Antibiotic Resistant Staph Infections
LinuxGeek8 writes "There's a news update on a previous article about the first case of antibiotic resistant staph infections. The woman who has the infection is being kept up to 6 months in an isolation room. She is taking an antibiotic that is working, after many others did not.
"In the scheme of public health threats, this has to rank close to the top," David Ropeik, director of risk communication at the Harvard Center for Risk Analysis, said of antibiotic resistance."
thanks for making me use all that anti-bacterial soap all the time. now i'm locked up in a room for 6 months.
as usual. Decimal to binary conversion errors in antibiotic design on computers caused this.
What doesn't help is the way that antibiotics have been indiscriminately and thoughtlessly prescribed these last several years for even the slightest ailments.
Then there's some research suggesting that feeding antibiotics to animals isn't such a great idea either since all the nasties associated with that can be ingested later by humans. Try googling for the info
For all you pathology people, is this a common method for bugs, or is it limited to a few families?
-Cyc
/.'s 10 Millionth
West Nile is a virus. There are no antibiotics for viruses, only treatments and immune shots. Immune shots allow our own bodies to make antibodies against viruses, so they shouldn't be susceptible to a similar problem with viruses (although immune shots must be taken at least several weeks before exposure to the virus).
Watch, it'll become immune to radiation. Now THAT's a scary bug.
Education is the silver bullet.
What will they sell us once their magic potions no longer work? Maybe invent a couple more highly profitable diseases, or just classify more things as pathologies. There just isn't the same profit in prevention.
Vivez sans temps mort
to quit washing your hands! the more bacteria resistant YOU are, the less you have to rely on artificial crutches like antibiotics.
Will it play Ogg Vorbis?
Luckily, i take my cipro once a week, so this shouldnt bother me.
All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
If you'd read the article as opposed to jumping at the opportunity to blame animal farming, you'd have read the vancomycin resistant staph infection (and it's presence in the Detroit area) is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users from the 1970's. They were attempting to avoid infections.
And my high school collegeues made fun of my lack of social life. Ha!
Has the bacteria really developed a resistance? Or have all the non-resistive bacteria died off and now only resistive bacteria remain?
Outdoor digital photography, mostly in New Engl
There are many strains of antibiotic resitant bugs out there.
I used to work in a hospital and we had a lot of patients with MRSA (Multiple Resistance to Strains of Antibiotics) related issues. These patients were kept isolated and treated until the MRSA infection was cleared then they could be operated on.
Quite often these bugs not dangerous until a person gets sick then they can be fatal.
This is why people should not use antibiotics for viral infections (such as the common cold) and why if you do have to use anti-biotics you should take all the pills as prescribed until they are done.
Isn't this just another strain of the MRSA (Methicillin Resistant Staphylococcus aureus) superbug. If so, the UK has already had 2 deaths in Edinburgh (after it infected 13 patients). There was a death last year from it after a 14yr boy broke his ankle (see BBC News for more articles).
Actually, a very few antibiotics also have antiviral effects. This is because infected cells often have some of their biological machinery changed due to the genetic change, and begin operating at a more primitive level.
More recently I had a positive reaction to a TB test and am on INH (Isoniazid), which makes me feel like crud. I'm 12 days into it with 6-9 months to go.
Same plan as standard penecillin treatment, take it all, to prevent drug resistent strains.
You can probably thank all those ranchers who load up their cattle, pigs and chickens with with antibiotics before bringing them to market, as those which don't break down get stay in the meat and enter your body. Nothing like a good training ground for weeking out the weaker strains of disease.
A feeling of having made the same mistake before: Deja Foobar
Antibiotics have to be one of the most overused and abused tools in the microbiological arsenal. They are needlessly added to animal feed and hand soap thus introducing massive amounts of antibiotics into "the wild". This has the effect of selecting for resistant strains and leads to problems such as the infection experienced by this woman.
Considering that S. aureus is an incredibly common memeber of the natural skin flora, I would think that this lady has a weak immune system or suffered a big oozing injury on her foot to allow for the infection to establish itself.
Staphlococcus aureus can be a fairly nasty little bug. It produces an exotoxin that acts as a super-antigen making the immune system go crazy. It also effects the vagus nerve causing *extreme* nausea. I once exposed myself to this stuff and enjoyed 18 hours of fever and projectile vomiting as a result. Several biological weapon programs have considered using the stuff as a chemical weapon.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
I can't imagine where the writer of the article
got the idea that this is the first case of an
antibiotic-resistant staph infection.
What will really be scary is when a necrotizing
staph infection proves resistant and highly
contagious. I can hardly wait!
-I like my women like I like my tea: green-
with antibiotic resistance; though just wait till enough disease paranoid people start loading up on antibiotics with the 2 plague cases in NY... that should give plenty of bugs the opportunity to evolve resistance! ;)
Heck, with things like this developing its a wonder anti-evolutionist 'creation science' people can show their faces in public!
In the free world the media isn't government run; the government is media run.
So just use regular soap, sterilize things with alcohol or bleach, and don't eat meat (besides the antibiotics, there's all KINDS of other nasty stuff in that stuff)
Do you really need reason for beer? Wingman Brewers
Antibiotics don't kill viruses.
:
Antibiotics don't kill viruses.
Antibiotics don't kill viruses.
Antibiotics don't kill viruses.
Antibiotics don't kill viruses.
Antibiotics don't kill viruses.
Antibiotics don't kill viruses.
Antibiotics don't kill viruses.
Antibiotics don't kill viruses.
Got it ? No. That might help
Antibiotics kill bacteria.
Antibiotics kill bacteria.
Antibiotics kill bacteria.
Antibiotics kill bacteria.
Antibiotics kill bacteria.
Antibiotics kill bacteria.
Antibiotics kill bacteria.
Antibiotics kill bacteria.
Antibiotics kill bacteria.
HTH.
mouhahah, first time I hit the lameness filter. Well, I guess the lameness filter picks up speech figures better than most humans.
How precisely is the parent post offtopic?
That we are getting soft. All these new products that have anti-bactereal stuff in them aren't helping us, in the long run anyway. It's sad when you see kids afraid of dirt, or people who have to wipe down every little thing before they feel it's clean. Yes, I'm wash myself.. but I don't feel the need to buy every product that 'Kills 99.9% of germs FAST!' I rarely kid a cold, and when I do my body fights it off without the use of twenty different products. Tylenol, and some good chicken soup are all I need. And yet they say the flu is getting worse by the year. We're soft, we need to toughen up. Go play in the mud.
There is no spork.
Yup, the US uses antibiotics in animal food.
That's why my wife and I buy food that hasn't been treated with antibiotics (mostly chicken.)
hmmmm...if the law isn't changing fast enough, vote with your walet. It makes the fastest policy changes...
"Only one thing, is impossible for god: to find any sense in any copyright law on the planet." Mark Twain
No. This is the result of people "self-medicating". When a doctor prescribes medication for 6 weeks, if you feel better after 4 weeks, there are still bacteria in your system. The next two weeks work on killing them. If you don't kill all of them, the stronger ones that survived will evolve to be immune to the medication (gross oversimplification). When they spread to someone else, who also doesn't finish the course of meds, they will become more medication-resistant. And this is the reason we have drug-resistant bacteria.
I can't say that I don't give a fuck. I've just run out of fuck to give.
If you read the article, the resistance is attributed to theft of genetic material from another organism. So those bacteria which were most effective at stealing vancomycin resistance survived to breed, and pass on their criminal legacy.
Antibiotics don't kill viruses.
HBI's Law: Frequency of calling others Nazis is directly correlated with the likelihood of the accuser being Communist.
Many health professionals hope that following this summer's discovery of vancomycin-resistant staph aureus in the metro woman's foot, Americans will be scared enough to accept limited use of antibiotics.
Not bloody likely. Though maybe if more doctors took the approach that was taken at the Olympic Village in Salt Lake City, the over-use of anti-biotics might start to decline. Not many doctors have that kind of captive audience, though.
It's not a matter of scaring people away from antibiotics, it's a matter of giving them something that actually might work, instead of just giving them something to get them out of the office...
This spectre of super-bacteria (another writer correctly notes that antibiotics have nothing to do with viral infections) has been over-hyped by the press. There have been occasional examples of astonishingly resistant variations on common bacteria, but almost all have arisen in hospital settings with other complications present. They aren't whipping through the community, in other words. There are also special interests, such as the anti-antibiotics in animal feed people (a cause I tend to believe in), which have disingenuously used the problem to boost their cause, lacking any causal connection.
:) Actually, I minored in biology and immunology, FWIW.
There is good evidence anitbiotics are overprescribed and, much worse, misused by the public (always always finish your course of antibiotic correctly, the last mile really is important even though you may feel fine -- it sounds preachy but it's true). But this is a different issue; the super-bacteria appear in hospital setting where doctors are doing their utmost to fight infection. Vancomycin is still pretty nuclear stuff.
I wish I had a good cite handy, but I can't dredge one up offhand; do take a look if you're interested, at NIH and CDC for starters. IMHO the superbacteria are kind of like the killer bees, long heralded but never quite arriving in force. I don't mean to make light of the potential trouble; it's just not here yet, and won't for a while, and it pales in contrast to staggering public health problems we have like HIV and smoking and unaffordable prescriptions and even West Nile virus. When you hear reports in terms of infections per 100,000 people, as opposed to isolated case studies, take heed. For now it merely makes for good copy, over and over.
"I'm not a doctor but I play one onlin."
I think the main problem with infections and diseases becoming more resistant to treatment lies partly in a lot of people failing to use the medicine for the required amount of time. I had a skin fungus that kept coming back because everytime I cound't see it anymore, I would quit spraying the medicine on it. After a few times of this, the medicine was no longer effective and I had to get some much stronger (and much more costly) medicine to combat the problem. Using antibiotics for a short while until the problem is apparently gone and then stopping, may allow whatever it is that is being treated to adapt to the treatments. Then it gets spread to someone else and the process repeats itself until eventually, we have no way to stop even common ailments.
How is it that one careless match can start a forest fire, but it takes a whole box to start a campfire?
How are they gonna explain this in classrooms in Alabama? (or wherever the heck it is that evolution is banned in classrooms)
"Well kids you see God just recently gave the staph bacteria a gracious gift; antibiotic resistance. Of course staph didn't *evolve* this resistance since theres no such thing as evolution, children.
We just have to wonder at Gods great plan where he makes these changes in living things just to make life harder for us God fearing folk. Praise the lord.
Ok now children all lne up for your lobotomy operations; you won't be needing independent thought with God looking after things."
In the free world the media isn't government run; the government is media run.
you have never met teh bacteria and mildew in my bathroom. THe view soap as fertilizer a this point. Chlorox merely annoys them.
All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
If giving antibiotics for every single illness is a bad idea for humans, then it's likely a bad idea to turn every single cow's bloodstream into an antibiotic river.
Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
Except that viruses are not sensitive to antibiotics. Viruses are prevented by vaccine and a few interference drugs (i.e. AZT).
Bacteria are sensitive to antibiotics and in that sense it is very very important to take the entire prescription.
One of the biggest problems in microbiology is antibiotics being perscribed for viral infections, thus costing the patient money and releasing needless antibiotics into the body (encouraging resistant strains).
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
The patient, a 40-year-old Michigan man with diabetes, seems to have caught the bug off an infected catheter inserted while he was in the hospital for the amputation of a gangrenous toe
Couldn't it be that this person's immune system is so compromised that no AB would cure him? He's one breath away from a corpse.
love is just extroverted narcissism
And how is this informative? Antibiotics don't do a damn thing for VIRAL infections.
7 November 2006: The day Americans realized corruption and incompetence weren't addressing 11 September 2001
and don't eat meat (besides the antibiotics, there's all KINDS of other nasty stuff in that stuff)
I eat meat because it tastes like food. I don't eat veggies because I'm smarter than the aminals that eat veggies. I eat them instead. Yum Yum.
After the bomb, the only survivors will be cockroaches, Spam (the meat, not the mail), and these bacteria. Fun.
I can't say that I don't give a fuck. I've just run out of fuck to give.
I have no problem with bringing it up. But this article is discussing a specific strain with a specifically attributed cause and it isn't animal farming. It's heroin/antibiotic mixing. That's the cause attributed today, here.
...and that's good enough for ME!
The Russians have been working for years on alternatives to antibiotics. Phages are viruses that target bacteria and have been shown to be successful in targeting what would otherwise be very resistant strains. http://www.phages.org/PhageHistory.html
That we've licked staph, along comes some guy with $6Mil. "We can rebuild it. We have the technology. We can make it better, faster, stronger."
Why not fork?
I'm pointing out that the scientists involved feel they have found the specific cause of this specific instance of vancomycin-resistant staph. And it isn't animal farming. It was heroin/antibiotic mixing.
If you want to discuss resistance in general, and it's growth in the future, bring up animal farming. But don't attribute this case to it.
Not only is this not the first time, but antibiotic-resistant strains are already resisting brand new classes of antibiotics designed to beat them when all others fail.
:-|
All I'm sayin' is that I'm funneling down the vitamin C like Pez.
How do you know which food hasn't been treated with antibiotics?
There have been rumblings in the news for over a decade that profligate use of anitbiotics in both medical care and factory farming would lead to just this sort of problem. After years of warnings, no one should be surprised by this development. DNA swapping among bacteria species is a well-known phenomenon, and I read years ago that biologists were concerned this very thing would happen.
What's the alternative? Virtually every species of bacteria has one or more virus species that have evolved to prey on it. These bacteriophage (or phage for short) can sometimes be used as treatment for bacterial infection. They were supposedly the Next Big Thing about a century ago, before antibiotics stole the show. Now there is renewed interest in this approach. There was also a recent development of a technique using only a phage-produced enzyme to fight bacterial infections.
Google "phage therapy" or "phage enzyme" for some good reading on the subject.
Attibution of evolutionary cause is dubious at best. Since evolutionary biology is almost alway based on preexisting correlation rather than comtrolled experimentation, it is not possible to say where the resistance plasmids arose.
Vancomycin resistant S. aureus has been isolated in areas outside the US where it has been ascribed http://www.cdc.gov/ncidod/eid/vol3no3/mcdonald.htDon't believe the nonsense, unless you hear it from me directly.
No, but there are antiviral medications, which help your body fight off viruses. I had to take one (for the first time) a couple months ago because I had the shingles. The doctor told me I was too young to be getting the shingles, but stopped just short of recommending a job change. :-)
GreyPoopon
--
Why is it I can write insightful comments but can't come up with a clever signature?
I'm sorry, but if you have a viral infection no amount of antibiotcs are going to help you...maybe Interferon would help, but antibiotics are only effective on bacteria.
I don't know about about the person who posted the article to /. but the article itself states pretty clearly that this is first strain resistant to vancomycin. I think the article mentioned that staph was already resistant to most other antibiotics. Vancomycin was one of our last defenses against staph evidently. That's why this was worth posting...
I have actually worked in S. aureus research and it is a very scary bug. Some of the strains we had collected were resistant to 12 different antibiotics and even Arsenic. The main reason S. aureus becomes so easily resistant to new antibiotics is because it easily picks up circular strands of DNA called plasmids which carry resistance genes on them. The most likely source of the resistance gene is not cattle but other bacteria present in the hospitals. Enterococcus, a cousin of S. aureus which lives in a person's gut is highly resistant to Vancomycin and it was expected that sooner or later this will be passed to S. aureus. There have been cases of this happening in Japan a few years ago. The best place to pick up a nasty germ is in the hospital since most patiets there are on antibiotics so the only bugs around are highly resistant to a wide range of drugs.
Oh my fucking God I got bit by a fucking mosquito and now it's like I have the flu! Holy shit! If I were old enough that the flu would kill me, I might suffer from a general feeling of weakness, and headaches, and if I didn't go to a doctor for about a month, I could die! Holy fuck! I demand the government spray DDT down the throats of my children this instant!
Staph is a normally not seen in the general poplution. It shows up where other things have all ready weaken the system.
So where is the place most staph affesction show up?
The hostipal.
That's right, the place you go to get better.
What was just being found is that assama (trouble breathing) is more common (by % of population) in the city than in the country.
Why? Cleaner air? No smog?
Not realy... more dirt in the air. That right dust, sod, pig "gas" and like. The lungs are stronger for having to fight these.
Staph protection is most like to follow that same. A little dirty does not hurt you.
Thing of the people that go over see or Mexico and just **GO**. The local microbes in the water setting up shop in their intesants.
Again people from the country do not show this problem.
I always wondered what happens to the high tech workers in those ultra-clean rooms for wafers and disks.
Felics Ungur must being turning in his grave.
perhaps an interaction between the magnetic pole shifting and the chemical weapons that will be used against us in the next 6 months could result in the destruction of antibiotic-resistant bacteria.
i, for one, have had enough indirect threats to my life for this year
And this is the reason we have drug-resistant bacteria
Unfortunately, the answer is, "all of the above". Overprescription, failure of patients to complete the course of treatment, use of antibiotics in animal feed as a preventative and growth inducer, inappropriate self-treatment (I'd never heard of people mixing antibiotics with heroin, but that would certainly qualify), over-the-counter sales (mostly in third-world countries, but you'd be surprised at what's available at farm stores), heavy advertising by the pharmaceutical industry to encourage more sales. Every time an antibiotic is used, there is a small but finite risk of promoting antibiotic-resistance.
VRSA (vanc. resistant s. aureus) is some scary schtuff. S. Aureus is one of the most virulent organisms we as humans get infected with; aside from the whole being sick in general, it can cause septic shock (death if you're not in a hospital at the time) and VERY rapid failure of your heart valves (called acute bacterial endocarditis). Vanc was once the last line of drugs. If it failed, we had no treatment. Since then, two more classes of ABs have been invented, and we deliberately avoid their general use so they'll be useful in just such situations; some doctors, sadly, don't use this guideline near as much as they need to. Sadly, S. Aureus is also a bacteria which is astoundingly well adapted to take up genetic change. These little buggers actually have "bacteria sex" and share their antibiotic resistance.
Here's some suggestions to help you avoid these problems:
1) Most MDR (multidrug resistant) bugs are found in hospitals (med word: nosocomial). You're relatively safe from this stuff when you're out in the community.
2) TAKE ALL OF YOUR ANTIBIOTICS AS PRESCRIBED. Taking just enough to feel better is the worst idea ever - all the bugs left have now been genetically selected for greater resistance.
3) If the doc says you don't need an antibiotic, don't push too hard - ABs can cause serious side effects and drug resistance in YOU. Remeber - a normal health human has 10x more bacteria than they do human cells - most bacteria are there to help!!!
Actually, the majority of antibiotics given to livestock are not administered to prevent infection. They are given to healthy animals in order to promote their growth. There is a good overview of the problem here.
Get this; those hippies are onto something. 'Organic' food can't be treated with antibiotics, by most peoples definitions. Labeling rules vary by area though...
"A language that doesn't affect the way you think about programming, is not worth knowing" - Alan Perlis
If a drug company unwittingly released some harmful, proprietary DNA into the world, would it be an IP violation for another company to produce a cure? (since the cure couldn't have existed without the problem)
The parent post is not offtopic, but informative. Instead of wasting your points on my post, use them to mod up the parent.
Thanks
CD
Use ISO 8601 dates [YYYY-MM-DD]
Yeah, thank God we have phlebotomy (blood-letting) to treat West Nile or we would really be screwed.
--long time ago I had an SA infection, it is TRULY sucky, incredibly hard to get rid of. took me six months or so to beat it. At the time I was put on erythomycin (sp).
With that said, past few years been using colloidal silver on external wounds/infections, works quite well. I was skeptical at first until I tried it. Still using it when needed. Much better than any store bought/prescription antibio cream I ever tried. The only bummer is, it's very inexpensive. You can make it yourself easily or buy it cheaply pre-made, variety of places. People have this ingrained almost religious belief that stuff has to cost a lot of money and come from the medical deity to be effective. (Almost like the almost religious belief that software has to come from an expensive closed source place to be any good). You don't get that "full" satisfaction of paying mucho dinero for it so you know it'll work, like big pharmco products.
Yes, I know there are some issues with taking it orally by the 55 gallon drum, I'm not recommending that at all, but for some reason those silver particles will sure kill the cooties. No idea if effective or not on SA, but given that the medcos are stumped, well????
Not to be construed as medical advice, closed track, illegal where void and like that there.
I'm not so sure that spam-the-mail wouldn't survive as well. I've a sneaking suspicion that those e-mail mass marketers have got to be some sort of subspecies of cockroach.
Good judgment comes from experience.
Experience comes from bad judgment.
What will they sell us once their magic potions no longer work?
Well, there's always the Chicken Pox vaccine. Merck is making a killing (sorry) by preying on the fears of parents. Despite the fact that 99.99% of children recover from the disease (caveat emptor on that link), the vaccine is being pushed with FUD directed at health professionals (leading to news articles like this one). These tactics have been wildly successful -- now, schools are requiring students to be vaccinated against Chicken Pox as though it were as deadly as measles or whooping cough.
This despite the fact that your child is more likely to die on the way to the doctor to get the shot, than to die of Chicken Pox.
My wife is a clinical tech at a major Dallas children's hospital, and the off-the-record opinion among all the health workers there is that the vaccine is nothing but a boondoggle for its manufacturer. Meanwhile, she and the rest of the team are dealing with bugs like MRSA -- Methicillin Resistant Staphylococcus aureus. In fact, this BBC article from last month details the fear that MRSA staph would pick up Vancomycin resistance because of antibiotic overuse.
Gee... I wonder who stands to gain the most from both the current overuse of antibiotics and from the development of the "next generation" of overprescribed medications?
Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
Not to push you over the edge, but the antibacterial soaps are controversial; many studies show they are little more effective than regular soap. Some contend the antibacterial ingredients can cause problems all their own.
Most bacteriocides that you'd be willing to put on your skin take a while to work, more time than you'd have the soap on. The most effective treatment is a good scrub, which physically scrapes the bacteria away -- not glamorous but effective. Most of us do a lousy job at handwashing -- it needs to be thorough and repeated during the day, as the bacteria multiply on your skin -- myself included, and I have two of those little disease vectors called "children."
Only 40% of people wash their hands exiting public restrooms, one study showed (imagine being the data-taker); the problem there being the encouragement of the fecal-oral route of disease transmission from the non-handwasher to others. I'll let you visualize what fecal-oral involves. So be a good citizen and lather up.
Oh, and the next time the press reports someone getting sick from beef tainted with E. coli, note that "coli" means colon, where these bacteria were discovered. These E. coli come from careless slaughtering practices and, stated frankly, mean that "there's manure in the meat." (quoting the muckraking author of the excellent Fast Food Nation)
It's a microbe's world after all.
...is that we're all one breath away from a corpse. Seriously, take a deep breath, hold it, relax, and exhale. Now, don't do it again - ever. See?
Dewey, what part of this looks like authorities should be involved?
and don't eat meat
Nearly all nutritionists will tell you that not eating meat at all is doing as much harm to you as it is doing good.
The proper advice is to avoid eating TOO MUCH meat. Even if you don't think you are eating too much red meat, you probably still are. You should never eat more red-meat than you can hold in the palm of your hand. Really, that's all you need in a single meal. Fish is an excellent food source, and turkey (or chicken when cooked properly) is also an excellent alternative to red meat.
So you can get your meat without pumping yourself full of the nasty crap that comes from it.
I myself don't even eat meat every day.
"Everything you know is wrong. (And stupid.)"
Moderation Totals: Wrong=2, Stupid=3, Total=5.
When you contract a viral infection and are prescribed antibiotcs then perhaps you should find a new doctor. Antibiotics do nothing to counter virii. (And yes, I did go to a doctor complaining of a flu once, and he did prescribe antibiotics. He may just as well have prescribed a placebo just to make me go away.)
"Freedom means freedom for everybody" -- Dick Cheney
You just gave me this great vision of a postapocalypse world, in which cockroaches sit at computers all day sending one another nigerian scams and free porn passwords. Should be a movie, or at least a Pixar short.
--- php: perl hates people
You should never eat more red-meat than you can hold in the palm of your hand.
Uhm. I can stack a whole lot of meat in the palm of my hand.
One slice of roast beef fits in my hand, as does 50. Are they both proper amounts?
Methinks you need to give clearer directions.
There is even recent research that even suggests that children exposed to pets (and the inherent uncleanlyness) have lower incidence of asthma and allergies down the road.
"I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
The development of antibiotic resistance by bacteria is one of the most important examples of evolution in action. Yet when so many people deny the reality of evolution because of religious superstitions, how can they be made to understand the dangers of antibiotic overuse?
You forgot Twinkies!
And for my own favorite test, just like chiropractric, colloidal silver users make some wide, sweeping, and exagerated claims for what silver "can cure". I mean crap, that's a huge list of things it will cure or alleviate. You just have to wonder when you see that many claims of a miracle medicine/tonic.
"Doubt your doubts and believe your beliefs." -- Switchfoot, Ode to Chin
I see people on one antibiotic, say Vancomycin, and the germs becoming resistant to them. Well, why not just perscribe 2 or 3 different antibiotics? That way if BacteriaA develops a resistance to AntibioticA, AntibioticB and C are still around to kill it, and thus it does not survive.
With one antibiotic, developing resistance is almost a certainty. With three or more antibiotics, the odds of a pathogen developing a resistance to all three at once must be nearly impossible.
Why is this not done?
occultae nullus est respectus musicae - originally a Greek proverb
Both your intended point and you're inadvertent point are big problems. The same people that don't finish off their antibiotic runs go off and badger their doctors for antibiotics to cure their flu or whatever, since the pills kill germs, right?!!
Think about this: If I get shot in the arm, but don't die from it, then have three childeren who all get shot and live, and they have childeren that all get shot and live, and so on for a few hundred generations, does that mean eventually my familial line will produce bullet-resistant childeren?
... each generation then is more resistant to the drugs than the previous. In other words, it's not *getting shot* that makes you stronger, but the inherent genetic variation that produces the resistance. The act of getting shot (or being exposed to antibiotics) just removes the weaker end of the gene pool, giving the next generation a stronger average, or starting point, if you will.
No. But you don't seem to understand the basic mechanism behind evolution, and your analogy is flawed. Picture not one bacterium, but thousands and thousands of them, all with different resistances to antibiotics. The antibiotics kills off some, but others live. The ones that lived have on average a stronger resistance to antibiotics. They have lots of children, which creates more variation. Then another antibiotic is used, which kills off some but leaves others. The others who are left have an even *higher* average resistance to antibiotics.
And so on
The following sentence is true. The preceding sentence was false.
Hey, great plugs for "Colloidial Silver". It's natural, right? And anything natural must be a Good Thing, right?
Yeah, kinda like Hemlock is natural.
Check out these links before you hit the natural foods store:
Rosemary Jacob's Argyria Pages -- her skin is a fetching shade of blue-grey, somewhat like the robot on Futurama.
Politician turns blue from drinking 'health' solution -- the Libertarian US Senate candidate from Montana would have had the distinction, if elected, of being the only Blue member of Congress. (I'm a Green, myself).
Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
Think about this: If I get shot in the arm
No, think about this...
Bacteria is everywhere. It's always growing, reproducing, and constantly mutating. So, if you take a sample of any given group of bacteria, it is easy to assume they won't all be of the same breed, and even those of the same breed won't all be of the same genetic line. The fact is, being simpler lifeforms they evolve and mutate faster.
Now, let's say you manufacture a chemical that will kill bacteria "X". You take a dish full of bacteria and since they're very obviously not all the same it is highly possible that a few of those millions will be immune to your neat little chemical. You pour it in and you take a count and let's say only a few dozen live. Well guess what? When they reproduce you're left with a colony of bacterium that is immune to your neat little drug. Next time it gets a good growth pattern going, your antibiotic may not be as effective.
Fortunately, our bodies fight infections on their own, so antibiotics aren't a "kill all" type of attack, but more like a "kill most and let the body take care of the rest". For this reason it is a good idea to ALWAYS take all of your prescribed antibiotics, assuming of course you actually needed them in the first place. You are basically helping your body help it's self.
This too is a gross over-simplifaction but...
"Everything you know is wrong. (And stupid.)"
Moderation Totals: Wrong=2, Stupid=3, Total=5.
Don't be an idiot. Where's the evidence (real or anecdotal) that the average guy who doesn't finish his antibiotics says to himself, "Well, golly, since evolution is just atheist propoganda, there is no reason for me to fear antibiotic resistance developing in bacteria--THEREFORE, I will now stop taking my antibiotic regime."
Don't be stupid.
"Doubt your doubts and believe your beliefs." -- Switchfoot, Ode to Chin
Sometimes this works backwards, but I used to have some really bad allergies to animals: cat fur, feathers, etc.
After toughing it out in clean fresh air, coupled with visits to the chickens in the barn, etc, most of my animal allergies went away. I was still allergic to cats, but got rid of that after we got three of the shedding creatures.
In reverse cases, sometimes the allergies chip away at the immune system, causing gradually increasing sickness. But in most cases I've heard of, low exposure over time builds tolerence.
*Note: That's low exposure, stuffing a kid with allergies in a house of 50 cats is probably not recommended in the short run...
Citation please? I find this incredibly hard to believe. Not that anti-biotics could have some effect, but that a viral infection can undo the vast differences between eucaryotic and procayotic metabolism. My molecular biologist friends think that that idea is utter horsehit.
You can only drink 30 or 40 glasses of beer a day, no matter how rich you are.
-- Colonel Adolphus Busch
If that heroine is Sarah Michelle-Gellar as Buffy, count me in as an addicted user.
However, heroin involves sticking a needle into my arm. Not going to freaking happen.
MORTAR COMBAT!
You might not have noticed the new standard. I say, "It's about time." I doubt my very republican state even had labeling laws.
'SBEMAIL!' is better than a goat!!
(Completely agree with parent post, minor correction, then rant)
MRSA actually means Methicillin Resistant Staphylococcus Aureus.
Now we have VRSA. Vancomycin Resistant Staphyloccocus Aureus.
There are no "wonder drugs" in the pipeline. We're reaching the end of the road for antibiotics. It won't be sudden, but it will happen.
Many diseases we currently think of as relatively trivial are going to become real killers again. Millions of people are going to die.
It won't be the young, fit and healthy as much as the very young and the very old.
But let's keep feeding the antibiotics to farm animals. It makes them more profitable. Got a slight viral cold? Demand antibiotics. It's your right.
It's the tragedy of the commons again.
Crazy question for microbiologists: Is it possible that resistance to a specific antibiotic costs an organism enough that it could no longer out-compete it's non-resistant cousins? Would it be worth infecting someone who has a resistant strain with a non-resistant strain in the hope that the non-resistant one will 'win'? Then, (if the patient still lives), treat that with antibiotics?
Or are you going to get so much genetic transfer that it's worse than dangerous?
Staph is found in the general poulation. A significant proportion of us are carriers. So please, wash your hands after you pick your nose :)
Heck, some bugs they found in antartica have the ability to withstand over 10000x times the leathal limit of radiation for a human, and they take it, no sweat.... Just think about what would happen if it was crosses with this strep mutant and releases it in a populated center... Well, there would be no more overcrowding ;-)
Sig
One slice of roast beef fits in my hand, as does 50.
hah hah. I said the same thing, but I was actually being serious when I said the palm of your hand.
A slice of roast beef, if balled up, might just fit in your hand perfectly if you clasp your fingers around it. Maybe two slices. It's going to be different slightly for everybody, and it's hardly scientific to use "the palm of your hand" as a way to gauge how much you should eat.
The reason I've been told the palm of your hand is a good rule of thumb, though is because a "handful" of meat, the size of "your hand" is a close aproximation of about how much meat someone your size should probably be eating.
I know it sounds silly, but believe me, if I were to say you shouldn't have any more than 2 ounces of meat a day, someone could turn around and say "But I'm 6'5" and 270 lbs of hulking mass." If that's the case, that person's palm is probably also about 6 inches wide, and he very easily might need more than a couple of ounces.
Of course, I'm not a nutritionist myself, I just have the rather unpleasant curse of knowing a few, so I can't lay out a proper diet plan for you. But I can tell you it seems to be pretty much agreed upon by those who should know that you really, truely, honestly, do not need to be eating very much meat.
This is of course not the same as saying "Don't eat meat." Do not confuse the two statements. Apparently, protein is NOT the only important thing you get from meat.
"Everything you know is wrong. (And stupid.)"
Moderation Totals: Wrong=2, Stupid=3, Total=5.
> Staph is a normally not seen in the general poplution.
Actually, S. aureus is fairly common in the general population. It is often found on the skin and hair and in nasal passages. Generally, it becomes a problem if it gets into the bloodstream.
It is Staph, not Staff. I hope you were joking.
That wouldn't solve the problem. If a lot more people become vegetarians, then you'd need to grow more vegetables. That means you need more pesticides, and possibly some genetic modifications as well. Fact is, the conscious American food shopper is in a real bind today. Hormone and antibiotics laced meat, abused poultry and pigs, pesticide laced fruits and vegetables - what's there to eat? There are organic foods, but can their production scale up and cost come down enough?
Read even more slowly. The article says:
Staph aureus is a common pathogen that infects about 400,000 U.S. hospital patients a year. About one-quarter of them die. For decades, scientists have been dreading -- but expecting -- a staph aureus strain to emerge that is resistant to vancomycin.
This means that "common pathogen" staph, not a super strain that the article is supposedly about, kills 100,000 people already weakened enough by something else (it is implied they're hospital patients when infected). This is nothing new, and it's certainly not the "dreaded" strain of antibiotic-resistant bacteria doing the damage. The current death rate certainly illustrates that infections and hospitals can be dangerous to vulnerable persons, but it doesn't belong in this story.
The presentation is confusing, out of carelessness or a desire to pump up the story.
That would be fine if people were willing to isolate themselves when taking antibiotics. Because no one would want to do that for strep throat doctors prescribe a single common anti-biotic that shows promise in the petri dish.
If people took a cocktail of antibiotics for every sniffle we would find the super bug very fast.
Not only would the super bug have no "bacterial competition" in the host to slow its proliferation but any transmition of bacteria would have a very high likelihood of being from the superbug strain.
Basically its good to crowd out weak resistant bugs with stronger vulnerable ones.
Cocktails are a Bad Bad idea for the general public.
But then you need bacteriophagephage to kill the phage.
"And like that
The hospital that my father works in has had similar cases in the past: infections that would only respond to the latest antibiotics.
This is rather worrying, especially when you think that the main cause of all this resistance buildup is GPs prescribing antibiotics copiously (at the behest of patients, true, but what's wrong with giving placebos? Probably will get them lawsuits for misleading the patients, hmm) and commercial farming where antibiotics are used liberally to stock up the animals..
Michel
Fedora Project Contribut
what your suggesting was proposed by a French scientist a few hundred years ago by the name of Laplace. It is usually referred to as Scientific Determinism. However, modern quantum mechanics theory and the uncertanitity pricipal have shown that it is not possible to predict everything in the universe to the degree of precision that Laplace had hoped for.
Lawyers, MBA's, RIAA? A jedi fears not these things!
--hmm, seems I made a point about not scarfing down gallons of it in the original post. I use it externally, and as a mouthwash/rinse with some salt stirred in. works great for me for that purpose as well. Took care of a tooth infection deal I had when the 40$ prescription stuff didn't phase it. I think I tried swallowing some straight twice or thrice but not beyond that, just for the taste and to feel it. zip, tastes like water.. If faced with like a biowarfare attack scenario, with nothing else, I plan on trying it should I get infected. Not counting on uncle sugar to have remedies for warsaw pact turbocharged and blended biowarfare cooties. I look at it as a "whut the heck" deal in a case like that, similar to these people now who are being treated by being basically stared at.
Like, cut me some slack that the shots for civvie smallpox will be effective against weaponised.
With that said, let the people with advanced SA rot, rather have them rot away then perhaps turn blue colored, right? Me, I still got a big chunk gone in my leg from the stuff, had I known about CS back then I SURELY would have tried it on it, heck, tried everything else they had at the time, I mean everything.
And why do they use silver in drinking water filters and some of the newer better quality swimming pool water filters?
Don't know, not a chemist, maybe someone noted it worked. Maybe size of dose has something to do with it, and size of particle suspended. No idea. will say it works better on external infections than anything I ever saw or used. And fast too, and seems to help with scarring problems. Of course at 2 cents a gallon to make it, I can't see any big companies falling over themselves to "prescribe" it or "recommend it" to doctors. I sorta have they impression they dig on the 40$ a pill stuff more, just a hunch, but something I've noticed the past several decades.
And would they stoop to an "anti missile" propoganda defense on the ole intarweb? Naw, why would they do that to protect their 200 billion business, generally speaking?
Internally, no idea. I think taking large doses of anything is usually a bad idea, just because something is sold from the pharmco and is manufactured by some large konzern doesn't mean it is either safe, nor even effective. Was just reading about lariam for instance. Gee, gimme some of that stuff-not!
Remember , always trust official doctors and government spokes persons, they never tell whoppers, like about agent orange and dioxin (safe as mother's milk) or gulf war syndrome (it's all in your head) or thalidomide (here, take this for motion sickness, it's safe), or lately the lariam for malaria.
Sure, they never lie about anything, they got 100% verified track record of being scrupulously honest. They've never lied to protect big business profits, never. (anthrax shots in the military)
I'm only relating my anecdotal, to each their own. I avoid quack stuff too, just I don't pick and choose one "side" or the other, that's just denying yourself data, and it falls into the lame category.
Google.
Whew. That was hard.
Do not read this sig.
Staph.aureus on your burger is unlikely to kill you. You might get a nasty stomach upset though.
The latest all natural fad being used as an anti-microbial is "Grapefruit Seed Extract" (commonly called GSE).
I discovered it when it was recommended to me for a nasty GI virus that wouldn't go away by normal starvation. Killed the sucker right off. As a nursing student I will be trying to bring this into any hospital I eventually work for.
Hopefully, and I don't see why not, it will work against antibiotic resistant bacteria and viruses.
A good overview
Here's a good summary from another site:
Grapefruit seed extract is derived from the bioflavonoids found in the seed and pulp. Its anti-germicide action has shown a growth-inhibiting effect on bacteria, fungi, parasites, and viruses in several in vitro studies. The effectiveness of grapefruit seeds was discovered accidentally by a doctor, who noticed that the seeds did not decompose in his compost file. Further examination revealed that the grapefruit seeds killed any microorganism that tried to decompose it. Laboratory studies have shown it to be effective in inhibiting bacteria such as Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. Grapefruit seed extract has been formulated by a number of manufacturers for various uses, including an internal bactericide, water disinfectant, skin cleanser, and first-aid spray. Grapefruit seed extract is also a treatment for house pets and livestock that may be susceptible to bacterial infections from a variety of sources.
The surviving bacteria swapped genes from another organism, thus "evolving" to allow them to survive, while the rest of them (quite probably the majority) did not, and died. However, the one(s) that remained, with the resistance, multiplied. Sounds like both to me.
Hi, let me go ahead and clear up something that someone else was wondering, and about which you seem to be a little confused.
.. because it changes so much.
HIV is the Human Immunodeficiency Virus. It is the virus that causes AIDS, which is Aquired Immune Deficiency Syndrome. A Syndrome, in medical parlance, is a group of symptoms that occur together. So AIDS is a condition, caused by the virus HIV.
Anyway, now on to the show. The reason HIV is so hard to destroy is that unlike most lifeforms, when it makes a copy of itself, it makes an "error" FAR more frequently than in, e.g., our cells. That is, HIV's reverse transcriptase makes an error something like 1/1000 base pairs copied, which is why we cant make a molecule to specifically attack HIV
Theoretically it could indeed become airborne, but, as another poster suggested, I don't know if a) it already is and b) if so, or when, how many ppm / particles / whatever it will take to get someone with a normal immune system sick.
Cheers!
James
Certified Dork
Multiple anbitiotic resistance in bacteria is documented. I can refer you to a brief article which shows that the med community is aware of it.
* Tenover FC, Hughes JM. The challenges of emerging infectious diseases: development and spread of multiply-resistant bacterial pathogens. Journal of the American Medical Association 1996;275:300-304.
Also, we can consider this from two points of view and see why it's reasonable:
1.) bacteria can transfer genes from one to another by plasmid - a plasmid is a small circle of DNA that's not part of the bacterial genome. so one plasmid can code for resistance to antibiotic A, and another plasmid can code for resistance to antibiotic B. this modularity just from the molecular biology of bacteria makes bacteria well-equipped to deal with multiple assaults. a bacteria doesn't have to independently develop resistance, it can acquire it easily from another bacteria, mix and match etc.
2.) the nature of darwinian selection of the survivalists means that, while it is *unlikely* for any particular bacteria for develop resistance, *once* it does develop resistance, then it will likely survive and multiply under heavy antibiotic environments.
"It's not so much 'theft' as 'mating'. . .gene exchange is just one method by which bacteria maintain genetic diversity."
:) ), bacteria species not their own, and even stray bits of DNA floating in the environment.
While some kinds of bacteria will exchange DNA through a process similar to mating (called conjugation, no less), others can pick up DNA from dead bacteria (micronecrophilia?
Nonsense. At least in this country (the .us of A) all you would have to do is stop paying people not to farm. You might spend the same amount supporting farming. There's plenty of farmland which is not in use. You could also go to "alternative" crops like amaranth which is healthier for you than wheat, can be made into 99% of what wheat is made into, and has a higher yield per acre. It also grows in less ideal (read: crappy) soil. So if you need more yield, there are a number of ways you can get it, at least one of these should work almost no matter where you live, politically or ecologically.
There are problems with this too because this is the real world, but the point is, growing more plants with less pesticides is not only possible, it is trivial.
"You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
Maybe because, apart from the virus/bacterium thing, it's 100% correct?
No matter what kind of infection it is, you should still take all your meds.
Ah, so if I were to argue you should take all your meds because otherwise the elves will take you away, that's informative too?
7 November 2006: The day Americans realized corruption and incompetence weren't addressing 11 September 2001
Aside from increasing awareness of antibiotic resistant bacteria (ARB), and increasing intervention efforts, the big questions that should elicit the most worry are:
1.) whether intervention, by diminishing use of antibiotics will be _effective_?
2.) And what is the timescale in which we'll see our intervention efforts start to work?
Regarding 2., I mean to ask, how long will it take before the ARB begin to go away and be replaced by normal bacteria? If it's quick, then we should not be so worried. And that would be a silver lining for those who are thinking of tackling this problem. If it takes a very long time, then we should worry more.
And even more importantly, for the long-term planning people
3.) Once ARB have been reduced in bacterial populations, how easy is it for bacteria to acquire resistance again?
For answering 3., unfortunately, it's probably _not_ the same as bacteria acquiring resistance for the first time. From the molecular biology of antibiotics and bacteria, we know some antibiotic resistance genes are placed onto plasmids. Plasmids are separate from the bacteria. They are small, modular pieces of DNA that can encode resistance. Once you develop resistance, you can keep or pass these plasmids around until needed. Even if resistant bacteria die, the plasmids may still remain in existence. Thus the molecular biology of bacteria tells us we should consider these things to fully understand our intervention efforts.
We are uncertain, I believe, of the evolutionary time scales of all these events. (except for the one telling us how long it takes for antibiotic resistance to develop!)
Yeah, Alyson Hannigan (Willow) is much better.
I could have sworn Willow was a man, a midget, played by Warwick Davis.
Will I retire or break 10K?
If a lot more people become vegetarians, then you'd need to grow more vegetables. That means you need more pesticides, and possibly some genetic modifications as well.
Actually, if a lot more people become vegetarians, then you'd need to grow less vegetables!
See before you can eat meat, you need to grow plants for the cow to eat. To make enough meat to feed 1 human, the cow eats enough vegetables that could directly have fed 5 humans.
So a vegetarian requires 1/5th the vegetable production that a meat eater does.
more vegetarians == Less vegetables == less fertilisers and pestisides etc != not more
Don't let Malda sneeze near you:
Staph aureus can live innocuously in the nose of a healthy person. About 5 to 10 percent of Michiganders have it and don't know it, said William Brown, a Wayne State University pathology professor.
gene exchange is just one method by which bacteria maintain genetic diversity.
Genes are software. Thus, bacterial conjugation is a form of software exchange, or "SEX" for short. Or is it piracy?
Will I retire or break 10K?
And the reason behind THAT is that it's better for the INDIVIDUAL to consume a lot of antibiotics, even while it's bad in the long term for society. So who's going to risk losing their life to infection in order to prevent antibiotic-resistant strains of bacteria from evolving? It sure as hell won't be me, thank you very much.
Not that bacterial resistance isn't bad enough by itself, but I think it's not inconceivable that "superbugs" resistant to everything at once could be created intentionally as biological weapons...that would be fun...
Omnes arx vestrum sunt adiuncta nobis.
Triclosan is not an antibiotic. Antibiotics such as vancomycin are a mold. Triclosan is a chemical.
Despite very wide use, so far no one has discovered organisms developing resistance to triclosan. Which is not to say it can't happen, but so far it seems ok. Furthermore, triclosan is not something you can use to fight infection, so medically speaking it is irrelevant anyway.
If there is a problem with triclosan, it is that people could be exposed to abnormally few bacteria, and that perhaps this could weaken the development of the immune system (or something).
Personally, I doubt that bacteria will develop a resistance to triclosan. It would probably be about as difficult as developing a resistance to alcohol, which is apparently pretty much impossible for the poor little bacteria. Too bad for them.
S. aureus is scarey, sure, but really only if you are already sick or immunocompromised. The really scarey bug, one that was almost under control until relatively recently is Tuberculosis .
There are a number of MDR Tuberculosis strains (many originating in the former USSR, but also in the drug ghettos of New York).
The difference between S. aureus and Tuberculosis from the point of view of community health is that to get consumption (from an epidemiological point of view), all you need is to live in high density housing in an area where Tuberculosis is present. The advent of MDR strains makes the likelihood of an infected individual being nearby higher and the possibility of treatment less (already difficult with 6 month courses of antibiotics being the norm for standard strains - the main cause of MDR appearance seems to be drug users going off courses and poor hospitals in old Soviet backwaters).
There's just so much to look forward to!
Don't believe the nonsense, unless you hear it from me directly.
My father, a physician and microbiologist, has had to deal with many resistant biological organisms as of late. He is an vocal opponent of prescribing antibiotics for every little sign of illness, something that has become all too common these days. We often forget how much easier it is for small organisms with low, or single cell counts to adapt to change.
Another one of my friends recently got a job doing biological analysis of airborne organisms in one of Montreal's biggest hospitals and has found a surprising number of drug-resistant bacteria.
Unfortunately it's something we'll have to live with, and for the drug companies it's a gold mine. They can charge whatever the market will pay for the latest designer anti-biotic. In the end, and as with many things, we will suffer for the excesses of the past, but we can affect a change. It's all in attitude. OpenSource drug companies... now that's wishful thinking.
Not always, at any rate. The only time you should be prescribed antibiotics for a viral infection is if you have a secondary bacterial infection as well.
;-P
For example, some people with long-standing bacterial infections (that can come with diseases such as Cystic Fibrosis) are put on antibiotics when they contract a virus because it makes said bacterial infection flare up, and treating that with antibiotics will let your immune system concentrate on the viral infection.
Another thing about overuse of antibiotics is they kill off all of the "friendly bacteria" in addition to the ones that are making you sick. I believe that is part of the reason antibiotics upset some people's stomachs so badly. Or, at least, I've known some people who have found relief from that problem by taking supplements of friendly bacteria such as Lactobacillus Acidophilus.
I'm not a medical doctor, so consult yours before you make any changes in your healthcare management. Duh
~Silvermask
"Wild nights are my glory"
I think your figure comes from corn-fed cows. The number would probably differ for grass-fed cows, which do not need as much cultivated crops. It might be better if we ate less meat, and not pump the corn-fed cows (which can't even digest corn) full of antibiotics and hormones, rather than stop eating meat altogether. I don't think there's enough evidence that cutting animals out of our part of the food chain entirely will do good in the long run.
It's almost inevitable, given human history, that cow farts are responsible for preventing global warming or something, and we won't realize that until we get rid of the cows.
Gee, I thought I even gave it away with the 'I made it up as I typed' bit too... Oh, well... flame-bait it is, I guess...
"Quotation is a serviceable substitute for wit." --Oscar Wilde
The question was previously posted about whether God knows everything that will happen or whether we have free will. My answer to that is that we are spirit children of God, and just as a parent knows the faults and virtues of each of their children, God knows how each of us will act in a given situation, because He knows us. He is also kind enough to let us do what we want to do, because He wanted us to learn by our own experience. But because He must be a just God too, He allows us to experience the consequences of our actions, good and bad. This is a big topic, so I can only be brief.
I personally believe that Creationism and Evolution are pretty much the same thing, but one theory leaves God completely out of it. There is no reason why the period of a day in the Bible has to be 24 hours long, just like the expression of doing something "in the 11th hour" doesn't necessary mean it was done at 11 o'clock or that it was an hour long. Just as "in the 11th hour" implies preparatory action taken just before it was too late, perhaps a day out of the week of creation was an age of working on a particular stage until it was done. How would a timeless God describe creation to a mortal?
-SheWhoWalksWithToesLikeCobras Please enter any 11-digit prime number to continue...
How about we want them to keep evolving toward a state where they need the antibiotics to survive only to pull the chair out from under them by withdrawing it later. Hmmm, there is a though, cure a disease by cutting off the cure. Man the Big Parma companies will just love that idea. They will send you to a Detox to clean out.
Sorry about the writing. Robot fingers, you know? Cliff Steele in DOOM PATROL #23
Vancomycin-resistant staph is really bad news. Vancomycin was the last line of defense among antibiotics that have been tested. Its successors are very recent and might have side effects that haven't been detected yet. Not to mention that they are very expensive.
That's one more reason why it's a bad idea to use antibiotic resistance genes as selection markers in genetically modified organisms (GMOs). The process goes like this: A researcher wants to splice, say, a sheep's wool-producing skin gene into common corn so that the GM corn will have wooly fibers (cheaper wool, great!). The researcher prepares thousand of modified cell cultures. The gene splicing has succeeded in only a small percentage of them. How does he select the cells with the spliced gene? Easy: He also splices another gene, coding for antibioresistance (ABR), and looks for its signature in the Petri dishes, using standard reagents.
Then when the wooly corn is marketed, all its cells carry the same ABR gene. Eat the corn, and the bacteria in your guts get a chance to acquire the ABR gene from exposure to it. Then you get sick. The doctor prescribes antibiotics. All the E. Coli in your guts are killed, except the infinitesimal fraction that acquired this ANR gene. Then the surviving fraction repopulates your intestine. All your E. Coli population is now ABR. They will transmit the gene to some pathogene sooner or later.
Understand me, I don't really think that GMO are evil. Some GMO are actually very good ideas. The problem is that implementation of the idea with selection through ABR is very dangerous. Look it up for yourself.
--
Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/
Does this mean that if I'm smarter than you, then you're a valid meal for me?
Any sufficiently well-organized community is indistinguishable from Government.
I don't know about this guy's compost pile, but I can tell you from my various attempts to sprout grapefruit seeds, that they do indeed rot (quite nastily) if conditions are too wet and the seed "drowns". OTOH, *NO* seed decomposes so long as it is still alive. So there's nothing unique about grapefruit seeds in this respect.
However, you might look into apple seeds. When I was a kid, I discovered that a peeled and crushed apple seed held against a canker sore for 10 minutes would cause very rapid healing in 90% of cases. Maybe a cyanide compound of some sort, killing a specific pathogen, I dunno (never bothered to pursue it, no idea if anyone's researched it).
~REZ~ #43301. Who'd fake being me anyway?
Nearly all nutritionists? What, you mean all the back alley "teach yourself nutrition in 24 hours" ones? Oh yeah, in that case, nearly all those will say such crap.
Eating "less" meat is definatley better than no moderation at all, but to say that fish, turkey, chicken, etc, are better alternatives is a bunch of crap. Poultry are pumped full of the same crap they administer to cows. The FDA still recommends that you don't eat fish more than once a week, because of mercury levels.
And besides that, even doctors who say eating meat isn't all that bad, still agree that a proper vegetarian diet is better.
A slip of the foot you may soon recover, but a slip of the tongue you may never get over. -Benjamin Franklin
The resistance markers used are commonly things like ampicillin. While bacteria in the lab may be sensitive to this, most organisms in the wild became resistant long, long ago. You don't need to worry about resistance markers used in the lab, even for crop selection.
Not only am I a scientist, I play one on TV
I and many others have cured ourselves without antibiotics, and I want to tell you how. This by no means qualifies as official medical information, it's just what happened.
Disclaimer: I am not a doctor and this is not a scientific analysis. This is just my story. It worked for me. If you have staph you should seek medical attention immediately. It's no joke, and even the doctors may not be able to help you.
OK, if you have a weak stomach, stop reading now.
First I should explain how staph attacks you, typically. Usually what happens is that you get a nick on your lower leg, and it just won't heal. Soon you have a festering infection which grows rapidly. It's amazingly efficient and agressive. It eats a sizable hole in your leg, and then starts to spread. You start getting pimples on other parts of your body which quickly grow and soon your are covered with round, dime or quarter-sized oozing festering holes. It's pretty horrifying. If you don't do something about it, you will end up with serious problems.
I was infected for a couple of months, but I recovered without antibiotics, and many others have by using similar techniques. I have thought about the whole experience a lot, and I think I can identify the core elements of a successful staph cure. These elements can be divided into two main categories. First, you must have some kind of internal defense to prevent the spread of the staph through the bloodstream and the intercellular fluid. In the usual cure this is done by antibiotics, but these are losing their effectiveness. But fortunately your body comes equipped with an immune system for this purpose, but you must do everything you can to strengthen it and give it the advantage over the bacteria. Secondly, you must have some sort of external attack. This is the really horrible part. The staph burrows under the dead flesh it kills, making it extremely difficult to attack from the outside.
Internal Defense
External attack
This can be divided into two phases. In the first phase, the staph colony is expanding into the flesh around it, and your attack must be very aggressive. In the second phase, your body has isolated the colony and built a membranous wall around it. Then the treatment must be very gentle.
Phase one; Expanders:
During this phase, I think the wounds should be left open. This is to encourage them to ooze pus, which is actually a good thing because it establishes an outward flow of fluid and slows the staph down. The objective of this phase is to slow the growth of the colony enough for your body to build a membranous wall around it, isolating the infection from the intercellular fluid and allowing the healing process to begin.
Phase 2; Contractors:
You will know you have entered this phase when you stop finding so much dead flesh, and the colony slows its growth. At this point you build a wall around the infection, and within a couple of days the remaining dead flesh outside the wall should come off easily, without extensive scrubbing. Now you must change your approach:
Gradually the wound will begin to shrink. You must stick with the treatment rigorously and stick to the diet mercelessly. The cases that go on and on are the ones where the person simply cannot force themself to avoid sugar, alcohol and cigarettes, and just keep getting new infections.
Also, a note about clenliness. It's really important. You must clean and disinfect your entire environment completely all the time, especially your clothes and bedding. Do lots of laundry, take lots of showers, use chlorine liberally.
Well, that about covers it. After two months of this horrible daily torture, I finally got a grip on my sugar consumption, cured my last big sore, and recovered. I have big scars on my legs to tell the tale, but I'm actually grateful for the experience. It builds a hell of a lot of will power, which is useful stuff.
Good luck, and may the Force be with you.
My site: Free Nature Pictures
So many people take anti-biotics for everything, and don't complete their prescribed courses, that people forget the other tried and true methods of helping your body and immune system fight a cold.
1. Inhalation of steam and an antiseptic agent.
Eucalyptus oil or Tea Tree oil in water, then heated/boiled is a great way to kill off bugs in the air. Very good for throat/nasal infections. Scented burners are good value for this.
2. Acidic foods/liquids.
This includes oranges, lemons, apples, grapefruit and tomato, including juices of those. Vinegar, particularly cider and malt vinegar, can be good if used as a mouth wash/gargle or ingested (if you can). Salt is also a good thing to ingest when ill, but as always, too much is bad for you. Yes, I am advocating salt'n'vinegar potato chips here. *grin*
3. Mouth washes.
Cider and malt vinegar work well, as does salt water. Iodine throat wash (commonly found under the "Betadine" brand) is also very good, but don't swallow it. Listerine and other mouth washes (for teeth care/plaque) are also good value. And brush your teeth too.
4. Suppliments/herbal treatments.
Echinacea, and other herbal suppliments can help, though be warned that some may have bad or deadly side affects for some people. Ginger is used lots in Chinese medicine, and is apparently quite good for helping someone overcome a cold, but some people are allergic to it. Vitamin suppliments are also good if you haven't been eating right, or can't keep a lot of food down.
5. Fluids.
The kidneys are a primary place for a virus to be flushed from the human body. Don't drink too much though, as it is possible to kill yourself from taking too much fluids.
6. Regular wash/shower.
Sweat is another way for fluids to leave the body, and regular washing helps remove some viruses.
This is not a definitive list. But I'm hoping someone out there might find it useful. There are a lot of NATURAL ways to fight a cold. The goal is to help out the body. If that is by helping to remove the virus or most of the things the body fights against on a regular basis (air-born contaminants, throat bourne virii, etc), then you body will have more resources to chuck at other areas. Just think of the whole thing as a resource based game, where you are the resource. Remember though that too much of something can be bad though, so balance things out.
I remember reading an article about a study where scientists took samles from the dorm rooms of messy college students and also from homes which were cleaned often with anti-bacterial cleaners. There were more germs in the college dwellings, but the germs found in the houses cleaned with anti-bacterial cleaners were much more dangerous. I don't remember the exact conclusions drawn, but there was definitely a link between the anti-bacterial cleaners and the dangerous germs.
To put this in a different perspective, we should be surprised we ever were without bacteria. As various clever posters have pointed out, bacteria are both everywhere (including in living in symbiosis inside us), and evolve easily and quickly. Of course the bacteria found a way to keep on living and reproducing. That's a pretty key goal for them.
So it's really a surprise, and notable accomplishment, and a setback that we found a method like antibiotics to hold them at bay for so long. The surprise and accomplishment should be obvious, but the setback is the following. It should be rapidly snapping into focus that human health, either on a personal or societal level involves balance, careful listening, and acceptance of risk. As all the informed consent speeches tell you, you may die anyway. There will not (and to my mind should not) be a moment when medicine will be able to insulate you from the risk that you could get sick and/or die. But as a consequence of advances in medical science such antibiotics as we've moved more and more towards magic bullet solutions of particular problems, and away from a simpler but subtler view that you have to take care of yourself to be healthy, and things might go left anyway.
Don't get me wrong, I'm not saying that it wasn't good to quash the snake oils and tonics of the turn of the century with a little hard nosed science, nor is wrong to do so today, but to see the picture more fully, you've gotta step outside the scientific viewpoint. I strongly doubt the canon of scientific medicine will ever be complete enough for you to have to work hard at using your judgement about your health and accept the risks of disease. So kudos to those who bring together the insight of "scientific" medicine with other worldviews of medicine.
MRSA strains with intermediate resistance to vancomycin have been seen in many parts of the world since 1996, and patients certainly have died as as result of vancomycin treatment failure. However, these perhaps weren't so scary as the resistance mechanism was a very thick cell wall which made these strains very slow growing and not so viable in the absence of vancomycin.
What's new is that MRSA strains have now emerged with high-level vancomycin-resistance and this happened by acquistion of the vancomycin-resistance gene (vanA) from VRE. That this was possible was shown in the lab in 1992, but the first time it's been seen in patients was this year. The two reports of Vancomycin-resistant MRSA in the U.S. can be found in the CDC's newsletter:
MMWR Morb Mortal Wkly Rep 2002 Oct 11;51(40):902
MMWR Morb Mortal Wkly Rep 2002 Jul 5;51(26):565-7
How scary is it? Until recently MRSA has been almost exclusively a hospital pathogen, so it's pretty scary if you're a hospital patient with a lot of tubes sticking into you which alow the bugs to get in and cause infections, but if you're well it's not a big threat (doctors and nurses can carry MRSA, but generally they don't develop infections despite a lot of exposure). There have been reports recently of strains of MRSA that do spread well in the community, and that can cause serious infections amongst essentially healthy people. However, these have not been multiply-resistant strains, and really these are no worse than virulent strains of normal S. aureus which have been round for millions of years. The message is, if you're well, don't rush out and buy cipro (this will only helps MSRA as the bugs are resistant to it), and if you're ill, keep away from hospitals.
Just to rebut a few other comments: over-prescribing of antibiotics probably is very important for encouraging drug-resistantce, but even correct of use of antibiotics will lead to some resistance. Use of antibiotics in animal feed can't really be blamed in this case, as drugs of the same class as vancomycin (glycopeptides) have not been used in animal feed in the US, though they have in Europe. They've probably played a significant role in VRE transmission in humans in some European countries, but in the U.S. hospital prescribing of this and other antibiotics have probably been the driving force.
to wash your keyboard!
Amazing magic tricks
Look for Deinococcus radiodurans in PubMed:. fcgi
http://www.ncbi.nlm.nih.gov/entrez/query
As long as you're cute. *winkwink*
Seriously, it isn't how smart someone is. A bull would kill any of us before we could kill it in a pure environment, meaning no tools or weapons allowed. But we are smart enough to use tools to get our food, which includes guns to shoot animals that we could never kill with our bare hands. More importantly, we were able to domesticate some of those same animals, so they will walk down the path to the slaughterhouse almost on their own. That is what intelligence did for us, even for the vegetarians.
Besides, if someone says they are smarter than a chicken, I'm still not going to think to highly of their intelligence.
1. From time to time, something known as Golden
Staph is reportedly found in our hospitals,
and it closes any operating theatres it's
been found in...
2. There's a double standard of informing people
who might be working around/with those known
to have/carry golden staph, &/or communicable
diseases:
- police dispatchers alert attending officers
that suspects are known to carry (unspeci-
fied) communicable diseases, but
- health care professionals (who work with
similar disease carriers) are not told, ie
officially
Different ministries / gov't dep'ts,
different needs/rights to know...
Go figure! Or better: go improve things!
You are so right. All the cattle in Texas should be killed right now, and buried to enrich the soil enough that something other than coarse grass and sagebrush can grow there. Then divert the Mississippi to irrigate the whole area. Who cares if the Mississippi delta needs that water, we have to grow some vegetables dammit. Besides, New Orleans would probably appreciate having the river lowered about 20 feet anyway.
Yeah, right.
Why do you make it sound like 50% of the CROPLAND in the US is used "to grow plants for the cow to eat"? Much of the land for cattle is pastureland or the wide open plains. It isn't necessarily feasible to convert that space to vegetable gardens. They need fertile soil, and plenty of water.
Vitamin B12. Take a pill, and then you don't need meat at all.
It's kind of lame to arbitrarily restrict yourself to a subset of nature's built-in rules. If the bull isn't smart enough to build a millenial civilazation that strictly limits opportunities for humans to kill bulls, that's their problem. My idea of a fair fight is everybody using everything they've got. The bull gets his horns, and I get my cell phone.
Any sufficiently well-organized community is indistinguishable from Government.
I recently attended a conference by Pharmacia, the company noted at the end of the article, in which the topic was vancomycin resitant staph aureas. During the conference they informed us that vancomycin is one of the major anitbiotics our national poultry suppliers feed in bulk to their chickens. Thanksfully, Pharmacia is being very smart and not giving out samples of their antibiotic in order to limit the number of bugs (bacteria) that encounter it and thus reducing the rate of resistant strains. I think the company needs a round of applaus for that one.
From Psalm 23:
"Thy rod and thy staph shall come for thee."
Clearly, the rod is the bacillus bacterium responsible for Anthrax, and the staph is the aureus.
I agree that Sub-Therapeutic use of antibiotics may not be a good idea but to date there has not been a good study that shows any link between antibiotic use in animals and antibiotic resistantance in human infection. It is all theory at this point.
Most people don't know you can get antibiotics for food animals without a prescription.
The FDA is investigating cases of guys in the military buying (and using on themselves) fish antibiotics sold in pill form at the same doses used in humans. I don't know why military guys would do this when they have access to cheap/free healthcare. I guess it has something to do with being willing to jump on a grenade.
Anyway I had a friend in college who said he didn't like doctors. When he felt sick he would shoot himself in the ass with pig antibiotics he got from a feed store. He wanted me to tell him how much he should use so I told him to use a does between a sheep and a pig:) I finally got him to stop when I explained how he could die from anaphylactic shock.
I bet he could be trained to jump on a grenade too!
I don't mean to over-hype my de-hype (to further abuse the language); just a grain of salt in the context of the article about staph, which I felt to be misleading. This misdirection doesn't imply there's nothing to fear, and infectious disease is certainly going to be a growth business for some time to come. (Of course, it is the job of specialists in the field to worry about what's to come.) But the antibitoic resistant bacteria problem is still largely in the future, a class different from the sort of infections most of us face.
Maybe that future is arriving faster than I thought... Be nice if we could do something about those "breeding grounds" in the meantime. It's depressing to see someone older go to the hospital with a broken hip to die of pneumonia. Also, the kids who have died because of the poor sanitation in meat packing are so betrayed by a system that responds not with rules but "cook the meat more."
On prescribing antibiotics, assuming the clinician is not ignorant or pandering, it must be difficult. There's always going to be a fear of injury and liability resulting from undertreatment. This comes up with the treatment of ear infections in infants and toddlers. Most such infection resolve themselves without treatment, but the 1 in 5 (or whatever -- there was a study) that don't can cause hearing loss, impaired learning of speech, and so on.
FWIW -- not too helpful -- here's the CDC page on antibiotic resistance with a quiz!
Hmm, cranberry juice cocktail might be used against infection. You never know what will help.
Only 40% of people wash their hands exiting public restrooms[...]
I had read a similar statistic, but with a twist. I believe it said that only 30% of people washed their hands after going to the bathroom if they were alone, but if someone else was in there the number went up to like 85%. I'm making the numbers up, but it was a high-contrast situation.
I had a cow-orker who used to always go take a piss or a shit if he could and not wash his hands before working on the most hated people's computers. He thought it was an indirect way of getting them to kiss his ass...
The place most people miss when washing their hands is [b]in between the fingers[/b]. You can wash that area in less than a second if you just incorporate it into your routine. And it makes the washing [b]much[/b] more effective.
Interesting about the selective disadvantages of selection.
:)
It's also not super adaptive for a parasite to routinely murder its host. Exceptions are pathogens that are very contagious or have nice homes elsewhere, either in another species or in some durable form. Anthrax has the unusual strategy of killing its host as fast as possible, before it can mount a defense, and then multiplying its spores throughout the carcass. The spores are eventually released into the soil, get inhaled by the next unlucky ungulate, and off goes another generation.
I live next to DC, hence my personal interest in anthrax. And in any case, isn't disease fascinating?
I'm kidding, but I'll bet some genius here on slashdot will claim that the "evolution" of antibiotic-resistant bacteria proves that all life evolved from a single cell.
I watch Brit Hume on Fox News
I guess I didn't make my point very well, because that is what I meant. While you are smarter than a bull, you would be no match bare-handed. And it's not that you can use a cell-phone, although I would prefer a good shotgun personally. It's that humans have already invented and improved the tools we can use, so you can have that cell phone to use to defeat the bull, and also call your friends to come over for a steak dinner.
Of course if we ask the dolphins....
Where i live (new zealand) it is common practise to divert rivers to irrigate pasture for cows to eat.
There is a class of cytoxan/cytosporin chemotherapy drugs that are in fact extremely powerful antibiotics. But at any rate the future of antibiotics is in custom tuned monoclonal antibodies.
Tougher bugs need tougher drugs.
Vanco is almost always given thru peripheral IV lines. It is NOT like Chlorox and will not destroy your veins. It can cause Red Man syndrome if a poorly purified batch is given too quickly.
I use it all the time at work, we have patients with bone infections who often need to get it for 6 weeks IV to clear out theinfection, and they're ok.
..........FULL STOP.
By and large I don't worry much. There's worse things, and I've lived through one of them. Eat well, exercise, get rest and you're probably pretty safe. People who get TB and die generally live in shitty conditions and have poor diets.
A feeling of having made the same mistake before: Deja Foobar
Actually, no. Bacteria have a pretty easy time growing on stainless steel. It's brass and other copper containing alloys that they can't take.
http://www.fastinc.com/foodsafe_copper.htm
Copper shows antibacterial properties against E. Coli
Originally published 9/14/2000
Source: www.foodservicecentral.com
A recent study, conducted by Bill Keevil, Ph.D., of the Porton Down, UK-based Center for Applied Microbiology & Research (CAMR), found E. coli O157:H7 bacteria survive for much shorter periods of time on copper and brass surfaces than on stainless steel. According to Keevil, this finding has wide-ranging implications for controlling the microorganism.
The work carried out by CAMR team member, Andrew Maule, revealed that at room temperatures it takes 34 days for E. coli O157:H7 bacteria to die on stainless steel tiles, 4 days to die on brass tiles, and just 4 hours to die on copper tiles. At chill temperatures typical of food storage, the study found that 10% of the bacteria were still alive on stainless steel tiles after 34 days, whereas bacteria were completely eradicated on brass tiles within 12 days and on copper tiles in just 14 hours.
Evolution happens over millenia, not in the course of a petri dish while Hal the Scientist watches.
Evolution happens over generations, not millenia! A millenium may have 50 human generations. For bacteria, 50 generations takes about 24 hours.
Lets put it this way. During our lifetime nothing has evolved. Some things have mutated, and mutation is part of evolution, but mutation is not evolution.
If you think antibiotic resistance (mutation + natural selection) is not an example of evolution then you are seriously mistaken.
Chiro is interesting for a couple of reasons. The most interesting is that a good chiro will actually _listen_ to you. Every doctor I have seen either for myself or with my wife in the last 10-20 years always seems to be paying attention to something else... maybe their afternoon golf date or whatever. The second interesting thing about chiro is that it only works if the patient is proactive. Can't take a pill, no no no. Gotta actually do the damn exercises. It requires more work than going to the doctor. A third interesting thing about a good chiro is that if you say your back (or whatever) hurts, they might believe you. In contrast to an MD that may say "its all in your head". (As told to my sister-in-law for years until they discovered, too late, that she had a degenerative bone disease. The pain was "all in her head". Chiro of course would not have helped her, but the orthodox medical establishment didn't really help much either.)
:).
Lastly, a really good chiro will have a short list of fine surgeons to refer you to if you have an injury beyond their capability. It helps to have one that has actually had back surgery...
Hope this helps. Don't believe the hype by any means, but for the kind of (very real) back pain I have occasionally, a $60 visit couple of times a year to the chiro is cheap relief.
Whichever it is, seems like an awful long time to wait before leaving the bathroom.
I think that's a big part of the problem...people go to the doctor expecting to get a pill to make the sickness go away. I am sure there are some doctors who will prescribe some antibiotic for a bad cold or flu to make it look like they're doing something useful, rather than just tell the patient, "There's nothing we can do. Just spend the rest of the week in bed and drink plenty of fluids."
DennyK
Um...Antibiotic resistance in Corn wouldn't work...
Antibiotics don't work on Eukaryotes (like Humands and Corn). The way you do it with bacteria is modify the bacteria, then use the antibiotic to kill all the ones that didn't get the genes you wanted. Btw, usually they use penicillin variants when doing this kind of experiment because most wild bacteria are already resistant to it.
Since antibiotics can't kill corn, you can't use it to wipe out the unmodified corn. And while you cood look for the antibiotic resistance gene in the corn's DNA but you might as well look for the gene you're trying to splice in.
Okay, after seeing the article, right about the time this came on the news.
For the patience-impaired, a local (err, Houston area) high school has had a rash of staph infections break out and the infections are apparentaly resistant to antibiotics. Now I understand that we over-medicate everyone but what's next when things such as this pop up in more than just an "isolated" area?
"...we dont care about the economics; we just want to be able to hack great stuff."
Flamebait AND overrated? You people have no sense of humor...
"Quotation is a serviceable substitute for wit." --Oscar Wilde
This isn't an either/or question. If people ate less beef we would need less land, period. We wouldn't need much more fertile land because the fertile land that is used for cattle production and feed crops could be converted to vegetable production. We could use the land that isn't good for food crops for nothing and not rape the environment the way we are. The land is not being "wasted" if we aren't extracting every last resource from it.
The cattle industry is perhaps the most environmentally destructive industry on the planet, and we would be better off without them. I like beef but I already don't eat it very often due to the practices of the industry. If everyone at least cut down on it as well we would be better off in many, many ways. Anyone who lives in the West can see how much of the land has been destroyed for cattle ranching, and I'm sure it's even worse in Latin America.
Of course, the issue will eventually be forced upon the market by the long term environmental damage being done. Mark my words, in 50 years beef will be a luxury item due to the wastefullness of its production combined with more limited resources being shared by an expanded population.
But isn't the ratio of human:bovines,swines,etc higher than 5/1?
Could be, i didn't look up the exact figure when i made that post, but you get the idea...
Thanks for your comments. They have made quite an impression on me.
I now realise my argument that a vegetarian diet requires less plant production to be false. Your point about the taste of meat clearly refutes this.
Have you considered a career as a science teacher? I wish more of todays youth had your clear grasp of critial reasoning.
"It won't be the young, fit and healthy as much as the very young and the very old."
Drug resistent bacteria have the social security and medicare problems licked!
paintball
Just let the nasty things be outcompeted by things you can take. That means that you don't sterilize things when you don't need to, which for most people mean almost never. Use a moderate amount of regular soap when washing to remove any grease, and learn how to wash effectively. Most people just push the dirt around, probably to let it make new friends.
Does that sound odd to anyone else? Someone's willing to inject heroin into their blood stream but damn, you gotta watch out for those dirty needles. You wouldn't want to get an infection or something or oh I dunno.. die of a fucking heroin overdose maybe?!
I never take antibiotics unless clearly, unequivocaly indicated... period. I was sick the entire month of September with Mycoplasma (an "atypical" pneumonia), and took no antibiotics. IAAD, BTW, so I have access to any and all antibiotics... I took nothing. Want to know why?
Whenever you take antibiotics you are messing with your normal bacterial flora; those bugs that live in/on you all day, every day. These communal bugs will almost never make you sick. Taking antibiotics wipes out your normal flora, along with the bug making you sick. No problem, right? Wrong... think of it in terms of population dynamics. You are opening up lots and lots of living space for any organism that wants to set up shop. Since it's now an antibiotic-rich environment, what bugs could survive there? That's right... the resistant ones.
Most antibiotics are broad spectrum (some more than others), within their class... ie. gram positive or gram negative. Since I work in a hospital, I am around a bad group of microorganisms, often multiply-resistant. Hospital-acquired pneumonias/other infections are problematic, precisely because that's where wide antibiotic use has bred resistance. If you have a live-in older disabled relative you take care of, or work in a nursing home, or work with end-stage AIDS patients, etc, you might want to be extra careful taking antibiotics. Those normal flora organisms may be doing you more good than you think.
This phenomenon is evident in conditions like Clostridia difficile colitis, where antibiotics wipe out normal bugs and allow the Clostridia to overgrow.
My personal (not necessarily professional) advice is to suck it up. If you have a cold and/or mild/moderate sinusitis, deal with it... the overwhelming majority are viral. If you have coexistant medical conditions, you may need antibiotics earlier than a young, healthy person. If you are young and healthy, be thankful, and avoid antibiotics unless clearly indicated.
Also, this may sound self-serving, but listen to your doctor when he says antibiotics aren't needed... that's why he went to school. The "I know my body" and the "I always get antibiotics for this" and the "my body has a resistance to drug X, I need drug Y" (usually a much more expensive/worse choice) crowd are the bane of every physician's existance. It sounds patronizing (and somebody is going to take me to task for this, I can feel it) but listen to your doctor, and don't throw a fit.
Even if a man chops off your hand with a sword, you still have two nice, sharp bones to stick in his eyes.
>However, you might look into apple seeds.
They are high in what is being called Vitamin B17, or Laetril. Quite controversial in its application; and depending on who you believe, it either cures cancer or kills you. It is also found in Apricot seeds, and Linseed (flax).
The FDA never seems to like anything that can't be patented and make their business friends lots of money...so it's best to study the heck out of this yourself.
A good site
Here's the short answer:
What Does Vitamin B-17 Do?
Dr. Krebs discovered the Vitamin B-17 compound reacts to the enzyme beta-glucosidase, primarily located in huge quantities at the site of cancerous tumours. In this reaction, two potent poisons are manufactured by beta-glucosidase at the cancer cell site; hydrogen cyanide and benzaldehyde. Therefore, Vitamin B-17's toxic reaction destroys the cancer cell.
What Happens To The Excess Vitamin B-17 Not Consumed In The Killing Of Malignant Cancer Cells?
Dr. Krebs found that healthy cells contain an enzyme called rhodanese, that acts as a control agent. Rhodanese is common throughout the body yet not at cancerous locations. If Vitamin B-17 comes into contact with healthy cells, rhodanese detoxifies the cyanide and oxidizes the benzaldehyde, and accurately targets Vitamin B-17 at cancerous locations and not at healthy tissue. Any excess by-products produced by the reaction are expelled in normal fashion through the urine.
(My mama told me to always ask politely and NOT TO YELL.)
:) should be considered for a mod-up as well, even if it's a bit... detached from reality.
The parent of this message is written evenhandedly and fairly, despite being a reply to a post full of (IMHO) ludicrous claims and half-told stories.
That said, the grandparent's author replied, and isn't AC, so perhaps this message's sibling
(Now, it'll be interesting to see if my first "MOD PARENT UP" request tanks my karma!)
Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
I discovered it when it was recommended to me for a nasty GI virus that wouldn't go away by normal starvation. Killed the sucker right off. As a nursing student I will be trying to bring this into any hospital I eventually work for.
2 .htm"> second letter
Please don't. I'm serious.
As someone with medical training, you should KNOW that most diseases go away by themselves and there's no substitute for double-blind, placebo controlled studies to ascertain the efficacy of a given treatment. Please don't rip off poor people in their time of need by sending them to GNC to pay lots of money for various things that just don't work, and in some cases kill.
Note that no links to peer-reviewed articles exist on the link you provide. Just assertions who all curiously use the commercial name of the product. Look at the broad range of things it claims to cure...missing only "the vapors" and "consumption" to be pure snake oil.
A quick check of the FDA, however, reveals that these makers haven't bothered to put it to the test of actually trying to show it cures people instead of making outrageous claims:
first letter
a href="http://www.fda.gov/cder/warn/cyber/cyber200
And since the stuff you'll be foisting off on suffering, desperate people is unregulated, you won't even know that the brand they buy actually contains the advertised product, nor that it's safe.
Hell, I don't know exactly why switching everyone in the middle east to purple robes wouldn't bring peace, except that nobody's shown even a correlation between purple-robe-wearing and sudden elimination of religious fanaticism (though it'd be fun to try on Pat Robertson in a study). Similarly, since no one has actually shown that the concoction you ingested (if it actually contained what its maker claims it did) had anything to do with your improvement. It's not as if all your white blood cells up and died, leaving it as the only thing between you and death.
Please, go to pharmacy school if not getting a full MD before prescribing drugs, because that's exactly what you'll be doing if you recommend it to anyone.
And that's just plain wrong.
This is why I never understood that why someone who would go through all the trouble to weaponize anthrax (the 2001 anthrax mailer) wouldn't also take this simple step to also produce it from an antibiotic-resistant strain. Would this not be a simple matter?:
Mix a batch of 100 petri dishes, put varying quantities of antibiotics into each dish, from 1% to 100%. Harvest surviving bacteria from the strongest concentrations in which it survived. Repeat oh, about 100 times. Then do it again with another antibiotic, until you have some antrhax which nothing will kill. Then weaponize and deliver it.
Sounds simple. I wonder why they didn't do that - it would also make the strain more difficult to trace by DNA analysis, one would think. . .
These are my friends, See how they glisten. See this one shine, how he smiles in the light.
Sure, the hide looks great in your Bimmer.. but really, have you ever actually tasted a buffalo?
Although, since they're usually "free range", I bet it would solve this drug-meat debate. Oddly, last time I was offered Buffalo meat, it prompted me onto the path of abandoning my vegetarian beliefs, because I realized that like so many, I really had no problem with the eating animals part; we were meant to do that. It's the overprocessing, overconsumption, and mechanization of it that bothers me. Though come to think of it, everything we do to cows, I've met people who've done worse to potatoes, so there goes that argument.
thats going to worry a few people I bet.
In the free world the media isn't government run; the government is media run.
Antiviral drugs do exist--look into Amantadine, which is commonly prescribed nowadays for influenza.
Now, all that's left is for you to culture them, bottle them and distribute them to pimply hamburger-flipping terrorists who pour a vial into the secret sauce that goes into every McDonalds hamburger. Because strep is contageous, this would infect not only McD customers but their families and coworkers. Since the bacterium would be basically untreatable, it would get a lot more chances to infect others than ordinary strep, basically because you are infectious for much longer (however long it takes to die).
I can't think of a better way to terrorize American society than this. Parents would refuse to send kids to school, we would shun each other and view every sneeze with grave suspicion... in general, there would be great fear and a much lower quality of life.
Anyway, I hope the CDC is working on a way to prevent this nightmare scenario. If this were to happen, could we make a vaccine to prevent infection? Anyway, I would hope we'd have some line of defense, though it seems to me that if the bacterium breeders did their job well, they could design the bacteria to be resistant to whatever they want.
I don't watch The Simpsons so I have no clue about current characters in it. And I'm not posting anonymously because I've got karma to burn so I might as well strike a match.
And the brethren went away edified.
"If you have a cold and/or mild/moderate sinusitis, deal with it..."
Fuck me, Americans take antibiotics for a cold ? You learn something every day, I guess... What is the world coming to ? It's like the way patients have gas before the injections at a dentist- I can't understand it. What a wuss culture !
graspee
The evolution of antibiotic-resistant bacteria proves that all life evolved from a single cell.
Or in other words: "From a drop of water, a logician could infer the possibility of an Atlantic or a Niagra without having seen or heard of one or the other."
The distinction between microevolution and macroevolution is one of semantics.
We can neither love nor pity nor forgive. If you make a slip in handling us you die!
Yeah, right: http://www.robeysilver.com/silveraid/bottled.htm
$50 for a bottle of colloidal silver, $2 for a bottle of penicillin-VK, hmm...
2) In some cases this is done - "cotrimoxazole" (aka Septra, Bacrim) is a common combination of sulphamethoxazole and trimethoprim, which block two different parts of folic acid synthesis (needed to make nucleic acids). Theoretically, this should reduce the risk of resistance.
Most importantly, 3) combinations of antibiotics can have reduced effects. B-lactams (penicillins, cephalosporins) are most lethal to rapidly growing cells, since they block effective cell wall synthesis. Drugs like tetracyclines and macrolides (erythromycin) block protein synthesis and slow cell growth to a crawl (so that the patient's immune system can mop it up easily, assuming the patient has one). Combining the two is just dumb.
However, aminoglycosides (gentamicin, etc.) are often used synergisically with B-lactams, since the latter damage the cell walls and help produce leaks in the membranes of gram+ve bacteria, making it easier for the aminoglycoside to get through the thick cell wall into the nucleus.
Having lost two relatives to golden staph in the last twelve months, both of whom went into hospital with terminal conditions and both of whom died of staph instead. This particular Geek chooses to die with his pocket protectors on.
Cuiusvis hominis est errare; nullius nisi insipientis in errore perseverare.
Not kidding...
http://news.bbc.co.uk/2/hi/health/1907065.stm
Deleted
I have been taking Cipro for a under the skin infection which was caused by a hit to the shin (sparring accident with someone's knee in martial arts) and it got infected after a few weeks. No breaking of the skin was apparent, just the pain which slowly went away. My doctor put me on 10 days of Cipro since the infection looked quite serious. I know the requirement to take all 10 days, and intend to (2 days away) and the infection is going down and clearing up in color and size, but I have a question. To those people who use antibiotics as prescribed and complete there use, does using antibiotics throughout your lifetime make you more prone to resistant bacteria in your old age, or is it more a combination of the environment, hospital workers, clean environments (or not), and just the normal progression and evolution of these bacteria? Thanks, not in the medical field, and I know there are many books out there on this topic which I intend to read, Im sure those books would answer that question, but was curious.
Relive the BBS Past - One Byte at a Time! www.ssabbs.com
Nah! Everyone knows the average politician produces 3 times the methane of the average cow. And the politician produces it from the FRONT end!
Slow down, cowboy! It has been 4 hours since you last posted. You must wait another few hours.
Heh... this moderation finally convinced me that the moderators have no clue.
This post is right on the money. Go ask your family doctor if you want confirmation. I will ignore moderation from now on I guess. You can't trust it anymore.
Thanks, that pretty much answers my question as to why apple seeds cure canker sores. As noted I did wonder if it was a cyanide-family compound, given that the smell is similar to apricot and other pit-type seeds, and that there was also a fairly reliable tissue-numbing effect. Probably not the best thing to ingest in large quantities. :)
Flaxseed meal is now sometimes used in dog food. There is some question in my mind (as a longtime professional breeder/trainer) that some ingredient relatively new to dog food may be causing infertility, tho my first thought had been the high hormone levels that come with chicken from certain sources. Any idea whether this B-17/laetril has a negative impact on fertility?
~REZ~ #43301. Who'd fake being me anyway?
So. In my lifetime, I will eat 10 cows, or I could eat 10 hectares of corn. Every cow eats 10 hectares of corn, so if I choose to eat 10 cows, there must be 100 hectares of corn to support that.
The benefit of using an antibioresistant gene as a marker is that you can use standard reagents to look for it even in non-bacteria, or so I have been told. It's a matter of tooling.
--
Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/
Thanks for your reply. Very interesting point. If you have points, please mod up the parent.
However, my concern is that by swamping the environment with resistance genes for even "obsolete" antibiotics, we are making sure that these antibiotics will never be effective against anything anymore. That's one less weapon in a tough fight.
After all, the number of new antibiotics marketed in the last 20 years is quite low. Are we really sure we can afford to write off an antibiotic?
There are publications saying that if you stop using a selecting agent such as an antibiotic for a long periond of time, the corresponding ABR gene will probably mutate and degrade in most strains, making the antibiotic effective again, at least for a few years. But if you have copies of this ABR gene all over our crops, it will probably never disappear from bacterias in the wild.
Also, an AC below is making a point about BASTA resistance about which I know nothing. Care to elaborate?
Again, thanks for your reply.
--
Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/
i'm not sure if soap lowers the surface tension. or if that's the same as what i think it does.
what i thought, was that soap works as an emulsifier , allowing oil to dissolve in water. most of the dirt is stuck to oil and grease. so the grease is dissolved, and the water carries it and the dirt away.
i guess both these things are simplifications.
"What are we doing tonight?"
"Tonight we make soap. In order to make soap, first we must render fat."
Nice to see you modding up Hitlerian propaganda.
IANAL but write like a drunk one.
They are surely no friggin transitional forms between a fscking mammal that used to live on dry land and a mammal that eventualy may live on water only. No they are not. They were created like that. Thank the Lord for that.
In a sense any form of life is a transitional form. We could be evolving into something completely different and of course we are not aware of it and consider ourselves (or any other species whith which we are familiar) "non transitional" which of course is a load of rubish.
IANAL but write like a drunk one.
I remember someone from the medical field mention what they often do when there are bacteria in an operating room that are resistant to one or many desinfectants: They open the window for some time. The competition kills most oft the resistant bacteria. This is competition with many different species of bacteria though, not just one. The resistant species/strain is only successful in the very special niche of an enviroment of desinfectants, if you open it for all kinds of species it's likely die out.
Hence, it's probably not a good approach for a treatment, you could never *completely* (to the last cell) outcompetition one strain with another of the same virulent species.
Hmmm. Wonder if this is a convincing enough reason to start telecommuting... "boss, I can't possibly come in to the office. It takes four hours to four days for bacteria to die after someone touches the mens' room door. Do you really want me waiting in there that long, just to be on the safe side?"
I do not have a signature
The theory is sound only if the resistance causes a notable decrease in survivability. The problem is that the amount of time that it will take to outcompete the other bacteria would mean that much more time the patient has to live with the dissease (and generally we're not worried about a dissease becoming resistant unless it affects humans badly enough to really want to get rid of it quickly). In support of this theory we can look to the non-bacterial case of the Hepatitis B virus- which sometimes has in its capsid a viriod (only animal viroid actually) called Hepatitis D which competes with B and has the effect that if a person is coinfected with both, the two more or less cancel each other out and the disease does not turn into the nasty chronic form of Hepatitis B . . . however D can also make things worse if B has been in the body for awhile . . . A more promising way to use some third party help would be to try to find bacteriophages (viruses that attack bacteria) that attack the specific virus in question. The chance that a bacteriophage would switch targets to a higher organism (such as human) is very small, and definitely a lot smaller than the chances the person would be irreversibly damaged by letting competitive bacteria grow. Only problems are finding a suitible bacteriophage that doesn't produce any nasty toxins while its killing the bacteria and finding a bacteriophage that our immune system doesn't immediately destroy - so maybe in a few decades : )
If a lot more people become vegetarians, then you'd need to grow more vegetables
What do you think they feed the livestock?? air?! Raising farm animals takes a lot more grain than rasing grain does.
"Question with boldness even the existence of a god." - Thomas Jefferson
Strictly speaking, most antibiotics are bacteriostatic (meaning that they prevent bacteria from growing and dividing), rather than bacteriocidal. But you are right - the idea is to keep cell numbers down to a level that the immune system can deal with
"E pur si muove!" - attributed to Galileo Galilei, 1564-1642
hmm..doesnt seem to but it might. delaware allows it to be used freely with not restrictions .. dont know about other states. http://www.delcode.state.de.us/title16/chapter049. htm
Back when I was a kid, I lived on a small farm. We had a garden that was about 5 acres. We had to water it after planting the vegetables, and a few times through the summer. Thankfully, we had our own well, which never went dry, even when the neighbor's did. The five acres of pasture and another five acres of open field never saw a sprinkler up close. Yet the grass grew very well.
/. on your Palm, shoved up there.) Of course "Pastureland for cows also needs grass ", I never said they didn't. I said the grass grows there without irrigation much better than vegetables would. If a pasture needs irrigation for grass to grow, it would need more for vegetables to grow well.
So, as I said, cows can live in pastures or open grasslands with no artificial irrigation to help the grass grow. The cows themselves may need water, or they might use natural ponds and streams. Vegetables on the other hand are thirsty, and need more water to grow than grass does.
So AC, next time pull your head out of your ass before reading my post, maybe you will understand what I am saying a little better. (Must be hard trolling
e(x) population growth. How long can it continue?
A strange game. The only winning move is not to play. How about a nice game of chess? - Joshua (Wargames)
It is. But you can deal with it. I think staph is mostly dangerous to people with compromised immune systems.
My site: Free Nature Pictures
This would totally work. The maggots would remove the dead flesh easily and painlessly. With the wound clean it is easy to cure! That's awesome, thanks very much!
My site: Free Nature Pictures
Doing your part to increase antibiotic resistance in the hospitals, eh? You do realize that some organisms will resist the GSE's effects, and then transfer that resistance to nastier bugs, right? Right? IMO doing what you suggest should be a firing offense.
Please take a couple more microbiology and public-health classes before you leave nursing school...and before you start killing people.
Slashdot - News for Herds. Stuff that Splatters.
The standard reagent used is the antibiotic.
You put ampicillin resistance in the plasmid you're putting in the bacteria, then you grow the bacteria in a solution containing ampicillin. Thus, you kill all the non-modified bacteria. It's a selection method.
Since antibiotics can't kill the corn, how would you use it to eliminate the non-modified corn?
Antibiotics only kill bacteria.
Antifungal products kill fungi.
Anti products kill plants.
The same drug can't kill fungi, plants and bacteria via cell walls because all of their cell walls are quite different. Plants use cellulose, Fungi use chitin, bacteria use a variety of other chemicals. Chemicals that break down one won't break down the others, so for example you can digest an insect (used chitin) but not the fiber in a leaf. (Technically, a chemical that breaks down chitin could be used on some species of bacteria that have chitin in their cell walls, but AFAIK most bacteria don't use chitin).
Antibiotics operate in a variety of ways on bacteria, which is good since not all bacteria have cell walls to attack. They attack proteins within the bacteria that are critical for growth, such as the proteins that build or maintain the cell wall. There are others that block various metabolic pathways. So resistance to ampicillin (attacks cell-wall mataining protein, I think) does not confer resistance to Tetracyclin (don't remember what this attacks, but it's not related to cell walls).
You sure about the standard reagent? I have read about something more elaborate such as immunokit-based indicators. Then again, corn is a bad example. Stick to bacterias.
--
Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/