One night I couldn't stand the sugar cravings any more and I ate 6 banannas. The next morning I woke up with 20 new sores starting. When I did finally get rid of it, it was only when I stopped eating sugar completely. Everyone who has had staph agrees on this. Avoiding sugar is the only way to stop getting new sores.
    • Bolster your immune system. Do anything you can to do this. Get lots of rest, drink lots of fluids, eat vitamin C and other antioxidants, do anything you can think of to strengthen your body's defense. Alcohol and tobacco weaken your immune system, and must be avoided. There are a number of local herbs which people say help, I can't really give evidence on these one way or another and besides they probably don't grow where you live.
    • Consider taking antibiotics anyway. I didn't, but sometimes they help somewhat even if they don't completely kill the staph. The resistant strain seems to have a higher survival rate, but it does still kill some of them. But taking antibiotics does not exempt you from the other elements of the cure, so don't even think about slacking off. Curing staph is a full time job, and you must give it your whole attention.

    External attack

    This can be divided into two phases. In the first phase, the staph colony is expanding into the flesh around it, and your attack must be very aggressive. In the second phase, your body has isolated the colony and built a membranous wall around it. Then the treatment must be very gentle.

    Phase one; Expanders:

    • This is the really horrible part, so brace yourself. The staph burrows under the dead flesh it kills, leaving a hard, tough gray scab. This material is incredibly strong, we should be using it in high tech aircraft design or something, it's amazing. This stuff must be removed by any means necessary. This is not fun. Some people take the leaves of a certain plant, boil them, take a handful and scrub the wounds hard until the scabs come off. This is horribly painful, and takes a long time because the leaves are soft. Some use a scrubby, brillo pad, or steel wool. This is even more painful, but is much faster. However, it does a lot of peripheral damage, which then gets infected. Personally, I used a razor blade, and just gouged that shit out of there. This is also horribly painful and takes a long time and is really really disgusting (the worst part is the smell of your own rotting flesh), but it is very precise and it works nicely. You must do this at least once a day, preferably twice or even three times. The staph grows fast.
    • Disinfectant. Once you have removed the dead flesh as completely as possible (you will know you have done this because when you get down to the living flesh it starts to bleed profusely, and it really starts to hurt like hell), you must disinfect the area thoroughly to kill as much of the colony as possible. This is just a numbers game. Exponential growth is a bitch. Some use hot water with a lot of salt, but I prefer hydrogen peroxide and chlorine, which are highly toxic and quite effective. Iodine for some reason seems to have little effect. Washing afterwards with antibacterial soap is also a good idea.

    During this phase, I think the wounds should be left open. This is to encourage them to ooze pus, which is actually a good thing because it establishes an outward flow of fluid and slows the staph down. The objective of this phase is to slow the growth of the colony enough for your body to build a membranous wall around it, isolating the infection from the intercellular fluid and allowing the healing process to begin.

    Phase 2; Contractors:

    You will know you have entered this phase when you stop finding so much dead flesh, and the colony slows its growth. At this point you build a wall around the infection, and within a couple of days the remaining dead flesh outside the wall should come off easily, without extensive scrubbing. Now you must change your approach:

    • Scrub the wounds gently with boiled Coralito leaves or a soft cloth. The idea is to remove the loose organic matter without damaging the wall.
    • Continue to disinfect after each scrub.
    • Cover the wound. The absolute best way to do this is to take this one kind of leaves called Coralito or Red Top, toast them to a fine powder over a low heat, and apply this powder to the wound after disinfecting. This hurts like hell for some reason but is very effective in drawing out the fluid and protecting the wound. In this phase the wound will ooze a lot. That's OK, even though it's pretty nasty.

    Gradually the wound will begin to shrink. You must stick with the treatment rigorously and stick to the diet mercelessly. The cases that go on and on are the ones where the person simply cannot force themself to avoid sugar, alcohol and cigarettes, and just keep getting new infections.

    Also, a note about clenliness. It's really important. You must clean and disinfect your entire environment completely all the time, especially your clothes and bedding. Do lots of laundry, take lots of showers, use chlorine liberally.

    Well, that about covers it. After two months of this horrible daily torture, I finally got a grip on my sugar consumption, cured my last big sore, and recovered. I have big scars on my legs to tell the tale, but I'm actually grateful for the experience. It builds a hell of a lot of will power, which is useful stuff.

    Good luck, and may the Force be with you.

  43. A few facts by mrpastry · · Score: 5, Informative
    This story is a big deal because until recently vancomycin has been the one antibiotic microbiologists could reliably fall back on to treat MRSA. Resistance to all other antibiotics has been seen in S.aureus . It's also a big deal because Staphylococcus aureus (the SA in MRSA) is a pretty aggressive bug, unlike say VRE, which, though also effectively untreatable in some cases due to drug-resistance, are pertty weedy bugs that only affect a few very ill patients.

    MRSA strains with intermediate resistance to vancomycin have been seen in many parts of the world since 1996, and patients certainly have died as as result of vancomycin treatment failure. However, these perhaps weren't so scary as the resistance mechanism was a very thick cell wall which made these strains very slow growing and not so viable in the absence of vancomycin.

    What's new is that MRSA strains have now emerged with high-level vancomycin-resistance and this happened by acquistion of the vancomycin-resistance gene (vanA) from VRE. That this was possible was shown in the lab in 1992, but the first time it's been seen in patients was this year. The two reports of Vancomycin-resistant MRSA in the U.S. can be found in the CDC's newsletter:

    MMWR Morb Mortal Wkly Rep 2002 Oct 11;51(40):902

    MMWR Morb Mortal Wkly Rep 2002 Jul 5;51(26):565-7

    How scary is it? Until recently MRSA has been almost exclusively a hospital pathogen, so it's pretty scary if you're a hospital patient with a lot of tubes sticking into you which alow the bugs to get in and cause infections, but if you're well it's not a big threat (doctors and nurses can carry MRSA, but generally they don't develop infections despite a lot of exposure). There have been reports recently of strains of MRSA that do spread well in the community, and that can cause serious infections amongst essentially healthy people. However, these have not been multiply-resistant strains, and really these are no worse than virulent strains of normal S. aureus which have been round for millions of years. The message is, if you're well, don't rush out and buy cipro (this will only helps MSRA as the bugs are resistant to it), and if you're ill, keep away from hospitals.

    Just to rebut a few other comments: over-prescribing of antibiotics probably is very important for encouraging drug-resistantce, but even correct of use of antibiotics will lead to some resistance. Use of antibiotics in animal feed can't really be blamed in this case, as drugs of the same class as vancomycin (glycopeptides) have not been used in animal feed in the US, though they have in Europe. They've probably played a significant role in VRE transmission in humans in some European countries, but in the U.S. hospital prescribing of this and other antibiotics have probably been the driving force.