Slashdot Mirror


Antibiotic Resistant Staph Infections

LinuxGeek8 writes "There's a news update on a previous article about the first case of antibiotic resistant staph infections. The woman who has the infection is being kept up to 6 months in an isolation room. She is taking an antibiotic that is working, after many others did not. "In the scheme of public health threats, this has to rank close to the top," David Ropeik, director of risk communication at the Harvard Center for Risk Analysis, said of antibiotic resistance."

621 comments

  1. FP!!! by Anonymous Coward · · Score: -1, Offtopic

    FP!!!!

  2. f.i.r.s.t. p.o.s.t by rhodesbe · · Score: -1, Troll

    whats the big deal?

  3. Well that sucks.. by xchino · · Score: -1, Flamebait

    but at least it's not antibiotic resistant west nile.

    --
    Everyone is entitled to their own opinion. It's just that yours is stupid.
    1. Re:Well that sucks.. by silvaran · · Score: 5, Informative

      West Nile is a virus. There are no antibiotics for viruses, only treatments and immune shots. Immune shots allow our own bodies to make antibodies against viruses, so they shouldn't be susceptible to a similar problem with viruses (although immune shots must be taken at least several weeks before exposure to the virus).

    2. Re:Well that sucks.. by TheSHAD0W · · Score: 2

      Actually, a very few antibiotics also have antiviral effects. This is because infected cells often have some of their biological machinery changed due to the genetic change, and begin operating at a more primitive level.

    3. Re:Well that sucks.. by GreyPoopon · · Score: 1
      There are no antibiotics for viruses

      No, but there are antiviral medications, which help your body fight off viruses. I had to take one (for the first time) a couple months ago because I had the shingles. The doctor told me I was too young to be getting the shingles, but stopped just short of recommending a job change. :-)

      --

      GreyPoopon
      --
      Why is it I can write insightful comments but can't come up with a clever signature?

    4. Re:Well that sucks.. by crawling_chaos · · Score: 3, Interesting

      Citation please? I find this incredibly hard to believe. Not that anti-biotics could have some effect, but that a viral infection can undo the vast differences between eucaryotic and procayotic metabolism. My molecular biologist friends think that that idea is utter horsehit.

      --
      You can only drink 30 or 40 glasses of beer a day, no matter how rich you are.
      -- Colonel Adolphus Busch
  4. And this is by lexcyber · · Score: 0, Informative

    the direct effect of industry driven animal farming. With antibiotics in the animal food. It is forbidden in Sweden, but is allowed in many many countries. Will make the jerms immune to antibiotics it has been known for quite some time 10+ years.

    --
    - To understand recursion, we must first understand recursion -
    1. Re:And this is by forevermore · · Score: 5, Informative
      Not just this, but there are a number of studies out (unfortunately, I have no links) that talk about correllations between overuse of antibacterial soaps and resistent bacteria strains. The thing is that the antibacterial soaps almost all use a form of the most powerful antibacterial agent out there, which used to be used only as a last resort (and thus bacteria weren't immune/resistent to it), but now that it's so prevalent in our sewers, etc., more and more resistent strains are showing up.

      So just use regular soap, sterilize things with alcohol or bleach, and don't eat meat (besides the antibiotics, there's all KINDS of other nasty stuff in that stuff)

      --
      Do you really need reason for beer? Wingman Brewers
    2. Re:And this is by sckeener · · Score: 2

      Yup, the US uses antibiotics in animal food.

      That's why my wife and I buy food that hasn't been treated with antibiotics (mostly chicken.)

      hmmmm...if the law isn't changing fast enough, vote with your walet. It makes the fastest policy changes...

      --
      "Only one thing, is impossible for god: to find any sense in any copyright law on the planet." Mark Twain
    3. Re:And this is by aridhol · · Score: 5, Interesting

      No. This is the result of people "self-medicating". When a doctor prescribes medication for 6 weeks, if you feel better after 4 weeks, there are still bacteria in your system. The next two weeks work on killing them. If you don't kill all of them, the stronger ones that survived will evolve to be immune to the medication (gross oversimplification). When they spread to someone else, who also doesn't finish the course of meds, they will become more medication-resistant. And this is the reason we have drug-resistant bacteria.

      --
      I can't say that I don't give a fuck. I've just run out of fuck to give.
    4. Re:And this is by Anonymous Coward · · Score: 2, Funny

      and don't eat meat (besides the antibiotics, there's all KINDS of other nasty stuff in that stuff)

      I eat meat because it tastes like food. I don't eat veggies because I'm smarter than the aminals that eat veggies. I eat them instead. Yum Yum.

    5. Re:And this is by RallyNick · · Score: 1

      How do you know which food hasn't been treated with antibiotics?

    6. Re:And this is by LineNoiz · · Score: -1, Flamebait

      No. This is the result of people "self-medicating". When a doctor prescribes medication for 6 weeks, if you feel better after 4 weeks, there are still bacteria in your system. The next two weeks work on killing them. If you don't kill all of them, the stronger ones that survived will evolve to be immune to the medication (gross oversimplification). When they spread to someone else, who also doesn't finish the course of meds, they will become more medication-resistant. And this is the reason we have drug-resistant bacteria.

      It's all a lie! We are getting anti-biotic resistant bacteria because the drug companies (read: pill pushers) tell the doctors what to prescribe for various illnesses. Then they turn around and tell everyone that when you feel better you're still sick, so you better keep taking those pills. Meanwhile, they are busy in their secret labs off the Florida Keys genetically engineering new strains of "resistant" bacteria, while simultaniously reducing the amount of "medicine" in the "medicine" they currently produce. All this in an attempt to get you sicker so that you have to keep buying pills. That is the reason we have drug-resistant bacteria, and I know it is because I just made it up as I typed.

      Think about this: If I get shot in the arm, but don't die from it, then have three childeren who all get shot and live, and they have childeren that all get shot and live, and so on for a few hundred generations, does that mean eventually my familial line will produce bullet-resistant childeren? Only if the bullets get weaker...

      --
      "Quotation is a serviceable substitute for wit." --Oscar Wilde
    7. Re:And this is by number11 · · Score: 5, Informative

      And this is the reason we have drug-resistant bacteria

      Unfortunately, the answer is, "all of the above". Overprescription, failure of patients to complete the course of treatment, use of antibiotics in animal feed as a preventative and growth inducer, inappropriate self-treatment (I'd never heard of people mixing antibiotics with heroin, but that would certainly qualify), over-the-counter sales (mostly in third-world countries, but you'd be surprised at what's available at farm stores), heavy advertising by the pharmaceutical industry to encourage more sales. Every time an antibiotic is used, there is a small but finite risk of promoting antibiotic-resistance.

    8. Re:And this is by jericho4.0 · · Score: 2

      Get this; those hippies are onto something. 'Organic' food can't be treated with antibiotics, by most peoples definitions. Labeling rules vary by area though...

      --
      "A language that doesn't affect the way you think about programming, is not worth knowing" - Alan Perlis
    9. Re:And this is by Jace+of+Fuse! · · Score: 5, Insightful

      and don't eat meat

      Nearly all nutritionists will tell you that not eating meat at all is doing as much harm to you as it is doing good.

      The proper advice is to avoid eating TOO MUCH meat. Even if you don't think you are eating too much red meat, you probably still are. You should never eat more red-meat than you can hold in the palm of your hand. Really, that's all you need in a single meal. Fish is an excellent food source, and turkey (or chicken when cooked properly) is also an excellent alternative to red meat.

      So you can get your meat without pumping yourself full of the nasty crap that comes from it.

      I myself don't even eat meat every day.

      --

      "Everything you know is wrong. (And stupid.)"

      Moderation Totals: Wrong=2, Stupid=3, Total=5.
    10. Re:And this is by Anonymous Coward · · Score: 1, Funny

      You should never eat more red-meat than you can hold in the palm of your hand.

      Uhm. I can stack a whole lot of meat in the palm of my hand.
      One slice of roast beef fits in my hand, as does 50. Are they both proper amounts?

      Methinks you need to give clearer directions.

    11. Re:And this is by Anonymous Coward · · Score: 0

      Is there a -1 paranoid fantasy moderation?

    12. Re:And this is by PenguiN42 · · Score: 2

      Think about this: If I get shot in the arm, but don't die from it, then have three childeren who all get shot and live, and they have childeren that all get shot and live, and so on for a few hundred generations, does that mean eventually my familial line will produce bullet-resistant childeren?

      No. But you don't seem to understand the basic mechanism behind evolution, and your analogy is flawed. Picture not one bacterium, but thousands and thousands of them, all with different resistances to antibiotics. The antibiotics kills off some, but others live. The ones that lived have on average a stronger resistance to antibiotics. They have lots of children, which creates more variation. Then another antibiotic is used, which kills off some but leaves others. The others who are left have an even *higher* average resistance to antibiotics.

      And so on ... each generation then is more resistant to the drugs than the previous. In other words, it's not *getting shot* that makes you stronger, but the inherent genetic variation that produces the resistance. The act of getting shot (or being exposed to antibiotics) just removes the weaker end of the gene pool, giving the next generation a stronger average, or starting point, if you will.

      --
      The following sentence is true. The preceding sentence was false.
    13. Re:And this is by Jace+of+Fuse! · · Score: 5, Informative

      Think about this: If I get shot in the arm

      No, think about this...

      Bacteria is everywhere. It's always growing, reproducing, and constantly mutating. So, if you take a sample of any given group of bacteria, it is easy to assume they won't all be of the same breed, and even those of the same breed won't all be of the same genetic line. The fact is, being simpler lifeforms they evolve and mutate faster.

      Now, let's say you manufacture a chemical that will kill bacteria "X". You take a dish full of bacteria and since they're very obviously not all the same it is highly possible that a few of those millions will be immune to your neat little chemical. You pour it in and you take a count and let's say only a few dozen live. Well guess what? When they reproduce you're left with a colony of bacterium that is immune to your neat little drug. Next time it gets a good growth pattern going, your antibiotic may not be as effective.

      Fortunately, our bodies fight infections on their own, so antibiotics aren't a "kill all" type of attack, but more like a "kill most and let the body take care of the rest". For this reason it is a good idea to ALWAYS take all of your prescribed antibiotics, assuming of course you actually needed them in the first place. You are basically helping your body help it's self.

      This too is a gross over-simplifaction but...

      --

      "Everything you know is wrong. (And stupid.)"

      Moderation Totals: Wrong=2, Stupid=3, Total=5.
    14. Re:And this is by DustMagnet · · Score: 1
      Labeling rules vary by area though...

      You might not have noticed the new standard. I say, "It's about time." I doubt my very republican state even had labeling laws.

      --
      'SBEMAIL!' is better than a goat!!
    15. Re:And this is by Jace+of+Fuse! · · Score: 2, Offtopic

      One slice of roast beef fits in my hand, as does 50.

      hah hah. I said the same thing, but I was actually being serious when I said the palm of your hand.

      A slice of roast beef, if balled up, might just fit in your hand perfectly if you clasp your fingers around it. Maybe two slices. It's going to be different slightly for everybody, and it's hardly scientific to use "the palm of your hand" as a way to gauge how much you should eat.

      The reason I've been told the palm of your hand is a good rule of thumb, though is because a "handful" of meat, the size of "your hand" is a close aproximation of about how much meat someone your size should probably be eating.

      I know it sounds silly, but believe me, if I were to say you shouldn't have any more than 2 ounces of meat a day, someone could turn around and say "But I'm 6'5" and 270 lbs of hulking mass." If that's the case, that person's palm is probably also about 6 inches wide, and he very easily might need more than a couple of ounces.

      Of course, I'm not a nutritionist myself, I just have the rather unpleasant curse of knowing a few, so I can't lay out a proper diet plan for you. But I can tell you it seems to be pretty much agreed upon by those who should know that you really, truely, honestly, do not need to be eating very much meat.

      This is of course not the same as saying "Don't eat meat." Do not confuse the two statements. Apparently, protein is NOT the only important thing you get from meat.

      --

      "Everything you know is wrong. (And stupid.)"

      Moderation Totals: Wrong=2, Stupid=3, Total=5.
    16. Re:And this is by Anonymous Coward · · Score: 0

      Is there a -1 didn't read the whole post and didn't realize that the paranoid fantasy was sarcasm and went ahead and made a knee-jerk AC comment about it like an idiot moderation?

    17. Re:And this is by GlassHeart · · Score: 2
      ...and don't eat meat

      That wouldn't solve the problem. If a lot more people become vegetarians, then you'd need to grow more vegetables. That means you need more pesticides, and possibly some genetic modifications as well. Fact is, the conscious American food shopper is in a real bind today. Hormone and antibiotics laced meat, abused poultry and pigs, pesticide laced fruits and vegetables - what's there to eat? There are organic foods, but can their production scale up and cost come down enough?

    18. Re:And this is by drinkypoo · · Score: 2
      That wouldn't solve the problem. If a lot more people become vegetarians, then you'd need to grow more vegetables. That means you need more pesticides, and possibly some genetic modifications as well.

      Nonsense. At least in this country (the .us of A) all you would have to do is stop paying people not to farm. You might spend the same amount supporting farming. There's plenty of farmland which is not in use. You could also go to "alternative" crops like amaranth which is healthier for you than wheat, can be made into 99% of what wheat is made into, and has a higher yield per acre. It also grows in less ideal (read: crappy) soil. So if you need more yield, there are a number of ways you can get it, at least one of these should work almost no matter where you live, politically or ecologically.

      There are problems with this too because this is the real world, but the point is, growing more plants with less pesticides is not only possible, it is trivial.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    19. Re:And this is by dan+the+person · · Score: 3, Insightful

      If a lot more people become vegetarians, then you'd need to grow more vegetables. That means you need more pesticides, and possibly some genetic modifications as well.

      Actually, if a lot more people become vegetarians, then you'd need to grow less vegetables!

      See before you can eat meat, you need to grow plants for the cow to eat. To make enough meat to feed 1 human, the cow eats enough vegetables that could directly have fed 5 humans.

      So a vegetarian requires 1/5th the vegetable production that a meat eater does.

      more vegetarians == Less vegetables == less fertilisers and pestisides etc != not more

    20. Re:And this is by nomadic · · Score: 3, Interesting

      And the reason behind THAT is that it's better for the INDIVIDUAL to consume a lot of antibiotics, even while it's bad in the long term for society. So who's going to risk losing their life to infection in order to prevent antibiotic-resistant strains of bacteria from evolving? It sure as hell won't be me, thank you very much.

    21. Re:And this is by bernardos70 · · Score: 1
      So a vegetarian requires 1/5th the vegetable production that a meat eater does.
      But isn't the ratio of human:bovines,swines,etc higher than 5/1?
    22. Re:And this is by GlassHeart · · Score: 2
      To make enough meat to feed 1 human, the cow eats enough vegetables that could directly have fed 5 humans.

      I think your figure comes from corn-fed cows. The number would probably differ for grass-fed cows, which do not need as much cultivated crops. It might be better if we ate less meat, and not pump the corn-fed cows (which can't even digest corn) full of antibiotics and hormones, rather than stop eating meat altogether. I don't think there's enough evidence that cutting animals out of our part of the food chain entirely will do good in the long run.

      It's almost inevitable, given human history, that cow farts are responsible for preventing global warming or something, and we won't realize that until we get rid of the cows.

    23. Re:And this is by Anonymous Coward · · Score: 0

      But.. But... But... Meat is YUMMY!

    24. Re:And this is by Anonymous Coward · · Score: 0

      No they dont. These soaps dont use antibacterials buy instead use chemicals closer to amonia and alchol. They are as poisonous if ingested to humans as they are to bacteria that is why you dont eat soap when your sick! Im a first year med student (3 months in) and even I know this.

    25. Re:And this is by LineNoiz · · Score: 1

      Gee, I thought I even gave it away with the 'I made it up as I typed' bit too... Oh, well... flame-bait it is, I guess...

      --
      "Quotation is a serviceable substitute for wit." --Oscar Wilde
    26. Re:And this is by susano_otter · · Score: 2

      Does this mean that if I'm smarter than you, then you're a valid meal for me?

      --

      Any sufficiently well-organized community is indistinguishable from Government.

    27. Re:And this is by Anonymous Coward · · Score: 0

      I've heard eating too much red meat is bad for you and that poultry is the way to go. I've also heard they're putting too many chemicals in poulty these days and it's bad for you. Vegetarian? If you listen to one crowd then organic is the way to go but I've also seen reports that the commercial stuff isn't as bad as some would have you believe and that the organic stuff is nasty.

      As for nutritionists, I've heard it's about as hard to call yourself a nutritionist in some states as it is to Google for braindumps, get your MCSE, and call yourself an engineer.

      Don't know what to believe.

    28. Re:And this is by Servo · · Score: 2

      Nearly all nutritionists? What, you mean all the back alley "teach yourself nutrition in 24 hours" ones? Oh yeah, in that case, nearly all those will say such crap.

      Eating "less" meat is definatley better than no moderation at all, but to say that fish, turkey, chicken, etc, are better alternatives is a bunch of crap. Poultry are pumped full of the same crap they administer to cows. The FDA still recommends that you don't eat fish more than once a week, because of mercury levels.

      And besides that, even doctors who say eating meat isn't all that bad, still agree that a proper vegetarian diet is better.

      --
      A slip of the foot you may soon recover, but a slip of the tongue you may never get over. -Benjamin Franklin
    29. Re:And this is by electroniceric · · Score: 2

      To put this in a different perspective, we should be surprised we ever were without bacteria. As various clever posters have pointed out, bacteria are both everywhere (including in living in symbiosis inside us), and evolve easily and quickly. Of course the bacteria found a way to keep on living and reproducing. That's a pretty key goal for them.

      So it's really a surprise, and notable accomplishment, and a setback that we found a method like antibiotics to hold them at bay for so long. The surprise and accomplishment should be obvious, but the setback is the following. It should be rapidly snapping into focus that human health, either on a personal or societal level involves balance, careful listening, and acceptance of risk. As all the informed consent speeches tell you, you may die anyway. There will not (and to my mind should not) be a moment when medicine will be able to insulate you from the risk that you could get sick and/or die. But as a consequence of advances in medical science such antibiotics as we've moved more and more towards magic bullet solutions of particular problems, and away from a simpler but subtler view that you have to take care of yourself to be healthy, and things might go left anyway.

      Don't get me wrong, I'm not saying that it wasn't good to quash the snake oils and tonics of the turn of the century with a little hard nosed science, nor is wrong to do so today, but to see the picture more fully, you've gotta step outside the scientific viewpoint. I strongly doubt the canon of scientific medicine will ever be complete enough for you to have to work hard at using your judgement about your health and accept the risks of disease. So kudos to those who bring together the insight of "scientific" medicine with other worldviews of medicine.

    30. Re:And this is by charon_on_acheron · · Score: 1

      As long as you're cute. *winkwink*

      Seriously, it isn't how smart someone is. A bull would kill any of us before we could kill it in a pure environment, meaning no tools or weapons allowed. But we are smart enough to use tools to get our food, which includes guns to shoot animals that we could never kill with our bare hands. More importantly, we were able to domesticate some of those same animals, so they will walk down the path to the slaughterhouse almost on their own. That is what intelligence did for us, even for the vegetarians.

      Besides, if someone says they are smarter than a chicken, I'm still not going to think to highly of their intelligence.

    31. Re:And this is by charon_on_acheron · · Score: 1

      You are so right. All the cattle in Texas should be killed right now, and buried to enrich the soil enough that something other than coarse grass and sagebrush can grow there. Then divert the Mississippi to irrigate the whole area. Who cares if the Mississippi delta needs that water, we have to grow some vegetables dammit. Besides, New Orleans would probably appreciate having the river lowered about 20 feet anyway.

      Yeah, right.
      Why do you make it sound like 50% of the CROPLAND in the US is used "to grow plants for the cow to eat"? Much of the land for cattle is pastureland or the wide open plains. It isn't necessarily feasible to convert that space to vegetable gardens. They need fertile soil, and plenty of water.

    32. Re:And this is by Anonymous Coward · · Score: 1, Informative

      Vitamin B12. Take a pill, and then you don't need meat at all.

    33. Re:And this is by susano_otter · · Score: 2

      It's kind of lame to arbitrarily restrict yourself to a subset of nature's built-in rules. If the bull isn't smart enough to build a millenial civilazation that strictly limits opportunities for humans to kill bulls, that's their problem. My idea of a fair fight is everybody using everything they've got. The bull gets his horns, and I get my cell phone.

      --

      Any sufficiently well-organized community is indistinguishable from Government.

    34. Re:And this is by stormfish · · Score: 1

      I recently attended a conference by Pharmacia, the company noted at the end of the article, in which the topic was vancomycin resitant staph aureas. During the conference they informed us that vancomycin is one of the major anitbiotics our national poultry suppliers feed in bulk to their chickens. Thanksfully, Pharmacia is being very smart and not giving out samples of their antibiotic in order to limit the number of bugs (bacteria) that encounter it and thus reducing the rate of resistant strains. I think the company needs a round of applaus for that one.

    35. Re:And this is by Anonymous Coward · · Score: 0

      > You are basically helping your body help it's self.

      Huh? What the _FUCK_ is _that_ supposed to mean? "You are basically
      helping your body help it is self." is gramatically incorrect and highly
      ambiguous. Please learn more about English if you are going to use it in
      daily conversation, you stupid, cocksucking, moron.

    36. Re:And this is by charon_on_acheron · · Score: 1

      I guess I didn't make my point very well, because that is what I meant. While you are smarter than a bull, you would be no match bare-handed. And it's not that you can use a cell-phone, although I would prefer a good shotgun personally. It's that humans have already invented and improved the tools we can use, so you can have that cell phone to use to defeat the bull, and also call your friends to come over for a steak dinner.

      Of course if we ask the dolphins....

    37. Re:And this is by dan+the+person · · Score: 2

      Where i live (new zealand) it is common practise to divert rivers to irrigate pasture for cows to eat.

    38. Re:And this is by LineNoiz · · Score: 1

      Flamebait AND overrated? You people have no sense of humor...

      --
      "Quotation is a serviceable substitute for wit." --Oscar Wilde
    39. Re:And this is by Mnemia · · Score: 2

      This isn't an either/or question. If people ate less beef we would need less land, period. We wouldn't need much more fertile land because the fertile land that is used for cattle production and feed crops could be converted to vegetable production. We could use the land that isn't good for food crops for nothing and not rape the environment the way we are. The land is not being "wasted" if we aren't extracting every last resource from it.

      The cattle industry is perhaps the most environmentally destructive industry on the planet, and we would be better off without them. I like beef but I already don't eat it very often due to the practices of the industry. If everyone at least cut down on it as well we would be better off in many, many ways. Anyone who lives in the West can see how much of the land has been destroyed for cattle ranching, and I'm sure it's even worse in Latin America.

      Of course, the issue will eventually be forced upon the market by the long term environmental damage being done. Mark my words, in 50 years beef will be a luxury item due to the wastefullness of its production combined with more limited resources being shared by an expanded population.

    40. Re:And this is by dan+the+person · · Score: 2

      But isn't the ratio of human:bovines,swines,etc higher than 5/1?

      Could be, i didn't look up the exact figure when i made that post, but you get the idea...

    41. Re:And this is by geirhe · · Score: 1
      So just use regular soap, sterilize things with alcohol or bleach
      Bad idea. Some bacteria will happily become immune to bleach. Since they don't have to compete with other bacteria, you will have a lot of them in your bleach-based environment. Is that really what you want?

      Just let the nasty things be outcompeted by things you can take. That means that you don't sterilize things when you don't need to, which for most people mean almost never. Use a moderate amount of regular soap when washing to remove any grease, and learn how to wash effectively. Most people just push the dirt around, probably to let it make new friends.

    42. Re:And this is by jafac · · Score: 2

      This is why I never understood that why someone who would go through all the trouble to weaponize anthrax (the 2001 anthrax mailer) wouldn't also take this simple step to also produce it from an antibiotic-resistant strain. Would this not be a simple matter?:

      Mix a batch of 100 petri dishes, put varying quantities of antibiotics into each dish, from 1% to 100%. Harvest surviving bacteria from the strongest concentrations in which it survived. Repeat oh, about 100 times. Then do it again with another antibiotic, until you have some antrhax which nothing will kill. Then weaponize and deliver it.
      Sounds simple. I wonder why they didn't do that - it would also make the strain more difficult to trace by DNA analysis, one would think. . .

      --

      These are my friends, See how they glisten. See this one shine, how he smiles in the light.
    43. Re:And this is by MightyTater · · Score: 1
      Actually, I believe the very general rule of thumb is that a step up from a level of the food chain to a higher level wastes 90% of the energy that was input into the present level.

      So. In my lifetime, I will eat 10 cows, or I could eat 10 hectares of corn. Every cow eats 10 hectares of corn, so if I choose to eat 10 cows, there must be 100 hectares of corn to support that.

    44. Re:And this is by feed_me_cereal · · Score: 2

      If a lot more people become vegetarians, then you'd need to grow more vegetables

      What do you think they feed the livestock?? air?! Raising farm animals takes a lot more grain than rasing grain does.

      --
      "Question with boldness even the existence of a god." - Thomas Jefferson
    45. Re:And this is by Anonymous Coward · · Score: 0

      Pastureland for cows also needs grass if you're not using farmland to grow food for them, and the cows destroy this land very quickly. Please know what the fuck you're talking about.

    46. Re:And this is by toxcspdrmn · · Score: 1

      Strictly speaking, most antibiotics are bacteriostatic (meaning that they prevent bacteria from growing and dividing), rather than bacteriocidal. But you are right - the idea is to keep cell numbers down to a level that the immune system can deal with

      --
      "E pur si muove!" - attributed to Galileo Galilei, 1564-1642
    47. Re:And this is by charon_on_acheron · · Score: 1

      Back when I was a kid, I lived on a small farm. We had a garden that was about 5 acres. We had to water it after planting the vegetables, and a few times through the summer. Thankfully, we had our own well, which never went dry, even when the neighbor's did. The five acres of pasture and another five acres of open field never saw a sprinkler up close. Yet the grass grew very well.

      So, as I said, cows can live in pastures or open grasslands with no artificial irrigation to help the grass grow. The cows themselves may need water, or they might use natural ponds and streams. Vegetables on the other hand are thirsty, and need more water to grow than grass does.

      So AC, next time pull your head out of your ass before reading my post, maybe you will understand what I am saying a little better. (Must be hard trolling /. on your Palm, shoved up there.) Of course "Pastureland for cows also needs grass ", I never said they didn't. I said the grass grows there without irrigation much better than vegetables would. If a pasture needs irrigation for grass to grow, it would need more for vegetables to grow well.

  5. "hey mom" by Anonymous Coward · · Score: 5, Funny

    thanks for making me use all that anti-bacterial soap all the time. now i'm locked up in a room for 6 months.

    1. Re:"hey mom" by duncan7 · · Score: 5, Insightful

      Antibacterial soap doesn't contain antibiotics, as far as I know, and certainly doesn't contain Vancomycin.

      Now, "Hey, Mom, thanks for taking me to the pediatrician for antibitoics every time I got the sniffles," is another matter, entirely.

    2. Re:"hey mom" by Viking+Coder · · Score: 2

      Alright, I'll bite.

      What differentiates "antibacterial soap" from "soap"?

      --
      Education is the silver bullet.
    3. Re:"hey mom" by cscx · · Score: 2

      Antibacterial soap contains Triclosan, a disinfectant. It doesn't contain antibiotics.

    4. Re:"hey mom" by Anonymous Coward · · Score: 0

      marketing: all soap kills bacteria...

    5. Re:"hey mom" by Apiakun · · Score: 1

      And hey, it may not work.

    6. Re:"hey mom" by DigitalOZ · · Score: 1

      Acutally, it turns out that anti-bacterial soap isn't helpful at all. Check out this article http://news.bbc.co.uk/1/hi/health/791934.stm. Save a few bucks and use regular soap.

      Also, here's another link talking about how antibacterial soap might actually help in spreading disease (http://www.practicalhippie.com/cache/antibacteria l/soapoveruse.htm).

      The reasons for this are the same as for VRSA. Namely, overuse of anti-bacterial medications and soaps are enabling the bacteria to evolve strands that are resistant.

      The best things to do to help the human race in its fight against bacteria:

      1. Don't use anti-bacterial soap, use regular soap
      2. Don't pressure your doctor for antibiotics
      3. If you are given antibiotic prescription, take all doses of a prescription you are given.

    7. Re:"hey mom" by caveat · · Score: 2

      no, but there's a lot of convincing research showing that using antibacterial everything promotes the (massive) growth of triclosan*-resistant bugs...that's sort of an unpleasant thought..

      *-common topical antibacterial, in everything from soap to toothpaste

      --

      Facts do not cease to exist because they are ignored. - Aldous Huxley
    8. Re:"hey mom" by TheMonkeyDepartment · · Score: 2

      Nope, this is incorrect - antibacterial soap contains triclosan which is an antibacterial agent. It does contribute to the problem.

      Check out this article as a reference.

    9. Re:"hey mom" by NoData · · Score: 5, Informative

      What differentiates "antibacterial soap" from "soap"?

      One word: Triclosan.

      This is an antibacterial agent commonly used in all sorts of consumer products including deodorant soaps. If it's for your body and labeled "antibacterial" check the ingredients. It probably has triclosan. While it is certainly not an antibiotic per se, bacteria can grow resistant to it, producing more virulent strains. See here for a good discussion.

      A recent article (too lazy to google again) recently suggested antibacterial and regular soaps do an equally good job of cleaning you of bugs anyway.

    10. Re:"hey mom" by fishbowl · · Score: 5, Informative

      First of all, the strain resistant to vancomycian has been known since 1993, so sensationalism aside, it's hardly news. I myself experienced this in 1996, after getting the same infection from a stream in Missouri; and I *almost* lost a toe because of it. A more powerful antibiotic, that I wish I could remember the name of, took care of it. By the time I realized it was a serious enough infection to go to the hospital, it was almost too late. (I discussed it in a usenet thread way back then, perhaps I can google it back out).

      Now, to the "Antibacterial Soap"

      What gives "Antibacterial" soap it's antibacterial property is mainly the molecular structure of the soap. It is lipophilic detergent, which impedes the cell membrane (of the bacterium), essentially stopping it from passing water either way (study the Fluid Mosaic Model to understand cell membranes).

      I would imagine that olive oil has as much "antibacterial" properties as a grocery store "antibacterial" soap; so would a soap made from animal fat for that matter.

      My understanding is that what makes Triclosan so special is, it simplifies (economizes) the manufacturing process, because it is less expensive to formulate triclosan than the alternatives with similar properties. I'm not trying to say that it doesn't kill bacteria -- it DOES kill bacteria, but the WAY it kills them is through a simple physical process.

      I wonder if the patent has had any relationship to the sudden adoption of this chem in practically every personal care product on the shelf?

      --
      -fb Everything not expressly forbidden is now mandatory.
    11. Re:"hey mom" by jericho4.0 · · Score: 2
      Antibacterial soap doesn't contain antibiotics, but it does kill of many bacteria.

      What this does is provide a food-rich enviroment for the stronger bacteria to exploit. It also lowers peoples (ie; infants) regular exposure to enviromental pathogens, messing with the natural immune response.

      --
      "A language that doesn't affect the way you think about programming, is not worth knowing" - Alan Perlis
    12. Re:"hey mom" by nomadic · · Score: 1

      so sensationalism aside

      Not allowed to do that on slashdot.

    13. Re:"hey mom" by Chops · · Score: 2
      A recent article (too lazy to google again) recently suggested antibacterial and regular soaps do an equally good job of cleaning you of bugs anyway.

      Indeed. Once I've washed the bacteria off my hands and down the drain, they can do whatever they bloody well like.
    14. Re:"hey mom" by Loki_1929 · · Score: 2

      Considering the fact that bacteria can survive in boiling-hot acid, I'm not entirely certain that your hand-washing habits have a significant effect on the bacterial population of our planet. That being said, natural selection makes it quite clear that if you kill off all the bacteria you can with one drug, the ones that are left are resistant to it. For any given substance, there can and will be some form of life that not only survives in it, but thrives in it. It's simply a fact of life and a part of the game we live every day.

      --
      -- "Government is the great fiction through which everybody endeavors to live at the expense of everybody else."
    15. Re:"hey mom" by Anonymous Coward · · Score: 0
      Not much according to the CDC. The latest guidelines for getting *real* antibiotic protection from handwashing is to use an alcohol-based gel. They found antibacterial soap is no better than regular soap when coupled with proper handwashing technique.

      Read more here [yahoo.com]

    16. Re:"hey mom" by duncan7 · · Score: 1

      Indeed. I stand corrected, not that I put much stock in CNN's science reporters, who seem mostly interested in citing other CNN stories- I followed the links in that story two deep and couldn't get to the primary reserach.

      This looks like the real deal, though, and this woman's work is pretty interesting, as well.

    17. Re:"hey mom" by Durindana · · Score: 2, Informative

      Wrong. Most "antibacterial" products contain triclosan, which is about as useful for fighting infection now (after decades of massive overuse) as green Jello.

    18. Re:"hey mom" by _ph1ux_ · · Score: 5, Interesting

      one inmportant thing to know is that it is not good for you to use soap on your body every time you shower.

      you should actually use it more like twice a week. (a full body lather and scrub that is) even then it may be too much.

      and you should rarely use harsh soaps on your face. I ahve a friend who is always buying "anti-oil this" and other crap products and special soaps for her face. She claims that she needs them because she has really oily skin. and that she needs to wash with it every day. She washes her face in the morning - and before she goes to bed. I told her that the reason she is so oily is because she is using that crap. That what happens is the soaps wash off the natural oils and bacteria that your skin is *supposed* to have on it. But since she uses this toxic stripping soap on her face all the time - it causes her skin to over oil in attempts to compensate. The only time she should actually use soap on her face and whole body is when its actually dirty.

      For 99% of the time you can use a *hot* shower and a *hot* washcloth on your face and skin. This will get rid of most anything. you dont need to use soap on your face and body every time you get wet. its bad for you. the *only* reason they tell you to do this is to get you to buy worthless products.

      The cosmetics industry is a sham. Those designer shampoo (hence the name) products you buy use about 3 cents worth of the standard detergent Sodium Lauryle Sulfate. (which some people think cuases cancer - I have no idea if it does, I just know it gives me dandruff so i stay away from it)

      All the other ingredients in shampoos and conditioner are mostly garbage...

      Anyway - the point is that you have bacteria on your skin that your body *needs* and you should not use soap very often. Just use hot steaming wash clothes to wash your face.

      I have perfect skin, no oil and never any zits, and no BO. I almost never use soap. I use soap when I am actually DIRTY - like after paintball for example.

      The bacteria on your skin and the oils you produce will typically be in balance - unless you are doing activities that cause a lot of sweating in a dirty environment - or you dont shower every single day - then you dont need soap.

      (but you should wash your hands with soap - even though the crappy detergents ruin your skin)

      And you should avoid antibiotics like the plague - unless you actually have the plague, then they are a good thing (TM) :)

      (seriously - take these as rarely as ever possible)

    19. Re:"hey mom" by lawpoop · · Score: 1

      Those bacteria that live in boiling hot acid die when they leave it.

      --
      Computers are useless. They can only give you answers.
      -- Pablo Picasso
    20. Re:"hey mom" by Jay+L · · Score: 2
      Antibacterial soap contains Triclosan, a disinfectant. It doesn't contain antibiotics.

      Wrong! Triclosan is an antibacterial, not a disinfectant. According to the APUA:

      The EPA classifies public health antimicrobials as bacteriostats, sanitizers, disinfectants and sterilizers based on how effective they are in destroying microorganisms. Bacteriostats inhibit bacterial growth in inanimate environments. Sanitizers are substances that kill a certain percentage of test microorganisms in a given time span. Disinfectants destroy or irreversibly inactivate all test microorganisms, but not necessarily their spores. Sterilizers destroy all forms of bacteria, fungi, and other microorganisms and their spores.


      The only difference between "antibacterial" and "antibiotic" is that, traditionally, the former refers to something man-made, and the latter to something grown from natural substances. These days, the line is blurred. In fact, in the latest APUA newsletter, some researchers recommended calling all antibiotics "antibacterials", since the name is more specific, and might reduce the pressure to use antibiotics for bacterial infections.
    21. Re:"hey mom" by Syphilis · · Score: 1

      A recent article (too lazy to google again) recently suggested antibacterial and regular soaps do an equally good job of cleaning you of bugs anyway

      If this was true, then the bacteria wouldn't have developed resistance to the triclosan.

    22. Re:"hey mom" by Anonymous Coward · · Score: 0

      yeah, hygene advice from a group of people that are knows to stink and have the worse personal hygene on the planet!

      Shashdot.... stink for nerds, beards that matter..

    23. Re:"hey mom" by proxima · · Score: 3

      This is an interesting idea, but a quick Google search pulled up nothing to support your claims. Have your read this anywhere?

      --
      "The universe seems neither benign nor hostile, merely indifferent." --Carl Sagan
    24. Re:"hey mom" by narftrek · · Score: 1

      Isn't it this same mentality of "we shouldn't wash ourselves and be dirty, nasty people" that brought around things like the plauge and those annoying nasty flea ridden rats that carried it? Please wash yourself, at least a hundred years of medicine and scientific studies says it's good for you.

    25. Re:"hey mom" by NilesDonegan · · Score: 2, Informative

      It actually does - it contains triclosan, the over-used and poorly understood antibiotic. And while you're correct that it doesn't contain vancomycin, what it does do is select for those Staph that are resistant to triclosan. That's particularly a bummer when you DO get VRSA and decide to try to treat your infection with triclosan and find out, hmm, it's resistant to that TOO.

      Rats!

    26. Re:"hey mom" by canadian_right · · Score: 3, Interesting
      anti-bacterial anything:

      You don't need anti-bacterial soap to cleanse yourself of bacteria. Normal soap makes your skin SLIPPERY enough that a good rinse sends all the bacteria down the drain. Most research indicates that using any anti-bacterial products in your home is unneccessary. Normal soap and detergent will keep you and your home clean.

      Anti-bacterial products can produce bacteria that are resitant to the anti-bacterial ingredient.

      It has also been shown that kids that grow up in sterile homes (mom or dad use lots of anti-bacterial soap everywhere, every day) tend to get more infections once they get to school age as their immune system hasn't had to develop resistance to normal environmental bacteria (like you find at school).

      --
      Anarchists never rule
    27. Re:"hey mom" by Anonymous Coward · · Score: 0

      exactly, Western socities tend to live in overly clean environments.

      The point you make about children not being exposed to normal childhood bugs, and therefore having a weaker immune system as they develop, is supposed to be one of the reasons for the increasing rate of asthma in western countries.

    28. Re:"hey mom" by eggcozy · · Score: 2, Informative

      Whether or not to wash yourself wasn't the point of the above comment, but how you wash yourself. She/He clearly stated to use soap only when needed and otherwise WASH with just hot water. Sounds like %100 washing to me. And yes, just water is actually fantastic at washing away basic dirt.

    29. Re:"hey mom" by Jeriki · · Score: 1

      You skin being slippery is only a side-effect of the alkaline ingrediants in the soap. What makes soap effective at cleaning your skin is that it lowers the surface tension of the water which makes the water more effective at cleaning dirt, grime, bacteria and the like from your skin.

      --
      -witty .sig
    30. Re:"hey mom" by kylef · · Score: 2, Interesting

      No offense, but I trust my dermatologist friend (who has been to specialist school) much more than the anecdotal evidence of an online web forum. He recommends soap and water daily.

    31. Re:"hey mom" by nurightshu · · Score: 5, Funny

      You're French, aren't you?

      --
      They that would sacrifice their .sig space for that cliched Franklin quote deserve neither.
    32. Re:"hey mom" by Doctor+Beavis · · Score: 0
      I believe that you are mistaken about the infection that you had. Vancomycin resistant staph aureus (VRSA) is indeed new and has never before been reported in a clinical infection (other than as reported in the article). Vancomycin resistance, however, is not new, and has been seen in other bacteria. Vancomycin Resistant Enterococcus (another species of bacteria altogether) or VRE, is fairly common and is often treated with linezolid if it is even treated at all. I suspect that is what you had. The article referred to touched on the pathogenicity of Staph aureus, but neglected to mention that resistance to vancomycin is not new, only resistance to vancomycin by Staph aureus. This is such a big deal because Staph aureus is a really nasty bug and is very good at infecting people and producing toxins that cause low blood pressure, etc, etc, and lead to death. Enterococcus can make you sick (and can kill you), but it's nowhere near as nasty as Staph aureus.

      The presence of vancomycin resistance in Enterococcus pretty much predicted that Staph would eventually acquire it. Bacteria swap antibiotic resistance genes all the time (transfection, transduction, conjugation, etc. - see any microbiology text for details) and several other resistance genes that are known to have originated in Enterococcus have made their way to Staph.

      Another minor clarification of a common misconception is that there are different "Strengths" of antibiotics. Admittedly, some antiobiotics kill (bacteriocidal) and others merely prevent growth or division (bacteriostatic), thereby allowing the body to kill them. However, the potency of an antibiotic is more appropriately measured in terms of spectrum of activity (i.e. does the antibiotic chosen work against the particular species that is causing the infection?). Some are very narrow and others are more broad. If your doctor puts you on one antibiotic and your infection does not improve, choosing or adding another antibiotic is not a matter of strength but of broadening the coverage to include other likely pathogens.

    33. Re:"hey mom" by mrscorpio · · Score: 2, Informative

      Exactly. The whole point of soap is to make water "wetter", as I learned in 1st year high school honors chemistry. I don't think his claims are too outlandish.

      Chris

    34. Re:"hey mom" by Anonymous Coward · · Score: 0

      You are almost certainly thinking of _methicillin_ resistant staph, which is not the same as vancomycin resistant staph.

      Incidentally, vanco is not a very "powerful" antibiotic. It just kills things that other drugs don't.

    35. Re:"hey mom" by Holi · · Score: 2, Informative

      umm actually soap emulsifies the oils so that the water can rinse them away.

      --
      Sorry, teleporters just kill you and then make a copy. A perfect, soul-less copy.
    36. Re:"hey mom" by cygtoad · · Score: 1

      Vanco has a lot of nasty side effects, which is why it has been traditionally used last. Its low use in the past make it a good antibiotic because the bugs haven't gotten used to it, but that is changing. It is like the Borg on Star Trek. Eventually they adapt so you have to switch weapons. Trouble is, we are running out of weapons. VRE and MRSA have been around for a while. Now we apparently have VRSA. Not cool man.

    37. Re:"hey mom" by rjamestaylor · · Score: 1

      My uncle, a hospital pharmacist, tells me that "anti-bacterial" soap dishes make fantastic incubators for bacteria. . .this after someone got curious and decided to perform a culture test on regular soap versus "anti-bacterial" soap. E-coli in particular seemed to feed on the "anti-bacterial" soap. . .

      --
      -- @rjamestaylor on Ello
    38. Re:"hey mom" by Sprout9194 · · Score: 1

      Yup, I agree. I haven't used shampoo for around 7 years and only use soap on my hands - and that includes after running in the hills / cycling / getting covered in mud etc. A good scub with a cloth works just dandy My body feels good - and I don't smell. My girfriend's even suprised I don't smell. And no, I'm not French either!

    39. Re:"hey mom" by daveisoverlord · · Score: 1

      That's particularly a bummer when you DO get VRSA and decide to try to treat your infection with triclosan and find out, hmm, it's resistant to that TOO.

      If your doctor is treating your VRSA with triclosan, I highly suggest you switch doctors.

      Nobody is going to treat something resistant to vancomycin with an over-the-counter antibiotic. "We're only admitting you to the hospital to soak the insurance companies. You could really just fix this at home by washing with SoftSoap."

      Of course, if you're just trolling, then congratulations. I guess you just popped a woody.

      --
      The perception of reality is more important than reality itself.
    40. Re:"hey mom" by Ozymandias_KoK · · Score: 1

      Prolly not so tasty, thoough.

    41. Re:"hey mom" by Anonymous Coward · · Score: 0

      Yeesh! Listen Pigpen, the next time I see someone covered in a halo of flies, I'll assume it's you. Good luck with those festering sores...

    42. Re:"hey mom" by jshazen · · Score: 1
      ...it is not good for you to use soap on your body every time you shower.

      You should actually use it more like twice a week.
      Wait, I'm confused.

      Didn't you just say not to use it every time I shower?!?
    43. Re:"hey mom" by Anonymous Coward · · Score: 0

      Uh yeah, thanks, but I think I'll listen to my American dermatoligist, who went through specialist training in addition to the years of education necessary for a medical degree, in preference to a SMELLY EURO-COMMIE.

    44. Re:"hey mom" by mrscorpio · · Score: 1

      http://www.dictionary.com/search?q=emulsion

      emulsion Pronunciation Key (-mlshn)
      n.

      1. A suspension of small globules of one liquid in a second liquid with which the first will not mix: an emulsion of oil in vinegar.

      Water (from a shower) and oil (from your skin) already *is* an "emulsion". The soap increases the contrast of the two; oil mixes even less with soapy water than just plain water (hence the film you see on the water that runs down the curb after washing your car). So in layman's terms, it makes water "wetter", as I said.

      Chris

    45. Re:"hey mom" by Anonymous Coward · · Score: 0

      Yeah, no conflict of interest there...

    46. Re:"hey mom" by Anonymous Coward · · Score: 0

      prolly tastes better than your nick

  6. decimal is to blame by Anonymous Coward · · Score: 2, Funny

    as usual. Decimal to binary conversion errors in antibiotic design on computers caused this.

  7. IN SOVIET RUSSIA by IN+SOVIET+RUSSIA · · Score: -1

    we have Staph Infection Resistant Antibiotics!

    1. Re:IN SOVIET RUSSIA by CaptainCarrot · · Score: -1, Offtopic

      Ya know, I don't understand why this guy always gets modded down. He's actually pretty funny. Or is everyone else around here too young to get the joke?

      --
      And the brethren went away edified.
    2. Re:IN SOVIET RUSSIA by Anonymous Coward · · Score: 0

      I imagine it's because this is slowly but surely becoming the new 'Imagine a beowulf cluster of...'/'Profit!'/etc. I have to agree that it's funny (althought I attribute part of Yakof's newfound popularity to a Simpsons character who has picked up the above shtick, but what do I know).

    3. Re:IN SOVIET RUSSIA by CaptainCarrot · · Score: 1
      Well, it could get that way if he's allowed, but I doubt many people are seeing his posts at this point. He's onlt made 10 comments and they're all at -1, so that's his default score now. But the format allows him the freedom to get creative with it. The Beowulf cluster troll is always exactly the same, and the "Profit!" joke is usually pretty lame regardless of teh context. But this one allows a certain amount of genuine parody and social commentary to be snuck in. Actual howlers are possible.

      I don't watch The Simpsons so I have no clue about current characters in it. And I'm not posting anonymously because I've got karma to burn so I might as well strike a match.

      --
      And the brethren went away edified.
  8. Irradiation is the answer by Anonymous Coward · · Score: 0

    Just irradiate all the food, that will do the trick.

    1. Re:Irradiation is the answer by Viking+Coder · · Score: 4, Funny

      Watch, it'll become immune to radiation. Now THAT's a scary bug.

      --
      Education is the silver bullet.
    2. Re:Irradiation is the answer by Anonymous Coward · · Score: 0

      Then irradiate everyone! Look, no more germs.

    3. Re:Irradiation is the answer by aridhol · · Score: 2

      After the bomb, the only survivors will be cockroaches, Spam (the meat, not the mail), and these bacteria. Fun.

      --
      I can't say that I don't give a fuck. I've just run out of fuck to give.
    4. Re:Irradiation is the answer by margaret · · Score: 2, Informative

      Actually, the majority of antibiotics given to livestock are not administered to prevent infection. They are given to healthy animals in order to promote their growth. There is a good overview of the problem here.

    5. Re:Irradiation is the answer by Dannon · · Score: 4, Funny

      I'm not so sure that spam-the-mail wouldn't survive as well. I've a sneaking suspicion that those e-mail mass marketers have got to be some sort of subspecies of cockroach.

      --
      Good judgment comes from experience.
      Experience comes from bad judgment.
    6. Re:Irradiation is the answer by filmnorthflorida · · Score: 1

      You just gave me this great vision of a postapocalypse world, in which cockroaches sit at computers all day sending one another nigerian scams and free porn passwords. Should be a movie, or at least a Pixar short.

      --
      --- php: perl hates people
    7. Re:Irradiation is the answer by Chrispy1000000+the+2 · · Score: 1

      Heck, some bugs they found in antartica have the ability to withstand over 10000x times the leathal limit of radiation for a human, and they take it, no sweat.... Just think about what would happen if it was crosses with this strep mutant and releases it in a populated center... Well, there would be no more overcrowding ;-)

      --
      Sig
    8. Re:Irradiation is the answer by piotru · · Score: 1

      Look for Deinococcus radiodurans in PubMed:
      http://www.ncbi.nlm.nih.gov/entrez/query. fcgi

    9. Re:Irradiation is the answer by Bush+Pig · · Score: 0

      Yeah - the idea is if you kill off all the natural bacteria in the animal's gut, the nutrients that they would otherwise consume go direct to the animal, allowing it to grow faster. Never mind that these bugs may be benign, or even essential to the animal's well-being, it's not going to live that long anyway (especially given that it's getting fatter faster).

      --
      What a long, strange trip it's been.
    10. Re:Irradiation is the answer by Anonymous Coward · · Score: 0

      What's there to think about? It would do nothing more than this strep mutant does. Except that it would be resistant to radiation... and there aren't many people around who are trying to cure their bacterial infections with radiation.

  9. It does rank up there.... by i_want_you_to_throw_ · · Score: 5, Insightful

    What doesn't help is the way that antibiotics have been indiscriminately and thoughtlessly prescribed these last several years for even the slightest ailments.

    Then there's some research suggesting that feeding antibiotics to animals isn't such a great idea either since all the nasties associated with that can be ingested later by humans. Try googling for the info

    1. Re:It does rank up there.... by Viking+Coder · · Score: 2

      I like antibiotic soap, too.

      Comic Book Guy: Worst. Idea. Ever.

      --
      Education is the silver bullet.
    2. Re:It does rank up there.... by rodgerd · · Score: 5, Insightful

      Unfortunately, patients are part of the problem - Gps are often pleasantly surprised when I don't want drugs as the automatic response to a problem, because most patients are aggressive abour demanding them, and too stupid to use them properly.

    3. Re:It does rank up there.... by Anonymous Coward · · Score: 0
      Then there's some research suggesting that feeding antibiotics to animals isn't such a great idea either since all the nasties associated with that can be ingested later by humans.

      That's why I stopped eating plants that eat animals. Ah fuck though, really, I'd try to be a vegetarian but damn that fried chicken, sabzi and seafood...

    4. Re:It does rank up there.... by Enzondio · · Score: 0

      Perhaps. But I would hope that a doctor would take the time to advise a patient about the risks of over using antibiotics if they were truly concerned about the issue themselves.

      I tend to think more of the responsibility lies on the shoulders of the doctors.

    5. Re:It does rank up there.... by GreyPoopon · · Score: 3, Interesting
      What doesn't help is the way that antibiotics have been indiscriminately and thoughtlessly prescribed these last several years for even the slightest ailments.

      Amen. I've actually gotten to the point where I get angry when I hear my mother-in-law tell my wife to go get some antibiotics because she has a cold. I've tried calmly explaining to her that antibiotics don't do anything to help a cold, but she's so used to years of doctors prescribing them for such that she can't get over it.

      I routinely suffer from sinusitis twice a year (when I turn on the heat and when I turn on the AC), so getting rid of infections is a big deal for me. I am not a doctor, but for the past couple years I've managed to completely avoid antibiotics. Instead, I take Echinacea and Goldenseal three times a day until the infection goes away. I've found that it's usually just about as effective as antibiotics, and since it's still my body that's doing all the work, there's no added fear of adaptation. Of course, this remedy wouldn't work if my immune system were in really bad shape.

      --

      GreyPoopon
      --
      Why is it I can write insightful comments but can't come up with a clever signature?

    6. Re:It does rank up there.... by EvanED · · Score: 2

      Not just overusing; in fact (warning: "a little knowledge is a dangerous thing" example), I suspect that underuse is more responsible. I don't mean underprescribed; I mean when a patient stops using an anti-biotic before it runs out because their symptoms have vanished. But there's still that little bit left...

    7. Re:It does rank up there.... by rodgerd · · Score: 2

      Yeah, and then the patient runs through GPs until they can find one to prescribe what they want.

    8. Re:It does rank up there.... by LineNoiz · · Score: 2, Funny

      Noooo! You're going to make strains of bacteria that are resistant to your bodies' natural defense mechanisms! The only way to ensure that these damn bacteria don't get out of control is to make sure you DIE every time you get sick. Otherwise, the bacteria will mutate and win.

      --
      "Quotation is a serviceable substitute for wit." --Oscar Wilde
    9. Re:It does rank up there.... by LineNoiz · · Score: 1

      And don't forget to have someone burn your corpse. Don't want that shit spreading...

      --
      "Quotation is a serviceable substitute for wit." --Oscar Wilde
    10. Re:It does rank up there.... by jkujawa · · Score: 2

      It's not antibiotic soap. It's antibacterial soap.
      Not the same thing.
      Clorox is antibacterial, too, but you're not going to create resistant bacteria using it. Nor are you going to inject bleach to cure a staph infection.

      If I remember correctly, the distinguishing ingredient in antibacterial soap is: orange dye.
      All soap is antibacterial ... I think what it does is disrupts a bacterium's cell membrane.
      Calling soap 'antibacterial' is a marketing gimmic.

    11. Re:It does rank up there.... by zyklone · · Score: 1

      Unfortunately this is only partly true.

      There are soaps, perhaps not a very large number but you can find them in most stores, with triclosan in them. Triclosan is just about everywhere.

      The braindead people behind those schemes deserve to be injected with some resistant infection.

    12. Re:It does rank up there.... by F34nor · · Score: 1

      Try Ocean nasal spray before you get the infection. It's just a saline spray that keep your mucus membranes moist. Also use it on planes, keeps you from getting cracks in your skin inside your sinus that allow infection. Stuff works better than anything for flying and not getting sick. My freind who gets 150,000 miles a year told me about it.

    13. Re:It does rank up there.... by rgmoore · · Score: 3, Funny

      No, no, no. If you burn the body, all you'll be doing is creating fire resistant strains of bacteria. Pretty soon there will be strains of bacteria that can survive in bodies full of burning antibiotics, and then where will we be?

      --

      There's no point in questioning authority if you aren't going to listen to the answers.

    14. Re:It does rank up there.... by Anonymous Coward · · Score: 0

      Fine so you create an enforcement dept. (we'll let that fucking Nazi Ashcroft be put to good use) that goes around and fines the shit out of GP's that roll over for bitchy patients. Then we give them the option of

      a. going to jail.
      b. having their 1.2 mil house taken away.
      c. doing some pro bono work in the rural south.

      That would teach em.

    15. Re:It does rank up there.... by F34nor · · Score: 1

      No one is giving anti-biotics to sushi.

    16. Re:It does rank up there.... by Anonymous Coward · · Score: 0


      No, that's exactly the problem with stupid patients.

      Just because your symptoms are gone, doesn't mean the infection is. All you'd do is leave the infectious agents that were the *last to die* to stay around in your body and create more offspring.

      This is exactly how resistant strains are bred.

    17. Re:It does rank up there.... by GigsVT · · Score: 1

      If you are in a car going the speed of light, what happens when you turn on the headlights?

      The whole point of the theory of relativity is that the speed of light is constant. Your example is moot, because the car could not travel at the speed of light, but a better example, if a car was travelling at half the speed of light, and it turned on its headlights, the light would still appear to travel away from the car at the speed of light, if you were in the car viewing the light travelling away from the front of the car.

      --
      I've had enough abrasive sigs. Kittens are cute and fuzzy.
    18. Re:It does rank up there.... by DoctorGrim · · Score: 1

      make sure you DIE every time you get sick. Otherwise, the bacteria will mutate and win.

      I think in this case it's safe to say the bacteria have already won...

    19. Re:It does rank up there.... by __aaahtg7394 · · Score: 2

      "Instead, I take Echinacea and Goldenseal three times a day until the infection goes away"

      How are you taking this? I have the same sort of problem (more on this in a second) and tried echinacea/goldenseal tea. Goldenseal is basically a weed when considering it as tea. Horrible taste, couldn't do more than sip it once every few minutes.

      Last season, i was drinking water habitually, and i found i had fewer problems with sinusitis. Maybe i'm just growing out of it, but water (not juice, not soda, nor tea) seemed to help. Also, I definitely notice the less milk and sugar i ingest when having heavy sinus drainage, the faster it goes away.

    20. Re:It does rank up there.... by d_i_r_t_y · · Score: 2, Informative

      correct.

      antibiotics were one of the most significant advancements of the 20th century. i studied the genetic mechanisms of the tranferral of bacterial antibiotic resistence as part of my postgrad and can add a few comments.

      it's true that the overuse of antibiotics as placebos is a part of the problem, but what the article fails to mention is that not taking an entire prescription, or taking tablets irregularly, can be just as bad or worse. in these cases, because the full dosage/regimen is not followed, bugs get to "acclimatise" to a much lower dosage of the drug, which aids the evolution of resistance genes.

      bacteria have a pretty damn nifty mechanism ("integrons") by which they can transfer genes encoding antibacterial resistance (amongst other things) to other bacteria. this, combined with the high rate of genetic evolution in bacteria, and the improper use of antibiotics, allows bacteria to develop resistance to new antibiotics very rapidly.

      the moral of the story: don't ask for or take antibiotics unless you're really sick! you have an extremely efficient and adaptive immune system which works better the more it's used, so use it! and don't forget than big pharma companies *want* you to take antibiotics, and *want* doctors to prescribe them, even for stupid people with the flu (a virus).

      matt

    21. Re:It does rank up there.... by LineNoiz · · Score: 1

      Yeah, but that sig sucks...

      --
      "Quotation is a serviceable substitute for wit." --Oscar Wilde
    22. Re:It does rank up there.... by GigsVT · · Score: 1

      Better now? :)

      --
      I've had enough abrasive sigs. Kittens are cute and fuzzy.
    23. Re:It does rank up there.... by CanadaDave · · Score: 2

      What are you talking about? Antibiotics are good for people! I've been taking erythromycin and it is great for getting rid of my zits. Without it, I couldn't get any dates. Thanks erythromycin!

    24. Re:It does rank up there.... by oku · · Score: 2, Insightful
      ... and too stupid to use them properly.

      Fully agreed. One of the worst things to do is to start taking antibiotics and stop using them as soon as it feels 'somewhat better', for fear of ill effects.

      If you use antibiotics, use them for entire period for which they are prescribed. Otherwise, you are giving the stronger bacteria a chance to survive. You don't want to do that.

      A worse idea would be to the store remaining antibiotics 'for future use', i.e., self-medication.

    25. Re:It does rank up there.... by Grizzlysmit · · Score: 1

      Too true, some doctors have confided in me that they fear to lose patients if they don't provide antibiotics, as for me I'm happy enough not to take them when I don't have to. But my life would be miserable without them, as a very allergic person (Allergic rhinitis), I get way to many infections especially in the nose/sinuses/ears/throat/chest, it's a difficult balancing act for doctors.

      --
      in my life God comes first.... but Linux is pretty high after that :-D
      Francis Smit
    26. Re:It does rank up there.... by GreyPoopon · · Score: 1
      Try Ocean nasal spray before you get the infection.

      Yeah, this is a good idea. I use something similar if I can catch the symptoms in time. Sometimes it only takes one night with the heat on (if the weather changes suddenly) to do the damage.

      --

      GreyPoopon
      --
      Why is it I can write insightful comments but can't come up with a clever signature?

    27. Re:It does rank up there.... by GreyPoopon · · Score: 2, Interesting
      How are you taking this?

      I buy either capsules or caplets with both herbs ground up in them -- any local pharmacy here (United States). I'm not sure what country you're in, but if you are anywhere in Europe, you should be able to find something similar. While living in Germany, we even found an oral suspension for our child that worked pretty well. I haven't managed to find that here.

      The most important of the herbs is probably the Echinacea, which is the immune system booster. The Goldenseal may actually increase your drainage, but is helpful in getting rid of the little nasties as your body beats them down.

      The bottle I currently have contains 225 mg of Echinacea and 50 mg of Goldenseal in TWO caplets. It recommends a dosage of two caplets daily. When I'm sick, I take this dosage three times a day. Because I'm not a doctor, I don't recommend that you do this -- try smaller dosages first. I've just found that this particular dosage schedule works for me. I also have a colleague in Germany who suffered from similar problems, and she now takes a small Echinacea supplement daily -- hasn't had a problem since. However, I don't know if the body will build up a "tolerance" to this kind of usage, so I haven't tried it.

      Finally, beware that Echinacea has some rather interesting side-effects for your digestive system, similar to antibiotics. I'm not sure if this is due to an intestinal reaction to the herb itself, or if it enables your body to start fighting the "good" E. Coli that live in your intestines. (I suspect the former because the herb itself does not attack the bacteria.) Every time I start taking the stuff, it takes a couple days for my digestive system to adjust, and then I'm ok after that.

      --

      GreyPoopon
      --
      Why is it I can write insightful comments but can't come up with a clever signature?

    28. Re:It does rank up there.... by __aaahtg7394 · · Score: 2

      You know, i live in a hippieish town (Asheville, NC), and i've never seen caplets of the stuff =) Admittedly, i was living in a much more conservative area (midwest) when i got the tea...

      I'll poke around some more, see what i can find.

      As far as the digestive system upset, well, you're draining heavily anyway. It's probably not going to be too much worse =)

      Thanks for the info!

  10. DNA Theft by Cyclopedian · · Score: 3, Interesting
    In the article, it says that the Staph bug stole DNA from another bug already inside the woman to become resistant to vancomycin.

    For all you pathology people, is this a common method for bugs, or is it limited to a few families?

    -Cyc

    1. Re:DNA Theft by Gilgaron · · Score: 2, Informative

      Pretty common under the right conditions for nearly any bacteria.

    2. Re:DNA Theft by egeorge · · Score: 5, Informative

      It is fairly common for many types of bacteria to swap genes. I don't think it is very common that you can observe such a concrete trait being transferred from one species to another.

    3. Re:DNA Theft by Professor+Farnsworth · · Score: 5, Informative

      It's not so much 'theft' as 'mating'. . .gene exchange is just one method by which bacteria maintain genetic diversity.

    4. Re:DNA Theft by BitwizeGHC · · Score: 5, Funny

      In the article, it says that the Staph bug stole DNA from another bug already inside the woman to become resistant to vancomycin.


      Could the indigenous bacteria sue for intellectual property theft?

      What if a bacterium steals patented DNA? Do the pharmaceutical companies have a case against it?
      --
      N4st0r, trixx0r h0bb1tz0rz! Th3y st0l3 0ur pr3c10uzz!
    5. Re:DNA Theft by Anonymous Coward · · Score: 0
      "What if a bacterium steals patented DNA? Do the pharmaceutical companies have a case against it?"
      I have a better question, if an engineered bacterium acquires DNA from an engineered bacterium from another company, can the company be prosecuted under the DMCA and the Patriot act for making a tool to hack the companies intellectual property? Or perhaps even can the government take action even if the company did not?
    6. Re:DNA Theft by Anonymous Coward · · Score: 0

      NEWSFLASH: Beekeeper arrested for hacking. Joe Sixpack was arrested today by the FBI for alledgedly locating his hacker bees between the CONAGRO corporate research farm and the farm of Farmer Brown resulting in patented DNA showing up in Farmer Brown's corn. Farmer Brown has also been arrested as he admitted to hiring Joe Sixpack to locate his beehives on Farmer Brown's property. More at 11.

    7. Re:DNA Theft by creepery2kplus · · Score: 1

      It's called plasmid exchange. Plasmid in the biologic sense is a self replicating circular DNA strand. It used by many single cell life forms to exchange information on protein, DND and other similar cellular artifacts. We (that us humans) have used this as an entry vectors in molecular biology. If a plasmid is documented, in other worlds we know every single molecule, we can attach DNA code into it so we can then introduce it to bacteria that up take it readily (not all plasmids are taken in by all bacteria and vice a versa). It allows us to increase the sample of DNA or protein etc... for research purposes. See below for a link that describes this better. http://www.accessexcellence.org/AB/GG/plasmid.html

    8. Re:DNA Theft by plugger · · Score: 1

      Try this link for the gory details.

    9. Re:DNA Theft by addps4cat · · Score: 1

      Yeah, that's so comforting.

      --
      Don't eat shrimp candy, just a heads up.
    10. Re:DNA Theft by Jeriki · · Score: 1

      One or two way plasmid(little circles of DNA) transfer is actually really common, a bacteria can also absorb plasmids from other dead bacteria and the enviroment.

      --
      -witty .sig
    11. Re:DNA Theft by 20_ooodbye · · Score: 1

      Actually it's quite common. Mating may play a part in stuff like this but there is at least as much "naked DNA" geting picked up from dead cells.

      When they did the genome for H. Influenzae they found a number of genes that almost definately came from another organism (bacteria can pick up any gene, not just Bacterial DNA) The other bacterial genomes finished since seem to tell a similair story

      Also passing on a discrete functional gene isn't all that rare, mobile genetic elements called transposons and intergrons can move out of the bug's chromosome and insert somewhere else, if one of these has an antibiotic resistance gene it will have a pretty huge selectional advantage, so will prosper.

      An an event like this is rare (one study attempted to do it under "real world" conditions and didn't detect it once in 10^13 possibe cells) but only has to happen once to spread.

    12. Re:DNA Theft by anocow · · Score: 1

      what the article probably meant was the exchange in plasmids, which are small strands of DNA that is not part of the whole bacterial DNA. bacteria's commonly exchange plasmids, as it's one of their ways to "evolve" sorta speak (other than mutations for example). it's actually more like gaining new abilities, rather than evolving...

      another thing, IIRC this doesn't happen with virii.

  11. great now i can't eat at mcdonalds by dubbreak · · Score: -1, Troll

    The big deal is that staffolacocus (SP sorry) is a very common bacteria carried by most humans in their nasal cavaties. So the next time that little bugger at BK(tm) or Mcdonalds(TM) picks his nose and puts it your greasy burg you could die! In the food industry staff is rampant (BTW it's called staff because it's staff that carry it, cute eh). Best of luck with yuor next burger.

    --
    "If you are going through hell, keep going." - Winston Churchill
    1. Re:great now i can't eat at mcdonalds by Nexus7 · · Score: 1

      How precisely is the parent post offtopic?

    2. Re:great now i can't eat at mcdonalds by Anonymous Coward · · Score: 0

      Staff Bacteria usually do not respond well to 300 degree temperatures.

    3. Re:great now i can't eat at mcdonalds by plugger · · Score: 1

      Staph.aureus on your burger is unlikely to kill you. You might get a nasty stomach upset though.

    4. Re:great now i can't eat at mcdonalds by dubbreak · · Score: 0

      and when do they see this 300 degrees b4 or after handling?it's gotta be handled after cooking.

      --
      "If you are going through hell, keep going." - Winston Churchill
    5. Re:great now i can't eat at mcdonalds by dubbreak · · Score: 0

      true enough, but a strain that is resistant to antibiotics? ever seen the "foodsafe" videos? at one restaurant in my province nearly every person served one night (about 50 me thinks)became deathly ill.. all because of one cook that didn't wash his/her hands.. woops, luckily no elderly there..

      --
      "If you are going through hell, keep going." - Winston Churchill
  12. those poor pill pharms by speculums · · Score: 3, Insightful

    What will they sell us once their magic potions no longer work? Maybe invent a couple more highly profitable diseases, or just classify more things as pathologies. There just isn't the same profit in prevention.

    --
    Vivez sans temps mort
    1. Re:those poor pill pharms by runenfool · · Score: 5, Interesting

      Well, from science fiction land I'm looking forward to nanotechnology to save the day on this one. Hopefully about the time everything under the sun becomes resistent to antibiotics we will have microscopic robots running through our blood stream wiping out invaders.

      Does that mean we will be cyborgs? Kind of I guess ... but we are going to machines sooner or later .. this sounds like a good place to start.

      I wonder how much it will cost and how much control software companies will have over us then?

    2. Re:those poor pill pharms by aridhol · · Score: 3, Funny

      Great...then some skr1p7 k1dd13 will 0\/\/n j00.

      --
      I can't say that I don't give a fuck. I've just run out of fuck to give.
    3. Re:those poor pill pharms by NegativeK · · Score: 1

      I wonder how much it will cost and how much control software companies will have over us then?

      Jesus, I'd hate to see the EULA on those buggers..

      --
      This statement is false.
    4. Re:those poor pill pharms by Anonymous Coward · · Score: 0

      Holy NanoMunch....

      Does this mean we will have to get Software Assurance on our nanobots..... MicroScrews ultimate plan.

    5. Re:those poor pill pharms by Anonymous Coward · · Score: 0
      There just isn't the same profit in prevention

      Quite the oposite actually. A disease whose symptoms could be abated by a drug but not cured would be a wet dream.

      Cure a disease and thats it no more money...

      One of the reasons that antibiotic resistance is a problem is that the returns on an antibiotic are so low compared to, for example, a statin.

    6. Re:those poor pill pharms by plugger · · Score: 1

      You already have smart agents to destroy invading microorganisms, it's called your immune system.

    7. Re:those poor pill pharms by mesocyclone · · Score: 2

      Phages *are* nanotechnology. So are engineered antibiotics.

      Or did you mean nanorobotics?

      --

      The only good weather is bad weather.

    8. Re:those poor pill pharms by runenfool · · Score: 1

      If nanorobotics means hordes of itty bitty robots in our bloodstream, yes, thats what I mean ...

      And yes, I fear the EULA/costs associated with such a system the way things are going now.

      Security shouldn't be too big an issue unless they try to retrofit some other general purpose OS to the job. I would hope that any design would have security first if you are talking about stuff that directly interfaces with our bodies.

      And yes, our immune system IS the original. We could continue to find ways to improve it, or we can augment it with technology. The future just might end up being a combination of both.

    9. Re:those poor pill pharms by error0x100 · · Score: 1

      Hopefully about the time everything under the sun becomes resistent to antibiotics we will have microscopic robots running through our blood stream wiping out invaders.

      Hmm ... looks like the timing on this one is going to be very tight indeed. Good luck to all of us.

    10. Re:those poor pill pharms by Anonymous Coward · · Score: 0

      And it doesn't always work dumbass, hence this discussion.

    11. Re:those poor pill pharms by NewtonsLaw · · Score: 2

      Hopefully about the time everything under the sun becomes resistent to antibiotics we will have
      microscopic robots running through our blood stream wiping out invaders


      Oh yeah... that's good -- until these little computer-controlled nano-probes fall victim to a software virus eh?

      Imagine what damage that could do to your insides!

    12. Re:those poor pill pharms by localman · · Score: 3, Informative
      Heh - I love tech, but the odds of us out-engineering the immune system in the next hundred and fifty years is pretty low. The immune system is pretty darn amazing.


      It's pretty rare that any human invention outdoes mother nature.


      Cheers.

    13. Re:those poor pill pharms by charon_on_acheron · · Score: 1

      Coffins.

    14. Re:those poor pill pharms by Jeriki · · Score: 1

      Phages are viruses that infect bacteria, and can be used to genetically engineer bacteria as well. Get you facts straight.

      --
      -witty .sig
    15. Re:those poor pill pharms by Anonymous Coward · · Score: 0

      It's pretty rare that any human invention outdoes mother nature.

      Really? Look around you. I'd say we're kicking mother nature's ass!

    16. Re:those poor pill pharms by Anonymous Coward · · Score: 0

      Yeah, I'm sure that nano-robots will do a much better job than macrophages, which have only been specializing to do that exact task over the whole of our evolutionary history. And when you say "But we can design them to be better," I answer, "Show me a single machine that can reproduce itself, anywhere." No? That's a rather basic problem compared to the complex tasks that our autoimmune systems handle every moment of our lives, and even macro-machines can't handle it (reproduction). Couple that with the fact that almost all modern medicine hinges on the body's ability to repair itself rather than providing a "magic bullet", and there you have it.

    17. Re:those poor pill pharms by Vuarnet · · Score: 2

      Oh yeah... that's good -- until these little computer-controlled nano-probes fall victim to a software virus eh?

      Piffle. We'll just simply create computer-controlled nano-nano-probes to remove any signs of virii in the computer-controlled nano-probes. Must I think of everything?

      --
      Tongue-tied and twisted, just an earth-bound misfit, I
      Learning to fly, Pink Floyd.
    18. Re:those poor pill pharms by localman · · Score: 2

      If you care to give an example, I will gladly respond.

      In general, human inventions are good at an extremely specialized task where the conditions are controlled. Mother nature excels at systems that are adaptable to unexpected situations.

      For example: the car is faster and more powerful than any animal at locomotion, but it requires you to pave roads for it. And not even the best SUV can come close to the terrain negotiation of any land creature.

      If mankind stopped supporting it's inventions by controlling the environment for them, there would be nothing but ruins in a few hundred years. By contrast, no matter what happens (even nuclear armageddon) it is likely that nature will continue to develop the planet for millenia to come.

      Cheers.

  13. all the more reason by Maskirovka · · Score: 5, Funny

    to quit washing your hands! the more bacteria resistant YOU are, the less you have to rely on artificial crutches like antibiotics.

    1. Re:all the more reason by fishbowl · · Score: 5, Insightful

      You are probably joking, but there is some credibility to the theory that, when we started living indoors, sterilizing our environment, using lipid soaps ("antibacterial" is only new in the Marketing sense), taking antibiotics, and so on, we diminished our exposure to pathogens. Way back when, routine exposure to such things as polio and smallpox led to infant mortality rates that we would not tolerate today, but also bestowed on those who survived much more immunity to disease.

      --
      -fb Everything not expressly forbidden is now mandatory.
    2. Re:all the more reason by nomadic · · Score: 1

      I've heard it argued that's responsible for the rise in severe allergies as well. Parents stop their kids from playing in the mud, and their bodies don't learn how to put up with allergens.

    3. Re:all the more reason by Anonymous Coward · · Score: 0

      Back when kids played in the dirt more, they got exposed to the mycobacteria in the soil (amongst many other things). These bacteria are harmless but help build the immune system.

      I think the overprescription is a bad thing. Every time I've gone to a doctor with ANYTHING in the last few years I've been prescribed hydrocodene (vicodin). Yea, that's not an antibotic, but I've been prescribed those whenever I go in with any illness, even when it appears to be viral. "Just in case". Hmm...

      Oh, and for all of you on the subject of antibacterial soap, it's not really antibacterial. It will kill bacteria exposed to it for a few minutes, but won't really do much when you're just washing your hands. Only the alcohol hand gel is instantaneous, and that's still not an antibiotic.
      -Thorn

    4. Re:all the more reason by margaret · · Score: 1

      Yeah, to paraphrase George Carlin: We have an immune system but it needs stuff to practice on!

    5. Re:all the more reason by Anonymous Coward · · Score: 0

      Two of my cousins had been raised in an obsessively clean environment by my Aunt. she was absolutely obsessed with cleaning, going so far as to wipe antiseptic through their car after every use, and she maintained the most painfully clean house. Those kids suffered from about the strictest upbringing with respect to 'getting dirty' even while playing outside. No sandpit for these kids.

      The first week they went to school they both nearly died from the multiple sicknesses they came down with. It was a good year until they were well enough to re-start schooling.

      Of course my Aunt just took this as a sign of how dirty the world was, and still keeps up her obsession. I don't go near her.

    6. Re:all the more reason by EZmagz · · Score: 1
      From the parent:

      there is some credibility to the theory that, when we started living indoors, sterilizing our environment,..., taking antibiotics, and so on, we diminished our exposure to pathogens

      Indeed, Mr. Fishbowl. Most of us in "modern" civilized countries are starting to experience diseases and health problems that in the past weren't an issue.

      One example, other than the whole antibiotic-resistant organisms emerging, is asthma. I don't have any URLs or statistics offhand, but asthma is WAY more common in places like the U.S, U.K., and Australia than in lesser places like Singapore or in the heart of Africa.

      Basically asthma is becoming a problem for the rich. Ironic, isn't it? That only the people who have the money to use modern medicines and drugs are the ones most likely to get sick from diseases like these? Makes me second guess our obsession with staying clean and disinfected (and I worked as a Microbiologist last year for the biggest industrial soap and disinfectant company in the US)!

      --

      "Hell hath no fury like a woman scorned for SEGA. ..."

    7. Re:all the more reason by Anonymous Coward · · Score: 0

      I wonder how old your Aunt is.
      The reason is that, this is pretty common behavior among people who grew up during a polio epidemic.

    8. Re:all the more reason by Anonymous Coward · · Score: 0

      She's around 60 now, perhaps a little older. My cousins are the same age as I am, born in the late 1960s.

    9. Re:all the more reason by Thaelon · · Score: 0

      Just because we shouldn't weaken the immune system by giving it cruthes, neither should we try to defeat it by ignoring the dirt, bacteria, and viruses that our hands come into contact with. Doorknobs, phone receivers and generally anything else you touch with your hands are the dirtiest things TO come into conctact with.

      While I'm not a fan of using those alcohol based hand sanitizers and the like, I DO believe in washing hands. Soap removes oils that dirt and other unpleasantness gets trapped in, and stuff on your hands has a nasty habit of finding its way into your mouth.

      In addition to oils, bacterias and the like, just think of how much urine is on the handles of those urinal or toilet handles because you KNOW most people flush right after taking a leak and since you're often urinating directly onto a flat vertical surface there tends to be some splattering and...well you get the idea.

      Wash your hands you filthy animal.

      --

      Question everything

    10. Re:all the more reason by cornice · · Score: 2

      "but also bestowed on those who survived much more immunity to disease"

      I think you mean that those who survived were the ones with much more immunity to disease. I know that there is evidence showing what you are stating - exposure to pathogens build immunity to other unrelated pathogens - but I think the bigger effect here is that those who are gentically predisposed to having a strong immune system are the ones that survive such things as polio and smallpox.

      By the way, there also happens to be evidence that exposure to such nasty bugs reduces alergies as well. Today, we are exposed to fewer nasty bugs and thus experience more allergies. Although, I can't remember where I just read that.

    11. Re:all the more reason by sbjornda · · Score: 1
      quit washing your hands!

      Here's another good reason to quit washing your hands: WWJD? (What Would Jesus Do?)

      All you folks who are teaching your kids to wash their hands before they eat are going against the teachings of Jesus! I mean, compared to an eternity in hell, an antibiotic-resistant staph infection is a walk in the park!

      Please moderate this as "+1, saving your sorry soul from eternal damnation."

      .nosig

    12. Re:all the more reason by mandolin · · Score: 2
      Way back when, routine exposure to such things as polio and smallpox led to infant mortality rates that we would not tolerate today, but also bestowed on those who survived much more immunity to disease.

      .. along with crippling deformities, such as my aunt's permanently bent back (thx to polio). That which does not kill you does not necessarily make you stronger.

  14. But.. by Anonymous Coward · · Score: 1, Funny

    Will it play Ogg Vorbis?

  15. this is disturbing. by Unknown+Poltroon · · Score: 5, Funny

    Luckily, i take my cipro once a week, so this shouldnt bother me.

    --
    All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
  16. The causes.. by xchino · · Score: 0, Informative

    Antibiotic resistant strains develop all the time, and most likely each and every one of us is a carrier for antibiotic resistant microbes. When you contract a viral infection and are prescribed antibiotcs it is important to take ALL the prescription. Just because you feel better doesn't mean the infection is gone, it just means you've killed enough virii that your body no longer needs to raise it's extra defenses (ie the symptoms). If you do not kill all the microbes, the ones that remain will develop defenses against whatever antibiotic was used against it, just as our bodies develop antibodies to defend against a Virus we've contracted previously..

    --
    Everyone is entitled to their own opinion. It's just that yours is stupid.
    1. Re:The causes.. by freuddot · · Score: 2

      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.
      Antibiotics don't kill viruses.

      Got it ? No. That might help :

      Antibiotics kill bacteria.
      Antibiotics kill bacteria.
      Antibiotics kill bacteria.
      Antibiotics kill bacteria.
      Antibiotics kill bacteria.
      Antibiotics kill bacteria.
      Antibiotics kill bacteria.
      Antibiotics kill bacteria.
      Antibiotics kill bacteria.

      HTH.

      mouhahah, first time I hit the lameness filter. Well, I guess the lameness filter picks up speech figures better than most humans.

    2. Re:The causes.. by HBI · · Score: 1

      Antibiotics don't kill viruses.

      --
      HBI's Law: Frequency of calling others Nazis is directly correlated with the likelihood of the accuser being Communist.
    3. Re:The causes.. by primenerd · · Score: 1

      Except that viruses are not sensitive to antibiotics. Viruses are prevented by vaccine and a few interference drugs (i.e. AZT).
      Bacteria are sensitive to antibiotics and in that sense it is very very important to take the entire prescription.
      One of the biggest problems in microbiology is antibiotics being perscribed for viral infections, thus costing the patient money and releasing needless antibiotics into the body (encouraging resistant strains).

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    4. Re:The causes.. by elmegil · · Score: 1

      And how is this informative? Antibiotics don't do a damn thing for VIRAL infections.

      --
      7 November 2006: The day Americans realized corruption and incompetence weren't addressing 11 September 2001
    5. Re:The causes.. by Anonymous Coward · · Score: 0
      And how is this informative?

      Maybe because, apart from the virus/bacterium thing, it's 100% correct?

      No matter what kind of infection it is, you should still take all your meds.

    6. Re:The causes.. by MrFreezeBU · · Score: 2, Informative

      I'm sorry, but if you have a viral infection no amount of antibiotcs are going to help you...maybe Interferon would help, but antibiotics are only effective on bacteria.

    7. Re:The causes.. by Anonymous Coward · · Score: 0

      If you have a viral infection and are prescribed antibiotics, it is time to change your doctor.

    8. Re:The causes.. by El · · Score: 2

      When you contract a viral infection and are prescribed antibiotcs then perhaps you should find a new doctor. Antibiotics do nothing to counter virii. (And yes, I did go to a doctor complaining of a flu once, and he did prescribe antibiotics. He may just as well have prescribed a placebo just to make me go away.)

      --

      "Freedom means freedom for everybody" -- Dick Cheney

    9. Re:The causes.. by Anonymous Coward · · Score: 0

      So... You're saying what, exactly? It kinda sounds like anitibiotics don't kill viruses, they kill bacteria, but I'm not terribly sure. On second thought, that can't be right. Why would they call it an antibiotic if it doesn't kill a virus? That's just dumb...

    10. Re:The causes.. by fenix+down · · Score: 1

      Both your intended point and you're inadvertent point are big problems. The same people that don't finish off their antibiotic runs go off and badger their doctors for antibiotics to cure their flu or whatever, since the pills kill germs, right?!!

    11. Re:The causes.. by Anonymous Coward · · Score: 0

      > On second thought, that can't be right. Why would they call it an antibiotic if it doesn't kill a virus? That's just dumb...

      A virus is an entirely different beastie than bacteria & other single-celled bugs, and antibiotics do not work on viruses.

      There's a good argument that viruses aren't even alive, just a Very complex collection of self-replicating molecules; can't even reproduce by itself, needs a host cell, and doesn't have any kind of metabolism - eats nothing, makes no waste. "Antibiotics" don't work well on things that aren't biotic to begin with - viruses don't have any of the cellular structures or mechanisms that an antibiotic would attack.

    12. Re:The causes.. by Anonymous Coward · · Score: 0

      > (Score:1, Informative)

      Another fine example of the keenly-insightful moderation here at Slashdot. "Antibiotics kill viruses" is informative.

      SHEESH.

    13. Re:The causes.. by elmegil · · Score: 1
      An Anonymous Coward wrote:

      Maybe because, apart from the virus/bacterium thing, it's 100% correct?

      No matter what kind of infection it is, you should still take all your meds.

      Ah, so if I were to argue you should take all your meds because otherwise the elves will take you away, that's informative too?

      --
      7 November 2006: The day Americans realized corruption and incompetence weren't addressing 11 September 2001
    14. Re:The causes.. by Silvermask · · Score: 1

      Not always, at any rate. The only time you should be prescribed antibiotics for a viral infection is if you have a secondary bacterial infection as well.

      For example, some people with long-standing bacterial infections (that can come with diseases such as Cystic Fibrosis) are put on antibiotics when they contract a virus because it makes said bacterial infection flare up, and treating that with antibiotics will let your immune system concentrate on the viral infection.

      Another thing about overuse of antibiotics is they kill off all of the "friendly bacteria" in addition to the ones that are making you sick. I believe that is part of the reason antibiotics upset some people's stomachs so badly. Or, at least, I've known some people who have found relief from that problem by taking supplements of friendly bacteria such as Lactobacillus Acidophilus.

      I'm not a medical doctor, so consult yours before you make any changes in your healthcare management. Duh ;-P

      ~Silvermask

      --

      "Wild nights are my glory"
    15. Re:The causes.. by DennyK · · Score: 2

      I think that's a big part of the problem...people go to the doctor expecting to get a pill to make the sickness go away. I am sure there are some doctors who will prescribe some antibiotic for a bad cold or flu to make it look like they're doing something useful, rather than just tell the patient, "There's nothing we can do. Just spend the rest of the week in bed and drink plenty of fluids."

      DennyK

  17. It helps to read the article by burgburgburg · · Score: 5, Informative

    If you'd read the article as opposed to jumping at the opportunity to blame animal farming, you'd have read the vancomycin resistant staph infection (and it's presence in the Detroit area) is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users from the 1970's. They were attempting to avoid infections.

    1. Re:It helps to read the article by GreyPoopon · · Score: 1, Insightful
      ...is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users...

      Yes, but the article *should* have mentioned animal farming as one of the culprits. In my mind, reckless doping the animals with antibiotics is ultimately far worse than the mixing of antibiotics by drug users.

      --

      GreyPoopon
      --
      Why is it I can write insightful comments but can't come up with a clever signature?

    2. Re:It helps to read the article by Anonymous Coward · · Score: 4, Funny
      is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users from the 1970's.

      Oh great, ANOTHER reason why I picked the wrong day to start using heroin.

    3. Re:It helps to read the article by Anonymous Coward · · Score: 0

      Sorry but this is rubbish. In the UK, methicilin resistent staph has been around for ages (my wife's a nurse). No one is really sure why it's come about - the two main reasons mentioned are indeed animal farming, but more likely the scatter gun - have some antibiotics - method of doctoring that became prevalent in the 60s and 70s.

      It's a big problem in the UK - particularly in the London hospitals, and the recent rise over here (it's probably on 80% of wards) has been attributed to cutbacks in the budgets for ward cleaning. As MRSA becomes prevalent, the old ways are more important than ever - keep things, including yourself - clean.

    4. Re:It helps to read the article by jericho4.0 · · Score: 5, Interesting
      There are many reasons behind the emergence of drug resistant strains. I would think that the biggest one is over-prescibing by doctors, often in cases when the drugs will do nothing (viral).

      Along with extremely high antibiotic usage in the meat industry, there's also anti-bacterial soaps, drug-hoarding of precriptions, not finishing a prescription, and the hospital setting itself, that provides a wonderfull proving ground for infections.

      Some friends of mine work in medicine, and this is a big topic for them. And us soon, I guess.

      --
      "A language that doesn't affect the way you think about programming, is not worth knowing" - Alan Perlis
    5. Re:It helps to read the article by Anonymous Coward · · Score: 0

      It is never the wrong day to start using heroine.

    6. Re:It helps to read the article by Anonymous Coward · · Score: 0

      when in doubt.. blame drugs..

    7. Re:It helps to read the article by Zordak · · Score: 2

      But isn't drug use a "victimless crime"?

      --

      Today's Sesame Street was brought to you by the number e.
    8. Re:It helps to read the article by Anonymous Coward · · Score: 0

      The low level does of antibiotics you get each time you eat meat DOES have an effect. When treating bacterial infections it is safest to start with the mildest antibiotics. However some of the bacteria may have grown resistant already due to the low level doses of antibiotics each time one eats meat or drinks milk.

      AC

    9. Re:It helps to read the article by nfotxn · · Score: 1

      I wouldn't blame doctors alone for over-prescribing. It's also the responsibility of the patient to finish the course of the anti-biotic treatment before dis-continuing use which is usually much after when the patient starts to feel better.

      Proper use of anti-biotics helps prevents a strain from mutating by killing the entire colony. The fact is that we're seeing bacteria adapt and evolve which is very healthy in the larger biological scheme of things. The fact remains that we're all part of a larger picture and that our medical technology doesn't prevent us from playing the game of survival. We luckily have the advantage of being able to develope new technologies and techniques.

      This artical is a little extreme in tone, in Canada we've been dealing with VRE, VRSA and other resistant bugs for years. It takes careful monitoring and lots of preventative public health measures in lew of new drugs but it isn't a "crisis" as the article mentions. It's just another threat from the biological world around us. Fact is that only the immunilogically comprimised and very young and old are at great risk. But they always are.

      --

      _nfotxn

    10. Re:It helps to read the article by Anonymous Coward · · Score: 0

      You are both wrong. Over perscription is less than a percentage point of all anti-Biotic use in the US. The VAST majority goes into feed animals to fatten them and prevent infections in udders.

    11. Re:It helps to read the article by Anonymous Coward · · Score: 1, Informative

      But (in the US at least) farmers can not get vancomycin. It is illegal. They use penicillin, tetracycline, erythromycin, etc.

      Nowadays, none of those is used to treat staph or any other life-threatening infection since resistance to them became commonplace decades ago.

      This is not to say they are ineffective. They are used in humans for treatments of infections such as acne, conjunctivitis, etc.

      I am not an MD, RN, or anything, but unless I am much mistaken this is all common knowledge.

      This is not to say that putting antibiotics in animal feed is a good thing. I think it is bad, but not due to overprescription leading to resistance.

    12. Re:It helps to read the article by Lumpy · · Score: 3, Informative

      NOT.. almost every reason you mentioned is pure 100% un-adulterated FUD.

      Microbiology shows that if you supress a microbiological infection to the point where the body takes care of it it's self (not finishing a perscription) you completely kill the colony and there is ZERO chance of a mutation. the only way you can get a mutation to compensate for anti-biotics is by carefully dosing a colony and stopping just befoer you kill them all and keep this up until you start getting iterations of the strain that starts showing resistance.. unfortunately you need to keep the slightly kill-regrow cycle as it takes a few more generations to get the mutation to stick. Then you have to worry about the facts that you haven't been exposing the strain to it's normal habitat and therefore can easily become dependant on conditions during the exposure/treatment.

      and that just covers one piece of the fud.... I and many others that have spent time in the microbiology field can write volumes about it.

      Yes, there is a teeny tiny miniscule chance that you are right.... but is is highly unlikely... to the point that you are more in imminent danger of being killed by a chicken that was flung through the air by a maniac chicken farmer than it happening in the next 100 generations.

      and done even get me started on the myth of antibiotics and food.... I cant believe that people actually believe those greenpeace idiots...

      --
      Do not look at laser with remaining good eye.
    13. Re:It helps to read the article by ThunderInEye · · Score: 1

      My understanding from the article was that this strain was due to 'stealing' of genetic material from another bug: "By stealing genetic material from another bug, the new strain became totally resistant to vancomycin".

      This CDC article mentions that the gene may have come from enterococci (don't know what that is).

      Seems this baby really wants to survive.

      Not only can we speed things along with bad antibiotic discipline (in humans AND animals), but the thing we make resistant today may end up as a quickie-mart of useful genetic material for others.

      Perhaps Dirk Gently was on the right track when he stated that he believed in the 'fundamental inter-connectedness' of all things.

    14. Re:It helps to read the article by sasami · · Score: 1

      if you supress a microbiological infection to the point where the body takes care of it it's self (not finishing a perscription) you completely kill the colony and there is ZERO chance of a mutation

      Obviously, this is what happens if you get better.

      I thought the problem was that the window between when you "feel better" and "get better" is often plenty large enough to infect someone else with your slightly improved bug.

      Sure, this may not be the primary mechanism in many cases. But I can't think of many other possibilities for human-specific pathogens like HIV and such...

      ---
      Dum de dum.

      --
      Freedom is not the license to do what we like, it is the power to do what we ought.
    15. Re:It helps to read the article by SparkyMartin · · Score: 1

      Wrong! Here we go, another human-centric person believing that life on the earth began the day man came into existance.

      Microbes have been developing resistance to toxins and other harmful factors in the environment for billions of years before humans ever appeared. It's something called EVOLUTION. How do think thermophilic bacteria came into being? Thru mutation! After millions of generations one little bacteria developed a mutation that allowed it to survive in a hotspring. It survived, and multiplied, mutated, multiplied, mutated, and now there are numerious kinds of thermophillic bacteria. Same way that some bacteria that can survice in high salt concentrations that kill everything else? Same way some bacteria prefer higher concentrations of CO2, but others are retarded by it. Same way some bacteria have become resistant to toxins that plants produce, yet other bacteria are killed by them. This cycle of toxins-resistance-toxins-resistance has been going on from the beginning of time on this planet, and did not start when doctors "discovered" antibiotics. We simply sped it up a hundredfold in the time since penicillin was discovered.

      It amazes me that people still think Doctors and scientists know everthing. 25 years ago they were removing tonsils from most people until they started realizing that tonsils are part of the immune system and when they are swollen they are actually doing their job! 50 years ago because of antibiotics doctors proclaimed that the fight against disease is over-seems they were wrong about that too.

      Microbiology shows that if you supress a microbiological infection to the point where the body takes care of it it's self (not finishing a perscription) you completely kill the colony and there is ZERO chance of a mutation

      Wrong again! That maybe works in a petri dish but that is far from the real world. That would work if the body kills 100% of all pathogens, but unfortunately that is rarely the case. Just because you are not feeling sick does not mean you are not infected. We injest thousands if not millions of microbes every day from what we eat, drink, breathe and our body is constantly working to rid our bodies of these invaders. Only when an microbe gets the upper hand and reproduces out of control is when we feel symptoms. After we develop acquired immunity and recover we often end up being carriers of that same organism that caused infection; rarely are they 100% destroyed. If you don't think so then look up all the tribes that were wiped out by disease that Europeans were carrying, and immune to, when they were exploring the world.

    16. Re:It helps to read the article by origin2k · · Score: 1

      From what I have read anti-bacterial soap may increase the problem of antibiotic resistant bacteria as well.

      Something to think about.

    17. Re:It helps to read the article by Lumpy · · Score: 1, Flamebait

      thank you for being an obvious bigot... it's nice that you discredit yourself righot off the bat by spewing filth first...

      These strains are NOT changing due to the use of antibiotics they are changing due to the fact they usually DO swap dna from other strains and even different altogether Bacteria. it's not a mutation it's NORMAL OPERATION of the pathogen you idiot.

      so quit trying to be an armchair scientist, go actually read something about it that is accurate and not propaganda published by another group of clueless zealots.. I'm talking textbooks that you would use to get your degree in miocrobiology.. (I'll even lend you mine!) And the petri dish is NOT the same as a human host, you are right... a petri dish is far more hospitable... you dont have any body defenses also working on the problem, you have a controlled environment that is perfect for your target pathogen, and you can limit doaseages to minute levels instead of having the normal massive dose and then trickle dose coupled with body temperature fluctuations, the addition of alcahol to the bloodstream, other pathogens that out populate the target pathogen, etc....

      Thye body DOES get you to the target pathogen is removed state... and a proper perscription will get you to that point at the end of a medication... 99% of all antibiotic is over perscribed by a term of 2 weeks on the average.

      and finally your comment about how we wiped out the indians with our european pathogens... they were KILLED by airborne and waterborne pathogens.. airborne Virii and the fact that europeans settlers were too stupid to not crap and piss in their water sources.. (something that chlorinating the drinking water would have solved.. but they didnt have that back then) e-coli... a standard nice bug that is inside all of us is lethal to an aids patient or anyone with a reduced immune system WHEN it enters the body and is not a part of the digestive system. But mopst of what killed the tribes here in the states were virii like smallpox and the other scourges that we happily brought with us. Virii and bacteria are TWO DIFFERENT THINGS.

      Please, when you have something other than opinion, please bring it back.. I'd be glad to hear it if you can calm down and act like an adult instead of a screaming spoiled brat.

      --
      Do not look at laser with remaining good eye.
    18. Re:It helps to read the article by Lumpy · · Score: 2

      I thought the problem was that the window between when you "feel better" and "get better" is often plenty large enough to infect someone else with your slightly improved bug.

      BINGO!! this is why the doctor is SUPPOSED to monitor the patients when they are on any kind of drug like an antibiotic.. perscribing 30 pills of pennicilin for illness A is not right... as dave and stephanie will heal at different rates with dave healing first.

      the perscripotion of antibiotics hurts the human hosts more as the immune systems do not have a chance to develope their own attack solution... using antibiotics to HELP the body? great... but most perscriptions are written wrong.

      --
      Do not look at laser with remaining good eye.
    19. Re:It helps to read the article by hplasm · · Score: 1

      Bring on the BacterioPhages! Seriously, is anyone working on these things?

      --
      ...and he grinned, like a fox eating shit out of a wire brush.
    20. Re:It helps to read the article by metamatic · · Score: 1

      Still, there's absolutely no reason to legalize drugs or provide universal healthcare. And you'd be a fool and a Communist to think otherwise.

      --
      GCHQ Quantum Insert installed. If only our tongues were made of glass, how much more careful we would be when we speak
    21. Re:It helps to read the article by SparkyMartin · · Score: 1

      .. I'm talking textbooks that you would use to get your degree in miocrobiology.. (I'll even lend you mine!)

      You think your junior high biology textbooks will get you a degree in microbiology. BWAHAHAHAHAH!

      First you say the shit themselves to death:
      airborne Virii and the fact that europeans settlers were too stupid to not crap and piss in their water sources.. (something that chlorinating the drinking water would have solved.. but they didnt have that back then

      Then you say it was from pathogens carried by Europeans:
      ut mopst of what killed the tribes here in the states were virii like smallpox and the other scourges that we happily brought with us

      So what is it? You say one thing, then later you say the opposite, completely contradicting youself. You lost any credibility you had, not to say you had much to begin with.

      Thye body DOES get you to the target pathogen is removed state

      Huh? Problems typing at an adult level I see. Here's something you'll understand then: "body sick go get disease must doctor prescribe help"

      Virii and bacteria are TWO DIFFERENT THINGS
      I guess your junior high text books taught you something, didn't they.

  18. Geeks outliving everybody else? by Anonvmous+Coward · · Score: 3, Funny

    And my high school collegeues made fun of my lack of social life. Ha!

  19. It will petrify Natalie Portman by Anonymous Coward · · Score: 0

    Only hot grits down the pants will save her.

  20. Resistance or Darwinism? by MongooseCN · · Score: 5, Interesting

    Has the bacteria really developed a resistance? Or have all the non-resistive bacteria died off and now only resistive bacteria remain?

    1. Re:Resistance or Darwinism? by jonabbey · · Score: 5, Interesting

      Bacteria are very unlike higher animals. Bacteria aren't restricted to darwinian evolution. They sometimes just grab genes from things they eat and incorporate them into their structure. Some bacteria even take the presence of antibiotics as a sign to spew out copies of their drug-resistant genes.. such bacteria 'remember' that those genes helped them out, and share the wealth when they are attacked. Antibiotic-resistant bacteria are an obscenely dangerous threat.

      See Bruce Sterling's excellent article, Bitter Resistance for far more information than you wanted to know about drug resistance in bacteria.

    2. Re:Resistance or Darwinism? by miniver · · Score: 1, Redundant
      Has the bacteria really developed a resistance? Or have all the non-resistive bacteria died off and now only resistive bacteria remain?

      I was going to ask the same thing. Too bad I don't have mod points today.

      --
      We call it art because we have names for the things we understand.
    3. Re:Resistance or Darwinism? by mesocyclone · · Score: 4, Insightful

      Bacteria aren't restricted to darwinian evolution. They sometimes just grab genes from things they eat and incorporate them into their strucure.

      This is still Darwinian Evolution. After all, Darwin didn't know about genes at all - and certainly not DNA! How the genomic change occurs is not an issue with Darwinian Evolution. Darwin's insight (others had this too, btw) was how natural selection worked to produce variations and new species.

      Genomes change for in all sorts of ways. Mutation is one. Extremely important is gene exchange - typically sexual reproduction. This is very powerful or the high costs of it (please, no bad jokes) wouldn't be tolerated by natural selection. There are other mechanisms... bacteria can simply pick up DNA that is floating around in their environment - especially plasmids. Viruses can cause germ line changes - introducing new genes or modifying existing ones.

      --

      The only good weather is bad weather.

    4. Re:Resistance or Darwinism? by Anonymous Coward · · Score: 0

      Of course this is evolution at its best. The antibiotics eliminate all the bacteria which are not resistant. The few resistant strains which are left can then multiply, even if they had some other disadvantage before.

      A bacterium, while possessing many defense mechanisms against toxic susbtances, does not simply become "turn on" resistance. Almost all the bacteria die when treated with antibiotics... it is the remaining few which are most dangerous.

    5. Re:Resistance or Darwinism? by WatertonMan · · Score: 2

      Bacteria aren't restricted to darwinian evolution. Oh no! They are using Lamarkian Evolution. Run and hide! Run and hide! They've been trained to eat people so they'll all start mutating that way!

    6. Re:Resistance or Darwinism? by NilesDonegan · · Score: 1

      This bacteria has acquired a set of genes from a strain of Enterococcus that is resistant to vancomycin (VRE). Enterococcus has been known for a while to be resistant to vanco through three different evolved mechanisms, which all have the same result of modifying the cell wall. We microbiologists knew it was only a matter of time before Enterococcus donated some genes to Staph and made VRSA. So Staph didn't evolve the genes de novo. Those came from VRE, and *those* came from the original bacteria that made vancomycin to begin with (you have to have the resistance if you're going to make the poison, right?).

    7. Re:Resistance or Darwinism? by NoData · · Score: 2

      WOW. Thanks for the link to that Bruce Sterling article. That was one of the most well-written and absolutely devastating pieces I've ever read. Really a rare example of exceptionally written science for the lay audience.

    8. Re:Resistance or Darwinism? by Anonymous Coward · · Score: 0

      Bitter Resistance... fantastic article, thanks a lot.

    9. Re:Resistance or Darwinism? by jonabbey · · Score: 2

      I'm happy to spread the word about it. I read that article many years ago, and felt the same way. Interesting to read it again now and to see that he specifically discussed the vancomycin-resistant staph concern.

    10. Re:Resistance or Darwinism? by Tablizer · · Score: 2

      They sometimes just grab genes from things they eat and incorporate them into their structure.

      So the bacteria in me can gain the capability of posting stupid slashdot jokes and dancing funny also?

    11. Re:Resistance or Darwinism? by nycsubway · · Score: 1

      It's actually a little of both that contributes to antibitoic resistance. When millions and millions of bacterial cells are reproducing, there is a good chance that one or two or many of them will mutate. these changes may cause antibiotic resistance.

      what is more likely to cause sudden antibiotic resistance is horizontal gene transfer. bacteria like streptococcus can aquire antibiotic resistance through mutltiple encounters with antibiotics. it slowly builds its resistance. a strep bacterium may come in contact with another bacterium such as staphlycoccus and transfer its resistance.

      in your mouth and throat, where these bugs live, they have high chances of coming in contact with each other. when a bacteriophage in the body eats these bacteria, their DNA can mix. bacteria also get real close together and use a pillus to attach to each other and transfer genes.

      MRSA and VRE (vancomycin resistant enterococcus) are common in hospitals. nosocomial infections are extremely common. not because of poor infection control, but because these bacteria are part of the normal flora in the environment. when you have so many people in a closed space with compromised immune systems and lots of antibiotics, it becomes a concentrated breeding ground for resistant bacteria. with the difference types of bacteria that mix with each other, horizontal gene transfer can create bacterium resistant to even vancomycin, rifampin, and methicillin.

  21. Its more common than you think by CormacJ · · Score: 5, Interesting

    There are many strains of antibiotic resitant bugs out there.

    I used to work in a hospital and we had a lot of patients with MRSA (Multiple Resistance to Strains of Antibiotics) related issues. These patients were kept isolated and treated until the MRSA infection was cleared then they could be operated on.

    Quite often these bugs not dangerous until a person gets sick then they can be fatal.

    This is why people should not use antibiotics for viral infections (such as the common cold) and why if you do have to use anti-biotics you should take all the pills as prescribed until they are done.

    1. Re:Its more common than you think by cbnewman · · Score: 1
      MRSA stands for methicillin resistant staph aureus.

      There are already vancomycin resistant strains of bacteria (VRE = vancomycin resistant enterococci) which are treated with beta-lactam antibiotics like floroqunilones (Cipro). VRE is not uncommonly seen in hospitals.

      It is thought that VRSA (vancomycin resistant staph aureus) received its vancomycin resistance from enterococci: a completely different species.

      From a microbiology standpoint, it seems incredibly stupid to constantly expose bacteria to low levels of antibiotics (hand soaps, impregnated cutting boards). Buy bar soap! Take your antibiotics until the prescription is gone, not until you feel better!

    2. Re:Its more common than you think by Idarubicin · · Score: 4, Informative
      I used to work in a hospital and we had a lot of patients with MRSA (Multiple Resistance to Strains of Antibiotics) related issues.

      If you worked in a hospital, you obviously weren't a doctor or nurse. MRSA is Methicillin Resistant Staph(ylococcus) Aureus--a bacterial strain that is resistant to one of the antibiotic 'big guns' methicillin.

      There are few choices of antibiotics left to treat it (for example, vancomycin--though vancomycin resistant staph was observed recently, IIRC). A patient with MRSA is unlikely to survive the trauma of surgery coupled with a serious infection, because the drugs used to treat MRSA are often not friendly in their side effects.

      --
      ~Idarubicin
    3. Re:Its more common than you think by herrd0kt0r · · Score: 2

      someone mod this fellow up.

      MRSA indeed = methicillin resistant staph. aureus, NOT, as the parent said, "multiple resistance to strains of antibiotics."

      additionally, the fellow i'm replying to emphasized a very interesting point that was discussed in the article: VRSA got its resistance to vancomycin from a _different_ bug. fascinating, isn't it?

      one must realize that though bacteria develop resistances, they can also _lose_ resistance. a strain that develops resistance to vanc could lose its resistance to some other antibiotic. i've seen this happen with MRSA: at first, people go bananas thinkin "ABANDON SHIT! MRSA! BREAK OUT THE BIG GUNS [last-ditch antibiotics]!" then, when the sensitivity labs come back, they breathe a sigh of relief: "good news men, this sucker can be killed with toothpaste [err, a very cheap, common antibiotic]."

    4. Re:Its more common than you think by rgmoore · · Score: 1
      though vancomycin resistant staph was observed recently, IIRC

      You do RC, but you obviously didn't read the actual linked article, since it's talking about the first confirmed case of VRSA.

      --

      There's no point in questioning authority if you aren't going to listen to the answers.

    5. Re:Its more common than you think by Anonymous Coward · · Score: 0

      ABANDON SHIT!

      So, umm, the bacteria would be jumping off of it...?

    6. Re:Its more common than you think by beckett · · Score: 2

      MSRA is Methycillin Resistant Staphylococcus aureus, probably the precursor to VSRA. The resistance to vancomycin may have come from VRE, or Vancomycin Resistant Enterococcus. I'm a microbiologist and used to work with these strains of bacteria (VRE and MSRA) in controlled conditions, but the fear of a VSRA strain in the wild was always in the back of our minds.

    7. Re:Its more common than you think by Idarubicin · · Score: 1
      Ouch. I deserved that.

      By the way, it's truly an honour to meet someone on /. who does read the articles.

      --
      ~Idarubicin
  22. MRSA? by beebware · · Score: 2, Informative

    Isn't this just another strain of the MRSA (Methicillin Resistant Staphylococcus aureus) superbug. If so, the UK has already had 2 deaths in Edinburgh (after it infected 13 patients). There was a death last year from it after a 14yr boy broke his ankle (see BBC News for more articles).

    1. Re:MRSA? by WeaponOfChoice · · Score: 3, Informative

      Isn't this just another strain of the MRSA [cdc.gov]

      Sorta. You could probably call it VRSA (Vancomycin Resistant Stap... etc). It's a step up as Vanc & it's contempories are generally used to treat MRSA and there really isn't anything more powerful available. It's worrying as you get a bug that becomes almost impossible to treat (MRSA is a challenge to treat and people die but a full spectrum immune bug could be that Ace in the sleeve that the environment produces to curb the rampant expansion of humanity...)

      ATBE we've pretty much come to the end of what can effectively be treated with Anitbiotics and a new approach must be found, something that has not gotten a lot of attention what with antibiotics being so effective and profitable...

      --


      It's not that I'm Anti-American - I'm Pro-Freedom
    2. Re:MRSA? by GreyPoopon · · Score: 2, Informative
      Isn't this just another strain of the MRSA [cdc.gov] (Methicillin Resistant Staphylococcus aureus) superbug.

      No. This one's even worse. It's resistant to Vancomycin, which is the last line of defense. Because of it's side-effects, Vancomycin is avoided whenever possible. If that doesn't get rid of the bug, you either die, or your own immune system has to deal wit it.

      --

      GreyPoopon
      --
      Why is it I can write insightful comments but can't come up with a clever signature?

  23. Resistant infections by ackthpt · · Score: 1, Interesting
    I had something respiratory (read: lungs) which resisted amoxicillan (sp?) and I was put on something extremely toxic which did work.

    More recently I had a positive reaction to a TB test and am on INH (Isoniazid), which makes me feel like crud. I'm 12 days into it with 6-9 months to go.

    Same plan as standard penecillin treatment, take it all, to prevent drug resistent strains.

    You can probably thank all those ranchers who load up their cattle, pigs and chickens with with antibiotics before bringing them to market, as those which don't break down get stay in the meat and enter your body. Nothing like a good training ground for weeking out the weaker strains of disease.

    --

    A feeling of having made the same mistake before: Deja Foobar
    1. Re:Resistant infections by Anonymous Coward · · Score: 0

      That does explain your username.

    2. Re:Resistant infections by linuxrob · · Score: 0

      who's fault is it really? Yours.

      You know that these animals are being injected with horomones and fed antibiotics. Enough organic markets and mail order exists to
      enable anyone to stay free of this crud.
      Too expensive you say? Join a food coop.
      www.4thstfoodcoop.org

    3. Re:Resistant infections by ackthpt · · Score: 1
      who's fault is it really? Yours.

      Not mine. I've been a vegetarian for over 10 years. I buy most of my food at the local farmers market, and organic to boot, since the price there is pretty much the same, or from some of the co-ops, costs less! Great stuff too, not all beat up like the stuff at Safeway and Ralph's.

      The TB thing, though, likely has to do with living and working in an area with a significant population flow from Asia. One cough on a crowded bus and you're hit. Chest X-rays were negative, but because I tested negative two years ago and now test positive, I'm on the program. :-P

      --

      A feeling of having made the same mistake before: Deja Foobar
    4. Re:Resistant infections by Anonymous Coward · · Score: 0

      If you have TB you can blame all high rate of imigration into your area and all the ankle-grabbers with AIDS. Before AIDS became common, TB had been pretty much wiped out in the developed world.

    5. Re:Resistant infections by Anonymous Coward · · Score: 0

      I doubt the anitibiotic regimen is doing much good. IIRC, the TB skin test has a high false-positive rate, and even if it's correct, it doesn't mean you have TB. You could be exposed but not infected.

      Chest X-Rays are useless for detecting it unless it's in a very advanced stage so that your lungs are in really bad shape. (X-Rays are a dumb way to look at soft tissue.) By that point, you'd probably be coughing up blood, and wouldn't need an x-ray to tell you something's wrong.

      Basically, they x-ray you for no good reason (except x-rays make a lot of money for them), exposing you needlessly, then give you a long-term antiobiotic you don't need, for so long that your quality of life is seriously compromised AND you become a nice breeding ground for resistant bacteria.

  24. No big suprise here... by primenerd · · Score: 1

    Antibiotics have to be one of the most overused and abused tools in the microbiological arsenal. They are needlessly added to animal feed and hand soap thus introducing massive amounts of antibiotics into "the wild". This has the effect of selecting for resistant strains and leads to problems such as the infection experienced by this woman.
    Considering that S. aureus is an incredibly common memeber of the natural skin flora, I would think that this lady has a weak immune system or suffered a big oozing injury on her foot to allow for the infection to establish itself.
    Staphlococcus aureus can be a fairly nasty little bug. It produces an exotoxin that acts as a super-antigen making the immune system go crazy. It also effects the vagus nerve causing *extreme* nausea. I once exposed myself to this stuff and enjoyed 18 hours of fever and projectile vomiting as a result. Several biological weapon programs have considered using the stuff as a chemical weapon.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    1. Re:No big suprise here... by Breakfast+Pants · · Score: 1

      Antibiotics are NOT added to hand soap. That is, if you are talking about over the counter, "antibacterial soap." You need to understand that there is a difference between antibiotic and antibacterial. Antibacterial can be anything that kills bacteria, the stuff used in over the counter soap is just a disinfectant.

      --

      --

      WHO ATE MY BREAKFAST PANTS?
    2. Re:No big suprise here... by primenerd · · Score: 1

      Triclosan, while it is a disinfectant, has been shown to select for strains that also exhibit antibiotic resistance.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  25. Not the first by aminorex · · Score: 2

    I can't imagine where the writer of the article
    got the idea that this is the first case of an
    antibiotic-resistant staph infection.

    What will really be scary is when a necrotizing
    staph infection proves resistant and highly
    contagious. I can hardly wait!

    --
    -I like my women like I like my tea: green-
  26. or plague by myowntrueself · · Score: 5, Insightful

    with antibiotic resistance; though just wait till enough disease paranoid people start loading up on antibiotics with the 2 plague cases in NY... that should give plenty of bugs the opportunity to evolve resistance! ;)
    Heck, with things like this developing its a wonder anti-evolutionist 'creation science' people can show their faces in public!

    --
    In the free world the media isn't government run; the government is media run.
    1. Re:or plague by Omega+Hacker · · Score: 0, Offtopic

      Heck, with things like this developing its a wonder anti-evolutionist 'creation science' people can show their faces in public!

      Only true lunatics and those totally ignorant of basic science have ever claimed that evolution doesn't exist. Specifically micro-evolution. Any true scientist can point to hundreds, probably thousands, of fully documented, incontrovertible instances of micro-evolution. Bacteria evolving to become resistant to antibiotics is a perfect example.

      Macro-evolution (proto-mammals flopping out of the ocean, etc.) on the other hand has no such scientifically incontrovertible proof. Every "link" between one species and another consists mostly of wishful thinking and fabrications by the scientists who expound on the theory that somehow random mutations over the last billion years can produce sentient homo sapiens. A basic grounding in mutation theory and common arithmetic shows the absurdity of it, to start.

      The reality of the matter is that God can do whatever He wants, however He wants. If that involves some variant of macro-evolution, He'll make it work, natural laws or not (He who writes the laws can change/ignore them at will). However we came to this point (x,y,z species in the year 2002) is for Him to know and us to try to figure out. My disagreement with "strict" macro-evolutionary theory is that the science used to construct the theory is suspect at best, and total fabrication at worst.

      The may be right, they may be wrong, since after all reality is what God says it is (think "The Matrix" and the black cat), but when it comes down to it, Ockham's Razor really says it all.

      --
      GStreamer - The only way to stream!
    2. Re:or plague by Anonymous Coward · · Score: 0

      This has been another episode in "Why Religion Is Stupid."

    3. Re:or plague by Anonymous Coward · · Score: 0
      The reality of the matter is that God can do whatever He wants, however He wants.

      Can He create a rock so big He cannot lift it (assuming He wants to)?

    4. Re:or plague by myowntrueself · · Score: 2

      Y'know I sort of agree with you on this;
      "wishful thinking and fabrications by the scientists who expound on the theory that somehow random mutations over the last billion years can produce sentient homo sapiens"

      I like to run the following inductive argument;

      base case; I am at least somewhat intelligent.

      recursive case (sorta); I have no reason to believe that my father or mother are any less intelligent than me.

      For any ancestor x, x has no reason to believe that their immediate predecessor, x-1, is any less intelligent than them.

      Therefore I assume that I am a descendent of a lineage of intelligent organisms going all the way back to the 'primordial ooze'.

      And I'm serious, this is not a troll.

      (My personal philosophy coincides well with Advaita Vedanta)

      --
      In the free world the media isn't government run; the government is media run.
    5. Re:or plague by Omega+Hacker · · Score: 2

      This has been another episode of "mod down a post with which you disagree".

      --
      GStreamer - The only way to stream!
    6. Re:or plague by Anonymous Coward · · Score: 0

      Shame, shame... You can never assume He wants to do anything. Instant answer to every question!

    7. Re:or plague by Anonymous Coward · · Score: 0

      yes, but not directly in the way people think. Seemingly if he could lift it he is not omnipotent, but the same is true if he couldn't.

      However, he could create a rock exactly the size of the universe, and thus he couldn't lift it because there would be no place into which to lift it.

      Q.E.D.

      --
      nc420

    8. Re:or plague by plugger · · Score: 1

      If he really wanted to make a rock too heavy to lift, he could not lift it. If he could lift it, then he did not really want to make it too heavy.

    9. Re:or plague by Anonymous Coward · · Score: 0

      Can he create a world of illusion, in which he is trapped?

    10. Re:or plague by Ayanami+Rei · · Score: 1

      No one has asserted that intellegence has NOT increased from generation to generation. We would expect this to be the case, if the mounting achievements in human history are to be attributed to human cleverness.

      --
      THIS THING CAN TURN ON A DIME, MACROSSZERO STYLE ALSO FUCK BETA, ~NYORON
    11. Re:or plague by Anonymous Coward · · Score: 0

      easy, we can blamne the narrow minded racists like you for the problem.

      the difference between you and a KKK member is they dress better.

    12. Re:or plague by myowntrueself · · Score: 2

      You'll probably think this is really wierd, but I actually don't believe that the achievements of recent decades in any way reflects increasing intelligence.
      On the contrary, I believe that it is entirely possible that technology may allow us to evolve into a technological but unintelligent species.
      Remember it takes a lot of energy to run a brain. In the context of evolution a creature that doesn't need to maintain that expenditure *could* wind up more efficient than one that does ie one with a large brain.
      So, I believe its *possible* that I am more intelligent than some of my ancestors, I'm just saying that I don't believe its necessary.

      --
      In the free world the media isn't government run; the government is media run.
    13. Re:or plague by Ayanami+Rei · · Score: 1

      Sure, it may not be requisite. However, I think compared to population size, the number of persons of distinguished intelligence has risen since bygone eras. Perhaps we identify them better today, then that would give my viewpoint less weight.

      As to intellegence vs. brain efficiency, hogwash. Intellegence is primarily dependant on the structure of the brain, not how much energy it wastes. With deeper connectivity, you can do more with less. Furthermore, the organs within the body cavity consume several times more blood capacity than the brain; I would suspect those and skeletal muscles would be the first targets of evolutionary modifications for efficiency.

      But the tool argument is interesting. Although, I'd like to think that having complex tools still requires no less mental skill to derive and interpret meaningful results. That is, with a computer and MATLAB I can perform calculations on datasets that would have taken teams of college students 30 years ago to reproduce. Yet I still need to understand how to pose the problem, know that the solution is sound, and show how to arrive at those conclusions. You have to at least understand the process, it's only sped up for us. ^_^

      I think we also create niche areas where specific kinds of intellegence arise with our technology. Case in point: helicopter pilots. Its not for everyone, it takes a lot of effort and discipline to learn, and there are some who have a special knack for it. They have a high "Gyrcopter IQ" if you will. :)

      --
      THIS THING CAN TURN ON A DIME, MACROSSZERO STYLE ALSO FUCK BETA, ~NYORON
  27. It just goes to show.. by krin · · Score: 3, Interesting

    That we are getting soft. All these new products that have anti-bactereal stuff in them aren't helping us, in the long run anyway. It's sad when you see kids afraid of dirt, or people who have to wipe down every little thing before they feel it's clean. Yes, I'm wash myself.. but I don't feel the need to buy every product that 'Kills 99.9% of germs FAST!' I rarely kid a cold, and when I do my body fights it off without the use of twenty different products. Tylenol, and some good chicken soup are all I need. And yet they say the flu is getting worse by the year. We're soft, we need to toughen up. Go play in the mud.

    --
    There is no spork.
    1. Re:It just goes to show.. by metachimp · · Score: 1

      There is something to that. Can't get a source, but I remember reading something by I think a German or perhaps Danish researcher that seems to indicate that the quest to eradicate germs from children's lives has indeed made them more susceptible to infection. It makes sense. Your immune system is kind of like a muscle, in that it needs exercise or it goes flabby.

      --
      The system has failed you, don't fail yourself. --Billy Bragg
    2. Re:It just goes to show.. by El · · Score: 2

      In fact, studies have shown that kids subjected to _more_ household dust as children are _less_ likely to get asthma later. Can you say "building up a tolerance"? I personally have been working on building up a tolerance for poison oak, although some people refer to what I'm doing simply as "yard work".

      --

      "Freedom means freedom for everybody" -- Dick Cheney

    3. Re:It just goes to show.. by Transcendent · · Score: 3, Interesting

      Just like how our medical methods are really making our gene pool a bit murkey. Since even the children with life-threatening defects live and reproduce, this weakness gets spread to all their offspring... weakening the gene pool even more.

      On one hand, advanced medical science can cure the world... on the other... it can make everybody so weak that they would die from a untreated cold in a matter of hours...

      maybe genetic engineering can restore the strength that the human race once had...

    4. Re:It just goes to show.. by Beowulf+Smith · · Score: 1

      That is a very interesting point and one that deserves due consideration. One merely has to look at a crowded street in any first world nation to notice the huge amount of people wearing glasses (one of the most obvious genetic failings, though granted it isn't always genetic). If only people would stop to consider the benefit of genetic engineering for humans, instead of jumping to the immediate conclusion that someone would clone you for nefarious purposes (why would anyone want to clone you anyway?). Here at my university (PU), researches are working on using retro-viruses to correct genetic defects by literally going into each cell (by being infected) and replacing that bit of DNA with a better one. With this sort of technology and much greater understanding of the human genome, we won't even need much of the medicine we have now. We can simply make new generations of humans resistant to various illnesses and eliminate defects, all without becoming a race of clones or whatever delusion people have. Oh well, maybe some year.

      --

      The object of war is not to die for your country but to make the other bastard die for his. - Gen George S Patton
    5. Re:It just goes to show.. by dasunt · · Score: 2

      Transcendent writes:
      Just like how our medical methods are really making our gene pool a bit murkey. Since even the children with life-threatening defects live and reproduce, this weakness gets spread to all their offspring... weakening the gene pool even more.

      Hate to break it to you, but have you looked at humanity lately? We aren't anywhere near as strong as the great apes, we are poor runners, lack powerful jaw muscles and teeth, lack claws, and our hide is not only easy to tear, its also very inefficient at insulating us from the extremes of heat and cold. Not only that, but we can't graze on the food that many creatures can, and without technology, we'd have a hard time tearing apart any large prey. Other creatures have teeth to cut through thick hides - we don't.

      To add insult to injury, we take a decade and a half or more to reach maturity, and in hunter-gatherer societies, women average one birth every few years. And our young? What a joke. Needing constant care, taking an obscene amount of months before being able to move on their own, and years before they match the size and the strength of an adult.

      Technology is all that we have.

    6. Re:It just goes to show.. by Jeriki · · Score: 1

      If you buy something that says "Kills 99.9% of germs FAST!" and it's not bleach your wasting your money. We did some experimenting with common household antibacterial products last year and found that bleach was the only thing that managed to kill >95% of the bacteria in a mixed culture. I can't find the data sheets right now but I remember that Listerine only killed about 5% of all bacteria, antibacterial soap killed ~1% and a 70% alcohol solution only killed 75% of it was left on for 20 minutes. Advertisors can get away with these lies because they will test the prouduct at a high concentration against a harmless, cellwall-less non-bacili for like two hours and it will kill %99.9 of it. The best thing to do is to just use regular soap and HOT water.

      --
      -witty .sig
    7. Re:It just goes to show.. by caluml · · Score: 1

      I'd make you +5 Funny, if I could :)

    8. Re:It just goes to show.. by anocow · · Score: 1

      and this goes to show that you have absolutely no idea what you're talking about. in fact you sound so much like a nazi when you talking about "weakening the gene pool".

      our "gene pool" has nothing to do with what the article mentioned. the article clearly mentioned that the reason we have a problem with drug-resistant bacteria's is because of all the excessive use of anti-biotics. our gene pool is not involved at all.

      as many people already mentioned, what we need is responsible use of the right drug at the right time.

      genetic engineering... you're just gonna screw things up even more with that :p

    9. Re:It just goes to show.. by juhaz · · Score: 1

      You might as well stop using that Tylenol too.

      Or at least if you are using it as an antipyretic and not a painkiller. Fever is after all caused by your own body and not by the pathogen. It's part of the immune system and suppressing it with drugs only serves to make your flu last longer.

      So unless you really have a good reason to be partly "functional" or body temperatures are approaching dangerous levels, no need to bother with pills.

    10. Re:It just goes to show.. by Transcendent · · Score: 2

      Hate to break it to you, but have you looked at humanity lately? We aren't anywhere near as strong as the great apes, we are poor runners, lack powerful jaw muscles and teeth, lack claws, and our hide is not only easy to tear, its also very inefficient at insulating us from the extremes of heat and cold. Not only that, but we can't graze on the food that many creatures can, and without technology, we'd have a hard time tearing apart any large prey. Other creatures have teeth to cut through thick hides - we don't.

      You're not breaking anything to me... but most of the traits that our ancestors had are lost because we have no need for them anymore. Claws are no use to us, if we reproduced every few years there would be far to many of us (because of our advanced medical technology)... and all those traits you put together are not held by a single animal (An animal as strong as an ape, fast as a cheeta, can live in the tropic and artic??)

      Not only that, but we can't graze on the food that many creatures can, and without technology, we'd have a hard time tearing apart any large prey

      The reason we have lost most of our strength and do not have all the cool little biological weapons that most animals have is because of our ability to think and our use of tools... A pocket knife and a nice hot fire do just fine for cookin up meat in the wild...

      While I agree that it is a shame that we have lost some great characteristics of our animal ancestors (like the strength of an ape), you should not go so far as to "add insult to injury" when discussing the upbringing of our young. (which they mature at age 12-14 (even as young as 9)... which is perfectly fine).

      ...taking an obscene amount of months before being able to move on their own...

      Apes are the same way. They nurture their young for a long time before sending them off on their own...

      The focus of my argument before was genetic weakness in the respect of disease susceptibility and defects... not the lack of claws...

    11. Re:It just goes to show.. by Transcendent · · Score: 2

      and this goes to show that you have absolutely no idea what you're talking about.

      What are you talking about?

      in fact you sound so much like a nazi when you talking about "weakening the gene pool".

      Hitler! Bad! ...think for yourself for once... The idea of only allowing the most genetically sound to mate is instinct of all animals. Why do you think birds have plummage to show off and attract the opposite sex? Why do we have pheromones? In the end, the strongest and best looking male will get the girl... it's part of nature... live with it...

      our "gene pool" has nothing to do with what the article mentioned.

      It does somewhat directly, but indirectly it has a lot to do with it. Regardless of that, my post was to comment more on the post it was replying to...

      as many people already mentioned, what we need is responsible use of the right drug at the right time.

      Sometimes the drug is not needed at all... the only medication I have taken in my life(besides a decongestant and pain reliever) is amoxicillin... only because it was necessary for an ear infection.

      genetic engineering... you're just gonna screw things up even more with that

      Only if you're incharge...

  28. Neither actually by burgburgburg · · Score: 3, Informative

    If you read the article, the resistance is attributed to theft of genetic material from another organism. So those bacteria which were most effective at stealing vancomycin resistance survived to breed, and pass on their criminal legacy.

  29. Gimme some anti-virals... by duncan7 · · Score: 3, Informative

    Many health professionals hope that following this summer's discovery of vancomycin-resistant staph aureus in the metro woman's foot, Americans will be scared enough to accept limited use of antibiotics.

    Not bloody likely. Though maybe if more doctors took the approach that was taken at the Olympic Village in Salt Lake City, the over-use of anti-biotics might start to decline. Not many doctors have that kind of captive audience, though.

    It's not a matter of scaring people away from antibiotics, it's a matter of giving them something that actually might work, instead of just giving them something to get them out of the office...

    1. Re:Gimme some anti-virals... by StonedZero · · Score: 1

      A patient goes to the GP with a virus ie. a cold. 2 treatment paths are suggested. 1. Take a course of antibiotics, and you will be well in a week. 2. Go home with out a prescription, and you will be well in 7 days. An informed consumer would release the often antibiotics is no more than a placebo in regards to the virus, but it does give bacteria another chance to evolve in a resistant strain. (Thanks Dr. Karl)

  30. A grain of salt by MacAndrew · · Score: 5, Interesting

    This spectre of super-bacteria (another writer correctly notes that antibiotics have nothing to do with viral infections) has been over-hyped by the press. There have been occasional examples of astonishingly resistant variations on common bacteria, but almost all have arisen in hospital settings with other complications present. They aren't whipping through the community, in other words. There are also special interests, such as the anti-antibiotics in animal feed people (a cause I tend to believe in), which have disingenuously used the problem to boost their cause, lacking any causal connection.

    There is good evidence anitbiotics are overprescribed and, much worse, misused by the public (always always finish your course of antibiotic correctly, the last mile really is important even though you may feel fine -- it sounds preachy but it's true). But this is a different issue; the super-bacteria appear in hospital setting where doctors are doing their utmost to fight infection. Vancomycin is still pretty nuclear stuff.

    I wish I had a good cite handy, but I can't dredge one up offhand; do take a look if you're interested, at NIH and CDC for starters. IMHO the superbacteria are kind of like the killer bees, long heralded but never quite arriving in force. I don't mean to make light of the potential trouble; it's just not here yet, and won't for a while, and it pales in contrast to staggering public health problems we have like HIV and smoking and unaffordable prescriptions and even West Nile virus. When you hear reports in terms of infections per 100,000 people, as opposed to isolated case studies, take heed. For now it merely makes for good copy, over and over.

    "I'm not a doctor but I play one onlin." :) Actually, I minored in biology and immunology, FWIW.

    1. Re:A grain of salt by jonabbey · · Score: 4, Interesting

      Well, that's the hope, that somehow the antibiotic-resistant genes will prove detrimental to the bacteria in the absence of the specific antibiotic. If a vancomycin-resistant staph bug is 10% less efficient at metabolism or replication, then there might be a degree to which the problem becomes self-limiting. This is also the idea behind letting older antibiotics 'rest' for awhile, in the hope that, in the absence of the antibiotics, the wild population will mutate back to the more efficient non-resistant configuration.

      I suspect that's not a terribly sturdy reed to pin one's hopes on, though. I'd again recommend Bruce Sterling's Bitter Resistance column for more on this.

    2. Re:A grain of salt by Mr+Rohan · · Score: 2, Informative

      When you hear reports in terms of infections per 100,000 people, as opposed to isolated case studies, take heed. For now it merely makes for good copy, over and over.

      Didn't you read the article - Staph aureus is a common pathogen that infects about 400,000 U.S. hospital patients a year. About one-quarter of them die . That sounds like a pretty big problem !!

    3. Re:A grain of salt by rgmoore · · Score: 2

      It's not quite as slender a reed as you might think. I recently attended a seminar at which one of the speakers discussed bacterial evolution by inter-species gene transfer. One of the key points of his talk was that recently transfered genes really don't fit into the recipient genomes very well. Unless they actually give the recipient a selective advantage, they tend to be weeded back out of the population because they cause a whole host of subtle and not-so-subtle problems. So when you stop applying the selective pressure to keep them (i.e. stop prescribing the antibiotics) they can get selected back out pretty quickly.

      --

      There's no point in questioning authority if you aren't going to listen to the answers.

    4. Re:A grain of salt by jonabbey · · Score: 2

      That is reassuring to hear. Let's hope it's a relatively quick process.

    5. Re:A grain of salt by Anonymous Coward · · Score: 0

      > There are also special interests, such as the anti-antibiotics in animal feed people (a cause I
      > tend to believe in), which have disingenuously used the problem to boost their cause, lacking any
      > causal connection.

      I don't see how you can agree antibiotics are overprescribed for humans -- who may get it once a year on average -- yet not see the connection with animals getting it in their food every single day.

      There are NUMEROUS bugs that are happy to spread from animals to humans. Try E. Coli O157:H7, anthrax, various types of flu, etc.
      Animals are generally kept in such filthy conditions that antibiotics are used to keep them from dying. They're still sick, but lots of growth hormone gets 'em big anyway.

    6. Re:A grain of salt by hawkedwards · · Score: 1

      It's true that hospitals and nursing homes are the breeding grounds and storehouses of these highly-resistant bugs (e.g. MRSA). As long as you can manage to stay out of them, you are unlikely (although it's not impossible) to have a problem with, say, MRSA for now. Lots of people don't have the option, of course.

      Also, other forms of drug resistance are extremely widespread and have affected how common community-acquired infections are treated. Community-acquired pneumonia is treated very differently today than in the past, and part of the reason is resistance patterns. This is assessed community by community. The point being, in the not-so-distant past _these_ resistances were mainly in hospitals and nursing homes, but now they're everywhere. In time resistance to other drugs will spread as well.

      Also, the important thing about vancomycin is that it can treat some bacteria that are resistant to other antibiotics. However, even with bugs that are sensitive to it it may not be as effective as other, older, medications (not all antibiotics kill as effectively, regardless of resistance). The example I'm thinking of is bacterial meningitis, an extraordinarily nasty infection. There is a study which showed that those treated with vancomycin did significantly worse long-term (residual neurologic deficits) than those treated with an older antibiotic, if the bacteria weren't resistant to it. Problem is, there's enough resistance now in some communities that vancomycin will be the only choice for many people.

      Finally, I don't think this is a case of media hype. All of the infectious diseases docs that I know are even more concerned about it (if that's possible) than the articles suggest. Problem is there are some docs out there who still hand out prescriptions for no reason other than the patient wants one. There's a big push to stop this, but it may take another generation of freshly-trained MDs IMO.

    7. Re:A grain of salt by NilesDonegan · · Score: 1

      First off, Staph is normally carried in your nose and throat and skin. This is not a bacteria that you just pick up in hospitals, although you are more likely to get a resistant strain when you are in a hospital (and the larger the hospital, the greater the chance for a resistant strain!). BUT studies that have examined what kids on the playground are carrying have shown that at least a third of the kids have a strain that is resisitant to some commonly used medicinal antibiotic.

      So this is not just limited to the hospital. You can pick these bugs up in normal life, then when you become immunocompromised or have a deep wound, they can establish and cause disease.

      As for using antibiotics in animal feed, you're correct that it's not a bad idea at all! But the problem arises when we use the same antibiotics to make our cows a little bigger and to cure us of infections. Fluoroquinolone use is a great example. These drugs have been very effective in controling infections, but overuse by in livestock has created a large reservoir of antibiotic resistant bacteria. This is not controversial. Look at the American Society for Microbiology's (ASM) position on this topic. The solution to having your burger and keeping healthy is to have different classes of antibiotics. The highest class would be used for human disease only. The lowest class would be for farm animals and food production. A middle class would have a mix between the two. But the most important drugs would be saved for humans, not so that we can have that taaaaasty burger!

      So for your lack of worry, I'd encourage you to attend the ASM meeting in Washington this May, or any other microbiology conference, and talk to any microbiologist there. Trust me - we're very close to losing control of Staph. It IS very dangerous. It can kill a good deal of people if uncontrolled. It did so before penicillin, but there are few of us left who remember those days.
      This month, we just have lost the last best drug available to us, and we are now faced with a window of vulnerability to this bacteria.

      And I'm not a doctor yet either - but in a couple years more (and a few /. posts less) I'll have a microbio PhD.

    8. Re:A grain of salt by Doctor+Beavis · · Score: 1, Informative
      I disagree with you that super-bacteria have been over-hyped by the press. I this that the public (note public != slashdot community) is woefully uneducated about the significance of this. The emergence of VRSA should have been headline news - in 10 years it will be killing FAR more people than West Nile Virus (a very good example of media hype, IMHO).

      I believe that you are mistaken about a causal connection between the use of antibiotics in animals and antibiotic resistance as a result in infections in people. Please see New England Journal of Medicine, Vol. 345 (Oct 18, 2001). There are mutliple articles and an editorial on this topic. I would have provided a link to the articles, but I think full-text access is limited to subscribers. Their home page is here.

    9. Re:A grain of salt by Anonymous Coward · · Score: 0

      I think that the chances of dying from West Nile is close to that of the flu. (The real thing not the weaker stomach cousion.) In fact the flu has been responsible for at least one nasty pandemic while West Nile hasn't. Another thing is is that West Nile is DNA based so it is harder for it to evolve while the flu changes every year being RNA based.

    10. Re:A grain of salt by MacAndrew · · Score: 2

      Yep, I know we're surrounded by bacteria and viruses that would like to kill us. On the playground, there's the classic threat of that nasty tentanus-causing bacteria just waiting for its chance (at an unimmunized foot). Even our buddy E. coli (the "friendly" kind) is sitting there in the gut, just waiting for its chance.... But as you know, our skin is 99.9 % of our defense; that infection can result is scary, but where infection does result is what I worry about. Mostly, unless I'm out to sea, the infection by exotics has so far been among the immunocompromised (who have to fear even fungus) and hospitalized. This is of course the tip of the iceberg, and these people's lives are very important, but it is where we are right now, and I'm just uncomfortable with the frequent articles that describe these imminent threats and need for new drugs without touching on boring topics like how and where we get sick in first place. Wash your hands, folks!

      A doctor I worked for said that his first autopsy in medical school was of a man who died of a ruptured boil! It's almost a miracle our bodies can stay more or less sterile. The immune system is quite something.

      I'm not wild about giving antibiotics as a day-to-day thing to cattle -- as opposed to treating illness -- but I know what the ranchers would say. For me, it's primarily for the bleeding heart reason that I think such use encourages or masks maltreatment of the cattle. I buy "organic" milk mostly on humanitarian grounds. And then there are the possible antibiotic resistance problems. I don't think we could turn the whole system around and meet current production at reasonable prices, but do question the assumption that antibiotics are the correct way to do things. I think the science is there, but politically, well, look for my rant on the gov't's unwillingness to admit that E. coli in hamburger comes from manure in the meat.

      To be honest, I stopped eating hamburgers once I understood the contamination problem, even though i doubt they would ever kill me. I do wonder if maybe I get sick less often now. It astonishes me that the gov't and press and ranchers had me believing that the problem was inadequate cooking. Well, sure, in the sense that the Maginot Line "caused" the invasion of France.

      Cool career, I hope it gratifies you. Consider working on vaccines! Now, party with a bunch of microbiologists at an ASM meeting? Uh.... :)

    11. Re:A grain of salt by hughk · · Score: 2
      In Germany, people are concrned about antibiotics in meat. Regrettably, the medical profession still blandly perscribes antibiotics where none are needed, i.e., a cold. neither I nor my family take them unless we are clear that there is a bacterial element in the infection.

      In the third world, you can buy antibiotics over the counter. The drugs are fine and apart from cheaper packaging, are identical to the stuff I can find in a western pharamcist. These drugs seem to be Some people take them correctly, some do not.

      The proposed solution is to hold some antibiotics exclusively for animal use, some for regular human use and hold back some in case of emergency like Vanomycin. Regrettably, the quantities of antibiotics floating around in a hospital means that there will also be a resistent pool of bacteria there.

      I agree that multi-resistant bacteria aren't yet a major problem but it is one that is avoidable by having some kind of use policy inside and outside the hospital that is better than what is currently used. Policy and coordination don't cost a lot and it will help the problem from growing.

      --
      See my journal, I write things there
    12. Re:A grain of salt by elohim · · Score: 1

      There's selective pressure against larger genomes (ones with antibiotic resistance genes) since these take longer to replicate. Thus if you have spontaneous resistance to a drug, for instance, a duplication in a gene encoding a protein that pumps the antibiotic out of the cell, removing the antiobiotic from the media will cause the gene duplication to collapse.

  31. How long until AIDS swaps genes? by Blimey85 · · Score: 5, Interesting
    Yes I know that AIDS is a virus and not a bacteria but there have been cases of other things becoming airborne such as certain strains of Ebola. My fear is that somehow AIDS will become airborne.

    I think the main problem with infections and diseases becoming more resistant to treatment lies partly in a lot of people failing to use the medicine for the required amount of time. I had a skin fungus that kept coming back because everytime I cound't see it anymore, I would quit spraying the medicine on it. After a few times of this, the medicine was no longer effective and I had to get some much stronger (and much more costly) medicine to combat the problem. Using antibiotics for a short while until the problem is apparently gone and then stopping, may allow whatever it is that is being treated to adapt to the treatments. Then it gets spread to someone else and the process repeats itself until eventually, we have no way to stop even common ailments.

    --
    How is it that one careless match can start a forest fire, but it takes a whole box to start a campfire?
    1. Re:How long until AIDS swaps genes? by primenerd · · Score: 4, Informative

      Viruses such as HIV can swap genes, but only if two strains infect the same cell. This is why new influenza often comes to us from China, where swine, bird and human all live in close proximity and exchange viruses.
      The chief engine of genetic change in viruses is caused by antigen drift via mutation. This is due to the error-prone nature of virus replication.
      However, drug resistance is found in viruses. AIDS has shown resistance to some of the early retrotranscriptase inhibitors (AZT), not due to gene-swapping, but good old fashioned natural selection.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    2. Re:How long until AIDS swaps genes? by ackthpt · · Score: 1
      I thought HIV was the virus and AIDS (Acquired Immune Deficiency Syndrome) was the name of the disease. I may be a bit off there, but here's the rest of my thoughts on the advancement of HIV...

      Douglas Adams wrote something along the lines of 'some believe once someone has figured out the universe it will be immediately replaced with something stranger and more inexplicable. Others believe this has already happened.' (sorry for slaughtering it, but it's the gist of this I'm using here.)

      I find it unlikely that the HIV virus has remained in its present state of evolution, unchanged, for years. I think humans have come into contact with it many times before, but it wasn't quite so clever and immune systems disposed of it or it didn't kill the host. At some point it mutated into the unsuccessful disease (a successful disease doesn't kill it's host) that has since, mutated to be resistent to current treatments.

      --

      A feeling of having made the same mistake before: Deja Foobar
    3. Re:How long until AIDS swaps genes? by Anonymous Coward · · Score: 0

      Relax. There are worse things than AIDS. :-)

    4. Re:How long until AIDS swaps genes? by El · · Score: 3, Interesting

      AIDs is already airborne. The problem is, you apparent need a LOT of HIV virus in your system to get infected, and you simply can't get that much through airborne sources. Most of us have already come into contact with very low numbers of dangerous virii and not been affected because our imune system managed to wipe them out before they propagated to higher numbers.

      --

      "Freedom means freedom for everybody" -- Dick Cheney

    5. Re:How long until AIDS swaps genes? by Transcendent · · Score: 2

      AIDS does not swap genes.... it infects a living cell with its own genes. Then those genes take over the cell, multiply, and pack themselves with enzymes and other chemicals for the trip to the next cell. The cell bursts and off they go...

    6. Re:How long until AIDS swaps genes? by plugger · · Score: 1

      I wouldn't call it unsuccessful, if success is to infect the maximum number of hosts possible. HIV can be carried for years without any external signs. It is still infective in this phase. Most illnesses I know of are over within 2 weeks, max.

      A successful disease doesn't kill before the host has chance to infect many others, which I guess is what you meant.

    7. Re:How long until AIDS swaps genes? by Bruce+Losis · · Score: 1

      HIV does very occasionally swap genes by RNA recombination with co-infecting viruses (I would imagine this would nearly always be other HIV substrains - though I may be wrong).

      The importat thing though about HIV (and other retroviruses), is that they are extremely error prone in their replication (~1 error per 1000 bases replicated, which is about 1e3 fold higher than bacteria and 1e6 fold higher than humans and other animals).

      The upshot of this is that any host of a retrovirus (HIV in this case) is actually host to around 1000 different replication competent substrains. Each will have different drug sensitivities, growth rates and host ranges. That is the reason that single drug treatments are now ineffective against modern strains.

      The combination of rapid mutation and recombination in HIV makes it very difficult to reliably treat AIDS sufferers with antiviral drugs.

      Isn't it ironic that the plague tauted by religious fanatics as 'God's scourge against the sinners' is so successful because of it's propensity to evolve resistance.

      --
      Don't believe the nonsense, unless you hear it from me directly.
    8. Re:How long until AIDS swaps genes? by Anonymous Coward · · Score: 0
      AIDS has shown resistance to some of the early retrotranscriptase inhibitors [...]

      You mean reverse transcriptase.

    9. Re:How long until AIDS swaps genes? by WatertonMan · · Score: 2

      Of course the new technique against HIV is to increase the mutation rate even higher. This makes it so hard to replicate that it dies out. New Scientist had an interesting article on this a few days back. I'd put a link up, but it appears it is already gone from the public site. Of course it is still in early research but it sounds like a novel approachs.

    10. Re:How long until AIDS swaps genes? by primenerd · · Score: 1

      No.

      It is called retrotranscriptase. Retrotranscriptase is used by HIV to transcribe RNA into DNA, in reverse direction of what transcriptase does.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    11. Re:How long until AIDS swaps genes? by NilesDonegan · · Score: 1

      If you check out "Biohazard" by Ken Alibek, you'll see that the Russians (not the Soviets; our friends the Russians) engineered the vaccinia virus to hold Ebola genes. They claimed that it was for a vaccine application, but everyone looking at it knew it was a test to see if variola (i.e. smallpox) could be engineered the same way to hold the hemorragic genes of Ebola.

      Yikes.

    12. Re:How long until AIDS swaps genes? by i_am_nitrogen · · Score: 1

      This was a really great post until you had to bring in an attack on religion. While I won't associate myself with either extreme (hardline evolutionary atheists or hardline "science is stupid" creationists), I find arguing about who is right pointless at best, and petty attacks such as yours are not only a source for distrust of science, they also make use of generalizations that cannot be proven. You imply that all religious fanatics are anti-evolution, or that they all have stated that HIV is God's scourge. Many creationists claim that all scientists are evil because all scientists believe that religion is evil. Neither generalization is true.

      My intent is not to insult you personally or any particular group of people, but to bring to light a problem that I find quite annoying with many "arguments" used by both sides of any controversial debate.

    13. Re:How long until AIDS swaps genes? by Anonymous Coward · · Score: 0

      A number of links refer to AZT as a (nucleoside) reverse transcriptase inhibitor. http://www.thebody.com/treat/rtis.html etc

    14. Re:How long until AIDS swaps genes? by Anonymous Coward · · Score: 0

      when the revolution comes, you'll burn at the stake fundie.

    15. Re:How long until AIDS swaps genes? by Anonymous Coward · · Score: 1, Interesting

      Just a little tidbit of info from someone who works with AIDS on a daily basis in a P2-3 lab - AIDS can, in fact, be concentrated to such an extent that it can become infectiously viable as an airborn agent , but that condition never occurs naturally. For example, we sometimes recieve 1 ml sample vials that contain 10^3 TCID50 concentration of virus - more then enough to make it viable in a aerosol form. But unless you try to snort the stuff (which is packed and shipped in dry ice), or accidently spill it into an open orifice, the likelihood of infection is still very, very low. In any case, the virus dies extremely easily - even the smallest squirt of simple PBS can wipe out th e whole batch.

    16. Re:How long until AIDS swaps genes? by Jeriki · · Score: 1

      The problem with AIDS is that it has a very high mutation rate, AIDS mutates approximatly once in every five infection cycle(i.e. once in every five cells it infects). Because of this every person who has AIDS has a different strain, which makes creating a cure-all vaccine difficult. Your body fights off a viral infection by enabling your T-Cells to latch onto the specific protein coat on a virus capsid and destroying it. When a person gets AIDS their body is able to fight it off for up to several years until it mutates into something that their body can't fight off anymore, then they get HIV.

      --
      -witty .sig
    17. Re:How long until AIDS swaps genes? by Bruce+Losis · · Score: 1

      Quoting myself:

      Isn't it ironic that the plague tauted by religious fanatics as 'God's scourge against the sinners' is so successful because of it's propensity to evolve resistance.

      AIDS was tauted as a scourge brought to Earth against sinner (originally only homosexuals but later IV drug users).

      The people making this claim were religious fanatics.

      The very same (demographically speaking) people are responsible for getting Evolution taught as `only a theory' (this still makes me laugh - creation doesn't get past the hypothesis/axiom stage of idea development) in some American schools.

      HIV and other retroviruses are successful in large part because of their genetic instability and the subsequent selection of fit copies.

      I feel that it is ironic that people who have stated that AIDS was sent to remove sinners have also said that evolution is either not possible (I have been to talks like this - unfortunately) or `only a theory' when the virus clearly is successful because of its evolutionary fluidity.

      I can't see any `all Christians' (I don't see the word `christian' at all in fact), nor do I see any statements about who is right and who is wrong. I honestly don't care whether you believe that life is the result of evolution, Devine Creation, or something that was picked out of some BOFH's ear on a slow day.

      I think you may have been reading between the lines, but if the boot fits, you may need some help pulling it out.

      --
      Don't believe the nonsense, unless you hear it from me directly.
  32. And the creationists will say? by myowntrueself · · Score: 5, Funny

    How are they gonna explain this in classrooms in Alabama? (or wherever the heck it is that evolution is banned in classrooms)

    "Well kids you see God just recently gave the staph bacteria a gracious gift; antibiotic resistance. Of course staph didn't *evolve* this resistance since theres no such thing as evolution, children.
    We just have to wonder at Gods great plan where he makes these changes in living things just to make life harder for us God fearing folk. Praise the lord.
    Ok now children all lne up for your lobotomy operations; you won't be needing independent thought with God looking after things."

    --
    In the free world the media isn't government run; the government is media run.
    1. Re:And the creationists will say? by xenoweeno · · Score: 5, Informative

      In the creationist's mind, this is an example of "microevolution" and not "macroevolution". The latter of these two is the one that Goes Against God's Plan(TM), etc. They'll go along with staph becoming antibiotic-reistant, but not with staph mutating into an entirely different creature.

      This ignores that micro and macro are in reality the same thing to educated people, of course.

    2. Re:And the creationists will say? by Blimey85 · · Score: 2, Insightful
      I'm a creationist. I also believe in evolution. Yes you can have both. I believe that God created the Heavens, Earth, and everything else. Life then evolved into what it is now. There is evidence of evolution all around us but there is no concrete evidence that proves or disproves creation.

      This isn't going to start a flame war isn't it?

      --
      How is it that one careless match can start a forest fire, but it takes a whole box to start a campfire?
    3. Re:And the creationists will say? by binaryDigit · · Score: 2

      Actually, very few "creationists" think that the generic concept that organisms evolve and mutate is false. AAMOF, a great many of the scientists/medical professionals are "creationists", so they obviously see it first hand. What they usually have a beef with is taking the concept and extrapolating it to an extreme to explain the origins of man.

      After all, it's not a huge logical leap to say that to a creationist, "evolution" simply started at a point further along than many "evolutionists" want to start at.

      So before you start calling others "lobotomized" and lacking in independant thinking, please go take a long hard look in the mirror.

    4. Re:And the creationists will say? by myowntrueself · · Score: 2

      Ok fair enough.

      I've always felt that the only way one could disbelieve in evolution would be if one didn't know how sexual reproduction works!

      --
      In the free world the media isn't government run; the government is media run.
    5. Re:And the creationists will say? by GS11_Pus · · Score: 1, Funny

      Start?

      Sometimes I wonder if Slashdot is nothing but one endless Creation vs Evolution flame war...

    6. Re:And the creationists will say? by Anonymous Coward · · Score: 0

      There is no concrete evidence that proves or disproves the fact that the earth is actually a zit on the face of a giant teenage cat living in an alternate, undetectable, universe.

    7. Re:And the creationists will say? by Loki_1929 · · Score: 2

      "I believe that God created the Heavens, Earth, and everything else. Life then evolved into what it is now. There is evidence of evolution all around us but there is no concrete evidence that proves or disproves creation."

      Now why not take this one step further and say, "I believe that God created the energy of the universe and the laws of physics, and that since the Big Bang, things have evolved as they may." At that point, I don't think you'll have very many (if any) people arguing with you, especially physicists. Who can argue what caused the energy of the universe to come into being? And it still preserves the creationist part of you that believes everything was created by God. In this view, what makes up everything was created by God, but it's specific configuration is the result of evolutionary changes throughout billions of years. I think if creationists were to retreat to this point (instead of advocating hardline "if you see it, God made it just like it is" ideas), there would be much less of a debate, and yet creationism as a whole would be preserved. I'm just curious on your perspective on this; certainly not looking for a flamewar by any regards.

      --
      -- "Government is the great fiction through which everybody endeavors to live at the expense of everybody else."
    8. Re:And the creationists will say? by Dr+Caleb · · Score: 2
      "Big Bang theory does not preclude God creating the Universe, it simply sets a time at which He did it" Dr. Steven Hawkings (Paraphrased from 'A Brief History of Time')

      Way I see it, He had the plan, every atomic and particle collision, beginning to end already set and then went "GO!"

      --
      "History doesn't repeat itself, but it does rhyme." Mark Twain
    9. Re:And the creationists will say? by Quelain · · Score: 1

      The only thing 'extreme' about the origins of man is the extreme conflict with the fairy tale story the creationists seem to believe where man was just *poofed* into existance.

      Otherwise we're a pretty cut and dried case of evolution from primate ancestors ( of which we have fossils ), and we still have many close living relatives.

      How can you deny that you are an ape? Lack of independent thinking perhaps?

      --
      Cthulhu loves you.
    10. Re:And the creationists will say? by Loki_1929 · · Score: 2

      "Way I see it, He had the plan, every atomic and particle collision, beginning to end already set and then went "GO!""

      Which begs the question, if you know the location and velocity of every single particle in the universe at a given moment in time, all the forces acting upon each of them, and all the laws governing matter and energy, could you not predict as far into the future as you like? How about figuring out the past?

      If this is so, then do we have free will, or is every single particle in our bodies simply acting according to the laws of physics based on the forces acting upon them? Let the debate begin...

      --
      -- "Government is the great fiction through which everybody endeavors to live at the expense of everybody else."
    11. Re:And the creationists will say? by Anonymous Coward · · Score: 0
      This isn't going to start a flame war isn't it?

      We can always have a flame war. All it takes is for it to strike someone's fancy on that particular day. Wanna fight? :)

    12. Re:And the creationists will say? by myowntrueself · · Score: 1, Offtopic

      Something I always thought would be a cool creation-by-god scenario would be this;

      God creates the universe, all of infinite space and time.
      After all, can't God create infinities?

      What this scenario gives us is an infinite past and future all created by God and existing at once. In Gods perception (if it can be said that God has perception) everything that ever has or ever will exist appears together and non-sequentially.

      Personally I hold the view that God is/was one and indivisible, yet needing to understand itself, God created/s all of existance from its own substance in order that everything that can be experienced is experienced and since all things are God, once all that can be experienced has been experienced, God can recombine reality and understand itself.

      Or something like that, to be honest I am not exactly sure what I believe. But I know I must believe something.
      Anyhow, at some stage in the infinite future, all will become apparent.

      Maybe my personal experience of selfhood is really God remembering my life in that infinitely far future.

      --
      In the free world the media isn't government run; the government is media run.
    13. Re:And the creationists will say? by doorbot.com · · Score: 1

      There is evidence of evolution all around us but there is no concrete evidence that proves or disproves creation.

      I am god. Now prove me wrong.

      Because you can't, does that make it true?

    14. Re:And the creationists will say? by Anonymous Coward · · Score: 0

      This has been yet another episode of "Why Religion Is Stupid."

    15. Re:And the creationists will say? by NewtonsLaw · · Score: 2

      I'm not a creationist (well at not in the conventional sense of the word) but it strikes me that if God were going to create and populate the earth then he'd hardly do it all by hand would he?

      Being the/an all-powerful, all-knowing being, he'd surely be smart enough to simply create the right conditions for life to flourish and then seed it with a simple single-celled creature -- leaving the rest to evolution.

      Only an omnistupid being would design and construct each individual organism within an ecosystem eh?

      God -- working smarter, not harder?

    16. Re:And the creationists will say? by namespan · · Score: 1, Offtopic

      I had a weird thought the other day. What if you were a higher-dimensional being, and lived outside the timeline of the universe and could see its development? If you could touch/shape it in the right way, wouldn't influencing events be sort of like pruning a tree?

      Crazy stuff, I know, half-lucid, not talkin' sense, but it's a wisp of an idea...

      --
      Libertarianism is rich wolves and poor sheep playing gambler's ruin for dinner.
    17. Re:And the creationists will say? by Anonymous Coward · · Score: 0

      I'm a creationist. I also believe in evolution. Yes you can have both.

      All that means is that you are capable of holding logical inconsistant beliefs. If I believe that I am Elvis and I also belief that I am Madonna it doesn't mean that Elvis and Madonna are the same person. I means that I'm not right in the head.

      This isn't going to start a flame war isn't it?

      I think you know that you've said something stupid and you're going to get called on it, so in advance you're branding anyone who disagrees with you as flamer.

      --Elvis and Madonna

    18. Re:And the creationists will say? by Anonymous Coward · · Score: 0

      "There is evidence of evolution all around us but there is no concrete evidence that proves or disproves creation."

      Complete HORSESHIT.

    19. Re:And the creationists will say? by binaryDigit · · Score: 2

      The only thing 'extreme' about the origins of man is the extreme conflict with the fairy tale ...

      Well by "extreme" I meant "going out to the end", not in the political (e.g. extremist) sense.

      man was just *poofed* into existance

      OK, so you believe that man was "randomized" into existance, doesn't sound any more plausable in my book.

      How can you deny that you are an ape? Lack of independent thinking perhaps?

      No, it's my primitive ape derived brain that prevents me from seeing the "obvious" ;)

    20. Re:And the creationists will say? by Quelain · · Score: 1

      Yup, that's what I thought you meant. I was making the point that there's nothing unusual about us, we're just another animal. An animal which evolved from a previous population of different animals.

      If you don't have a problem with say, penguins evolving from a 'standard' flying sea bird, why is it extreme to accept the evolution of humans? I suspect it's because it would mean we aren't "special", whereas said fairy-tale says we are "special".

      --
      Cthulhu loves you.
    21. Re:And the creationists will say? by Anonymous Coward · · Score: 0

      you're wrong

    22. Re:And the creationists will say? by eMilkshake · · Score: 3, Interesting
      How much education counts?

      You are correct on micro/macro.

      And, it's not that it's "Against God's Plan" -- it's that it simply is conjecture that didn't happen.

      The better example is the dog born with 5 legs. Some would say this could be a transitional form that if things were right could lead to a new breed of super dog. We see a dog flopping around looking embarrassed because it has a serious problem.

      The main issue is that there should be tranisitional forms all around us -- and that evolution should be observed. Peppered moths are nursery stories and have little correspondance to anything. I could throw away all my yellow sheets of paper, but that wouldn't make my white paper turn into monkeys.

      Mutations and diseases are not part of God's Plan. They are the result of choosing another plan.

    23. Re:And the creationists will say? by Anonymous Coward · · Score: 0

      You're American and live in Ohio, right?

    24. Re:And the creationists will say? by junkgrep · · Score: 2

      ---OK, so you believe that man was "randomized" into existance, doesn't sound any more plausable in my book.---

      How many times must this be covered? The process of evolution isn't "random": it's a mechanism, not a lottery. That it includes elements of randomization (to produce variation) is not enough to characterize it as random, and selection is the driving force without which adaptation would not happen. Evolution is more plausible precisely because it explains an actual step-by-step process that can be understood. "Poof" explains nothing. It is simple only in the sense that nothing (no descriptive explanation) is simpler than something (an actual explanation).

    25. Re:And the creationists will say? by xenoweeno · · Score: 2

      You are correct on micro/macro.

      That's odd, because I said nothing of it other than to identify that they exist as erroneous mental constructs of creationists. Are you sure you meant to say that I was correct about that?

      This sort of twisting of information of well-known information is exactly what I would expect, however. Let's compare this to something you said later:

      Peppered moths are nursery stories and have little correspondance to anything. I could throw away all my yellow sheets of paper, but that wouldn't make my white paper turn into monkeys.

      Are you implying that evolutionary theory stipulates that peppered moths "turned into" monkeys? Are you implying that natural selection in the case of peppered moths has something to do with the evolutionary sequence of monkeys? What did the bit about a dog born with five legs have to do with anything?

      What, exactly, are you saying here? Help me make sense of these completely disconnected ideas.

      Mutations and diseases are not part of God's Plan. They are the result of choosing another plan.

      Yes, and maybe God really does kill a kitten when you masturbate. Bonus points for the gratuitous implications of all things clandestine, for what it's worth.

  33. Obviiously by Unknown+Poltroon · · Score: 4, Funny

    you have never met teh bacteria and mildew in my bathroom. THe view soap as fertilizer a this point. Chlorox merely annoys them.

    --
    All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
    1. Re:Obviiously by Cervantes · · Score: 4, Funny
      you have never met teh bacteria and mildew in my bathroom.

      Actually, we have met it occasionally, but normally it posts as an AC. Don't forget to say hi to Steve, the thing that lives on the crap in your keyboard, for me.

      And yes, for my sugar-starved brain, this is humour. And for the brain-starved mods, this is not troll nor flame, though perhaps flaming trolls could clean his bathroom...

      --
      If I knew the wedgies I gave you back in 6th grade would have resulted in this . . . I might have taken a moments pause.
  34. welcome to denial by shren · · Score: 5, Insightful

    If giving antibiotics for every single illness is a bad idea for humans, then it's likely a bad idea to turn every single cow's bloodstream into an antibiotic river.

    --
    Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
  35. Not the cause by avandesande · · Score: 2, Funny

    The patient, a 40-year-old Michigan man with diabetes, seems to have caught the bug off an infected catheter inserted while he was in the hospital for the amputation of a gangrenous toe

    Couldn't it be that this person's immune system is so compromised that no AB would cure him? He's one breath away from a corpse.

    --
    love is just extroverted narcissism
    1. Re:Not the cause by lirkbald · · Score: 1
      Couldn't it be that this person's immune system is so compromised that no AB would cure him?

      Nope. Antibiotics have nothing to do with the immune system.

      Well, sort of. Antibiotics, in their original form, were essentially the 'immune system' of various types of molds and other such creatures. Antibiotics act by ripping holes in the cell walls of bacteria, or otherwise directly interfering with them- not by supplementing the existing immune system.

    2. Re:Not the cause by 3am · · Score: 2, Insightful

      No

      Diabetes causes lower extremity vascular problems, and all the immune response in the world won't work if there is no blood circulation in the area. This can lead to gangrene if left untreated.

      So the point is that gangrene in toes is not a definitive sign of weak immune system. Maybe their immune system was weakened by septicemia resulting from the gangrene, but there's really no reason to think that antibiotics wouldn't help against non-resistant strains. There's also no reason to think the patient was at deaths door before the staph infection, the gangrene often remains a localized problem.

      --

      A: None. The Universe spins the bulb, and the Zen master merely stays out of the way.
    3. Re:Not the cause by Idarubicin · · Score: 2
      Couldn't it be that this person's immune system is so compromised that no AB would cure him? He's one breath away from a corpse.

      This is entirely possible, but it wouldn't affect the status of the bacterium as resistant. To test for resistance, bacteria can (and often are) extracted from the patient and cultured in vitro in the presence of various antibiotics. The guy may have been to sick to live either way, but the call on the antibiotic resistance of his infection can be confirmed regardless of the poor guy's health. Tests for resistant bacteria can be performed even post mortem as long as the corpse is still fairly fresh.

      --
      ~Idarubicin
  36. If you want to discuss resistance in general ... by burgburgburg · · Score: 2, Informative

    I have no problem with bringing it up. But this article is discussing a specific strain with a specifically attributed cause and it isn't animal farming. It's heroin/antibiotic mixing. That's the cause attributed today, here.

  37. Rush Limbaugh says this isn't happening...... by Newer+Guy · · Score: 1, Troll

    ...and that's good enough for ME!

  38. W Puts More Snowmobiles In Parks +1, Ecofriendly by Anonymous Coward · · Score: -1, Offtopic

    Thanks for nothing, moron:

    Mini-Me Sends More Snowmobiles Into Parks

    George H. W. Bush - Not Much

    George W. Bush - Even Less

    Cheers,

    Woot

  39. Antibiotic Resistant FP!!! by Anonymous Coward · · Score: -1, Offtopic

    Antibiotic Resistant FP!!!

  40. Antibiotics not the only option by jblsys · · Score: 5, Informative

    The Russians have been working for years on alternatives to antibiotics. Phages are viruses that target bacteria and have been shown to be successful in targeting what would otherwise be very resistant strains. http://www.phages.org/PhageHistory.html

    1. Re:Antibiotics not the only option by IamTheRealMike · · Score: 3, Interesting
      I remember seeing a Horizon that dealt with bacteriophages some time ago. It highlighted the fact that most of the research was being done in Russia and the conditions the researchers worked in were appalling. Power cuts could easily wipe out a colony of very promising phages.

      In particular one thing I remember was that for some types of phage, you had to feed them, I think raw meat was a good choice. The viruses actually ate the meat. Phages have the advantage of being as adaptable as the bacteria however.

      What about nanotech? I wonder if by the point that antibiotic resistant bacteria becomes a problem whether we'll have sufficiently advanced nanotechnology to make our own killer molecules.

    2. Re:Antibiotics not the only option by dexter+riley · · Score: 3, Interesting

      Unfortunately, bacteria can become resistant to bacteriophages as well. Occasionally a bacteria has a mutation in the receptor protein that the phage normally binds to during infection. Still, if I had a vancomycin resistant infection, I'd want to give phage treatment a try...

    3. Re:Antibiotics not the only option by idontneedanickname · · Score: 1

      Yes, Vernor Vinge mentioneed phages in Marooned in Realtime. They would be in your body and pretty much eat the bad stuff.

    4. Re:Antibiotics not the only option by CrackHappy · · Score: 1

      Does it bother anyone else that the phages that they suggest implanting in YOU are fed RAW MEAT just like YOU are made of to keep them alive?

      Doctor: Uhoh - bacterial infection! Here, we have a new treatment!

      You: Doctor, why is my arm disintegrating?

      Doctor: Oh, don't worry about that, it's all a part of the treatment.

      --
      1f u c4n r34d th1s u r34lly n33d t0 g37 l41d Capitalization really works: i helped my uncle jack off a horse
    5. Re:Antibiotics not the only option by npietraniec · · Score: 2

      Creating viruses and releasing them into the population seems like a really bad idea. If B-movies on sci-fi have taught me anything, it's that you can't contain nature like that.

    6. Re:Antibiotics not the only option by Anonymous Coward · · Score: 0

      That's odd... Seeing as they are both B-movies (read: crappy) and Sci-Fi (read: not real), the only real lesson you can garner from them is that some people who aren't exactly qualified think you can't contain nature like that.

    7. Re:Antibiotics not the only option by DickScratcher · · Score: 2, Interesting

      I think bacteriophages need bacteria to reproduce in. The meat stock is a culture for the bacteria rather than viruses - the type of bacteria that grow on raw meat are probably the same that infect humans. Bacteriophages specifically infect bacteria. Animal cells have a different cell structure to bacteria and aren't vulnerable to bacteriophages.

      I remember that the Russians were using hospital sewage as the source of bacteriophages. The sewage was contaminated with the most common patient infections.

    8. Re:Antibiotics not the only option by Halo1 · · Score: 2

      Then again, the bacteriophages can also mutate and adapt (unlike antibiotics). I've seen that documentary as well and when those researchers encountered bacteria their pahges couldn't handle, they simply went "fishing" in the sewer waters of their own facility to collect new ones.

      --
      Donate free food here
    9. Re:Antibiotics not the only option by Beautyon · · Score: 2

      I know an old lady who swallowed a fly.
      I don't know why she swallowed the fly.
      Perhaps she'll die.

      I know an old lady who swallowed a spider
      that wriggled and jiggled and tickled inside her.
      She swallowed the spider to catch the fly.
      I don't know why she swallowed the fly.
      Perhaps she'll die.

      I know an old lady who swallowed a bird.
      How absurd, to swallow a bird!
      She swallowed the bird to catch the spider
      that wriggled and jiggled and tickled inside her.
      She swallowed the spider to catch the fly.
      I don't know why she swallowed the fly.
      Perhaps she'll die.

      I know an old lady who swallowed a cat.
      Imagine that, to swallow a cat.
      She swallowed the cat to catch the bird.
      She swallowed the bird to catch the spider
      that wriggled and jiggled and tickled inside her.
      She swallowed the spider to catch the fly.
      I don't know why she swallowed the fly.
      Perhaps she'll die.

      I know an old lady who swallowed a dog.
      What a hog, to swallow a dog!
      She swallowed the dog to catch the cat.
      She swallowed the cat to catch the bird.
      She swallowed the bird to catch the spider
      that wriggled and jiggled and tickled inside her.
      She swallowed the spider to catch the fly.
      I don't know why she swallowed the fly.
      Perhaps she'll die.

      I know an old lady who swallowed a horse.
      She's dead of course!

      --
      ATH0 Bitcoin: 1DnwFLXczVZV8kLJbMYoheUrpqHesjxrSi
    10. Re:Antibiotics not the only option by jerde · · Score: 1

      There's something missing here, since viruses can't eat!

      Could it possibly have been a competeing strain of bacteria which eat meat and harmful bacteria, yet don't bother humans?

      It's important to remember that viruses are creepy, dead bits of genetic code. They are not cells, they have no life processes of their own. They barely have moving parts. Think of them as evil "keys" that float around and perfectly fit through the "keyholes" in susceptible cells. Once they fit in the cell's lock, the cell does all the work of opening up the virus capsule, extracting and incorporating its RNA, and then manufacturing more viruses according to that RNA.

      - Peter

      --
      INsigNIFICANT
  41. Just when you think by CableModemSniper · · Score: 5, Funny

    That we've licked staph, along comes some guy with $6Mil. "We can rebuild it. We have the technology. We can make it better, faster, stronger."

    --
    Why not fork?
    1. Re:Just when you think by Grizzlysmit · · Score: 1
      That we've licked staph

      Don't do that liking germs is how these problems get started.

      --
      in my life God comes first.... but Linux is pretty high after that :-D
      Francis Smit
  42. Mercury Poisoning by index72 · · Score: -1, Troll

    Very likely she has mercury poisoning from mercury amalgam fillings. The mercury causes treatment resistant strains of bacteria to grow in the body. Get the mercury out and the person's health should return to normal. See "Pain Free in 6 Weeks" at www.prestigepublishing.com . Also see www.amalgam.org for a whitepaper on this issue as well as information on legislation before congress to ban mercury amalgam fillings. It also has a list of countries that are phasing out or have already banned amalgam.

    1. Re:Mercury Poisoning by Anonymous Coward · · Score: -1, Offtopic

      Yeah right. And the moon landing is a hoax, and the eath is square.

  43. Not denial: Precision by burgburgburg · · Score: 2, Informative
    I'm not denying the danger of dramatic overuse of antibiotics in the animal farming industry. It has the potential for bringing about a large number of resistant bacteria in the future, and it should be legislated away (not likely for at least two years).

    I'm pointing out that the scientists involved feel they have found the specific cause of this specific instance of vancomycin-resistant staph. And it isn't animal farming. It was heroin/antibiotic mixing.

    If you want to discuss resistance in general, and it's growth in the future, bring up animal farming. But don't attribute this case to it.

    1. Re:Not denial: Precision by Anonymous Coward · · Score: 0

      It IS A CURRENT ISSUE. Within 6 months of the indtroduction of an anti-biotic into a feed animal population you start seeing human resistant strains in the hospitals.

      ALL THIS FOR A FEW PERCENT WEIGHT INCREASE!

      FUCK THEM ALL. Seriously I want to murder every fucking cow in America, AND I LOVE A GOOD STEAK!

      The cattle farmers are such assholes. They use 70% of the fresh water in the west. They are literally killing us for few few percentage points of weight gain. Here's a fucking clue assholes, give em beer intead, works for $150 per Lbs. Kobe beef.

      The cost analysis for removing anti-biotics from animal use is a $9.00 per year per person per increase in food cost. That's nothing compaired to dying from a fuck staph infection.

      DO ANY OF YOU KNOW WHAT ITS LIKE TO DIE OF FUCK STAPH! BOILS! Dying of fucking boils!

    2. Re:Not denial: Precision by Anonymous Coward · · Score: 0

      Farmers don't give vancomycin to cattle, so I seriously doubt that they created vancomycin-resistant staph.

      But you are right. There is no excuse for mass treatment of cattle with antibiotics. Even if it is just penicillin (almost never used for humans nowadays) no good will come of it. Supposedly the farmers do this because the cattle are fed so much corn (maize) but I don't know if this is true.

    3. Re:Not denial: Precision by shren · · Score: 2

      I follow your argument, but while we can't prove a causal relationship, we can't disprove a casual relationship either. Heroin sounds like a fall-guy to me. Just because we've found a contributing factor doesn't mean we've found all of the factors, or even the prime factor.

      --
      Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
  44. Not the first time. by xenoweeno · · Score: 5, Interesting

    Not only is this not the first time, but antibiotic-resistant strains are already resisting brand new classes of antibiotics designed to beat them when all others fail.

    All I'm sayin' is that I'm funneling down the vitamin C like Pez. :-|

    1. Re:Not the first time. by El · · Score: 2

      There's a limit to how much vitamin C you can take (it causes diarhea in sufficient quantities.) The amount you can tolerate does go way up when you have a viral infection, though. I think Linus Paulings rule of thumb of 2000 milligrams every 4 hours still applies.

      --

      "Freedom means freedom for everybody" -- Dick Cheney

    2. Re:Not the first time. by Quantum+Skyline · · Score: 2, Informative

      Correct me if I'm wrong, but you pee out any excess vitamin C that your body can't store. Vitamin C flies through your system, but other vitamins such as A can get saved, and too much of that is a bad thing.

      But then, too much of anything, including vitamin C, is a bad thing. Especially if you like keeping your kidneys and other bloodstream filtering organs.

    3. Re:Not the first time. by Cyno01 · · Score: 2

      Vitamin C is a water soluble vitamin, not a fat soluble, so you can take as much as you want and any excess you pee out. Iron on the other hand is a fat soluble vitamin, you can only take so much. I think i read somewhere that Flintstones Vitamins with iron are one of the leading causes of poisining among small kids.

      --
      "Sic Semper Tyrannosaurus Rex."
  45. phage therapy by soundofthemoon · · Score: 5, Informative

    There have been rumblings in the news for over a decade that profligate use of anitbiotics in both medical care and factory farming would lead to just this sort of problem. After years of warnings, no one should be surprised by this development. DNA swapping among bacteria species is a well-known phenomenon, and I read years ago that biologists were concerned this very thing would happen.

    What's the alternative? Virtually every species of bacteria has one or more virus species that have evolved to prey on it. These bacteriophage (or phage for short) can sometimes be used as treatment for bacterial infection. They were supposedly the Next Big Thing about a century ago, before antibiotics stole the show. Now there is renewed interest in this approach. There was also a recent development of a technique using only a phage-produced enzyme to fight bacterial infections.

    Google "phage therapy" or "phage enzyme" for some good reading on the subject.

    1. Re:phage therapy by Anonymous Coward · · Score: 0

      My only concern about Phage therapy is the phage itself mutating and attacking that which it is sent to protect. Also how will the phage/bacteria/immune system all interact with each other? The immune system probably will not find the phage any more amusing than the bacterium.

    2. Re:phage therapy by pyrosoft · · Score: 1
      Unfortunately, there exist phage-resistant genes (and organisms) just like antibiotic resistance. A lot of classical genetics back in the day (early to mid 20th century) was done with different strains of E. coli and bacteriophages altered in one way or another. For some types of phages, all that is required for resistance is for the potential host to lose a single cell-surface antigen, and the viral particle can't bind.

      Addressing another concern, your immune system may or may not mount a defense against the bacteriophage, depending on lots of things, including phage used, composition of viral coat, antigen presentation by dendritic cells and macrophages, etc. etc. And while it may seem like a good idea to begin with, purposely infecting a person with a competent virus (i.e., not inactivated or killed, because viral replication is what kills the bacteria) is quite risky. They are (pseudo)living things that kill other living things, and they may decide that humans are more fun to infect than bacteria.

      --
      Great spirits have always encountered violent opposition from mediocre minds. Albert Einstein
    3. Re:phage therapy by mesocyclone · · Score: 3, Insightful

      There is a good overview article on phage therapy in last week's Science magazine.

      Phages therapy still faces the development of resistance. Natural selection is a very powerful process, and various forms of gene exchange among bacteria makes it happen quite quickly.

      Phages also are likely to be attacked by the human immune system (they are, after all, foreign viruses). Thus a lot of phages that work well in vitro don't do well in vivo.

      However, they are an additional weapon against bacteria, and there are now some western companies that are combining the long Soviet experience with them with western venture capital and well equipped laboratories.

      At some point, on might suppose that bacteria would run out of resistance strategies. Most changes to cause resistance come at some cost - which is why resistance genes will often fade away without the presence of antibiotics. Add up enough of these changes and you may produce bacteria that are not very viable. OTOH you may produce bugzilla!

      --

      The only good weather is bad weather.

    4. Re:phage therapy by Loki_1929 · · Score: 2

      "These bacteriophage (or phage for short) can sometimes be used as treatment for bacterial infection."

      Oh no, not The Phage! The Vidiians will harvest our organs; please, not the phage!

      --
      -- "Government is the great fiction through which everybody endeavors to live at the expense of everybody else."
    5. Re:phage therapy by juhaz · · Score: 1

      But phages, unlike antibiotics, are alive so they probably would evolve to beat the resistance - after all, they would no longer have a host and would die out if they couldn't infect the bacteria. And nature doesn't like giving up easily...

      On the other hand, phages ability to change themselves could have some unintended consequences, what if it would be easier to evolve into preying different species instead of beating the resistance, and they would then commence to wipe out our beneficial, symbiotic bacteria?

    6. Re:phage therapy by juhaz · · Score: 1

      Bacterial cells are vastly different from mammalian (eg. human) cells, and are even classified in a different branch of the "tree of life", they are procaryotes, we are made of eycaryotes. Even plants are more related to us than bacteria...

      Phages are specialized, they cant just go on and "decide" that it's more fun to infect very different mechanism. What they probably could do is to change a species of bacteria they are attacking - eg. killing out the bacterium that are actually our symbiotes, and beneficial, maybe even necessary to us.

  46. It also helps to have a clue by Bruce+Losis · · Score: 2, Interesting

    Attibution of evolutionary cause is dubious at best. Since evolutionary biology is almost alway based on preexisting correlation rather than comtrolled experimentation, it is not possible to say where the resistance plasmids arose.

    Vancomycin resistant S. aureus has been isolated in areas outside the US where it has been ascribed http://www.cdc.gov/ncidod/eid/vol3no3/mcdonald.htm to the use of vancomycin analogues and homologue in the poultry industry
    --
    Don't believe the nonsense, unless you hear it from me directly.
    1. Re:It also helps to have a clue by Mnemia · · Score: 2

      That's very true, and there's no way they could ever know conclusively where the resistance first evolved. However, what is likely to be true is that the reason Detroit has these bugs popping up is due to overuse of vancomycin, as is stated in the article. They overused vancomycin more there because the other drugs became resistant sooner than in other areas. The genes for resistance become prevalent in the population of Staph aureus because the drug is being overused and thus a large proportion of the population of germs is being subjected to evolutionary pressure. So, while we can't pinpoint where the resistance started, we can certainly understand why resistance is spreading.

  47. Please stop touching the discussion board by Anonymous Coward · · Score: 0

    And put on a mask before leaning in to read this.

  48. Not any antibiotic - vancomycin by rmayes100 · · Score: 2, Informative

    I don't know about about the person who posted the article to /. but the article itself states pretty clearly that this is first strain resistant to vancomycin. I think the article mentioned that staph was already resistant to most other antibiotics. Vancomycin was one of our last defenses against staph evidently. That's why this was worth posting...

  49. Antibiotic resistance by Cipster · · Score: 5, Informative

    I have actually worked in S. aureus research and it is a very scary bug. Some of the strains we had collected were resistant to 12 different antibiotics and even Arsenic. The main reason S. aureus becomes so easily resistant to new antibiotics is because it easily picks up circular strands of DNA called plasmids which carry resistance genes on them. The most likely source of the resistance gene is not cattle but other bacteria present in the hospitals. Enterococcus, a cousin of S. aureus which lives in a person's gut is highly resistant to Vancomycin and it was expected that sooner or later this will be passed to S. aureus. There have been cases of this happening in Japan a few years ago. The best place to pick up a nasty germ is in the hospital since most patiets there are on antibiotics so the only bugs around are highly resistant to a wide range of drugs.

    1. Re:Antibiotic resistance by 3am · · Score: 1

      Doesn't the increased resistance incur a decreased competitive advantage? I.E., are the staph using more resources to be resistant, and therefore less likely to survive in the absence of a selection pressure (say, vancomycin?) over many generations?

      I just wonder if this resistance would be likely to spread outside of hostpitals, or if non-resistant strains would out-compete the multi-drug resistant strains for resources...

      --

      A: None. The Universe spins the bulb, and the Zen master merely stays out of the way.
    2. Re:Antibiotic resistance by mesocyclone · · Score: 2

      In general, the increased resistance DOES have a selection cost. In the absence of antibiotics the resistance gene(s) often fade from the genome.

      I don't know, however, if this cost is enough to keep the strains within the hospital, given the widespread use of antibiotics. It may be only a slight selection disadvantage in the absence of antibiotics.

      Furthermore, the staph may pass on that resistance to other bugs (Strep?).

      --

      The only good weather is bad weather.

    3. Re:Antibiotic resistance by Cipster · · Score: 2, Insightful

      We actually ran some experiments on this and within a few generations the antibiotic resistance genes disappeared if there were no antibiotics in the growth medium which suggests that in the absence of the pressure from the drugs the bacteria without them do better (this could be due to the metabolic cost of maintaining the extra DNA). This is backed up by clinical observations that the most virulent and resistant strains are much more common in the hospital. One radical suggestion that has been made is to ban the use of an antibiotic for a period of time so that the resistance fades, then reintroduce it. Unfortunately this is hard to implement because some drugs have uses for which there is no better alternative and the manufacturers are not kee on stopping production (and profits).

    4. Re:Antibiotic resistance by shren · · Score: 2

      The main reason S. aureus becomes so easily resistant to new antibiotics is because it easily picks up circular strands of DNA called plasmids which carry resistance genes on them.

      Doesn't the method of DNA transmission imply a solution? Can't we develop a plasmid that kills S. aureus when it takes it on? It looks like S. aureus is saying, "yes, please sabotage my DNA!" Can't we give the disease a disease? Pass it a gene sequence that sterilizes it?
      --
      Maybe the state's highest function is to grind out insoluble problems. (Zelazny, Hall of Mirrors)
    5. Re:Antibiotic resistance by Cipster · · Score: 1

      The problem with that method would be that only a small percentage of the S. aureus actually pick up the plasmids. That number becomes amplified quickly because the ones that did not pick it up get killed by the antibiotics and the resistant ones have free acess to food and resources (that would be the patient). The other problem is that DNA violates the two main tenets of a good drug: easy to manufacture and deliverable. The best way to mass produce DNA is to clone it into a bacterium which does not work with a "suicide" sequence. Prodicing it in vitro is expensive and impractical for longer sequences. Also a small piece of DNA is far bulkier than any drugs out there which makes it hard to deliver at the site of the infection. One of the great hurdles in Gene Therapy is finding an efficient way of delivering the foreign DNA into the target cells.

    6. Re:Antibiotic resistance by dlakelan · · Score: 1

      Where would it get the plasmid from? It'd have to be in contact with another (usually living) bacterium to get it. Since the plasmid would be lethal to the carrier, there won't be carriers for the staph infection to acquire it from.

      Your idea has merit though, it is possible that a specially engineered plasmid might be made that was activated ONLY in staph aureus, and innoccuous in something like e. coli. or another staph spp.

      --
      ((lambda (x) (x x)) (lambda (x) (x x))) http://www.endpointcomputing.com a scientific approach to custom computing.
    7. Re:Antibiotic resistance by jafac · · Score: 2

      The best place to pick up a nasty germ is in the hospital since most patiets there are on antibiotics so the only bugs around are highly resistant to a wide range of drugs.

      This is why the Republican "healthcare plan" is so great. By not controlling prices of medical treatments and prescription drugs, they'll just let them spiral upwards until only the ultra-rich can afford to stay in hospitals or take antibiotics, giving the non-antibiotic strains a chance to come back in the general population.

      --

      These are my friends, See how they glisten. See this one shine, how he smiles in the light.
    8. Re:Antibiotic resistance by Anonymous Coward · · Score: 0

      That would require a piece of DNA that is _beneficial_ to the bacteria, and yet somehow have a suicide mechanism that would only activate after several generations. Otherwise they would just take the thing and die - leaving others that didn't happen to pick up the plasmid to live and multiply.

      Doesn't sound like something that's easy to do...

  50. Why was (is?) West Nile this huge fucking deal? by fenix+down · · Score: 2, Funny

    Oh my fucking God I got bit by a fucking mosquito and now it's like I have the flu! Holy shit! If I were old enough that the flu would kill me, I might suffer from a general feeling of weakness, and headaches, and if I didn't go to a doctor for about a month, I could die! Holy fuck! I demand the government spray DDT down the throats of my children this instant!

  51. Re:A grain of salt except in sterial enviroment! by jackb_guppy · · Score: 1

    Staph is a normally not seen in the general poplution. It shows up where other things have all ready weaken the system.

    So where is the place most staph affesction show up?

    The hostipal.

    That's right, the place you go to get better.

    What was just being found is that assama (trouble breathing) is more common (by % of population) in the city than in the country.

    Why? Cleaner air? No smog?

    Not realy... more dirt in the air. That right dust, sod, pig "gas" and like. The lungs are stronger for having to fight these.

    Staph protection is most like to follow that same. A little dirty does not hurt you.

    Thing of the people that go over see or Mexico and just **GO**. The local microbes in the water setting up shop in their intesants.

    Again people from the country do not show this problem.

    I always wondered what happens to the high tech workers in those ultra-clean rooms for wafers and disks.

    Felics Ungur must being turning in his grave.

  52. a combo solution by honold · · Score: 1

    perhaps an interaction between the magnetic pole shifting and the chemical weapons that will be used against us in the next 6 months could result in the destruction of antibiotic-resistant bacteria.

    i, for one, have had enough indirect threats to my life for this year

  53. Some Thoughts from Med School by md2b · · Score: 5, Informative

    VRSA (vanc. resistant s. aureus) is some scary schtuff. S. Aureus is one of the most virulent organisms we as humans get infected with; aside from the whole being sick in general, it can cause septic shock (death if you're not in a hospital at the time) and VERY rapid failure of your heart valves (called acute bacterial endocarditis). Vanc was once the last line of drugs. If it failed, we had no treatment. Since then, two more classes of ABs have been invented, and we deliberately avoid their general use so they'll be useful in just such situations; some doctors, sadly, don't use this guideline near as much as they need to. Sadly, S. Aureus is also a bacteria which is astoundingly well adapted to take up genetic change. These little buggers actually have "bacteria sex" and share their antibiotic resistance.

    Here's some suggestions to help you avoid these problems:
    1) Most MDR (multidrug resistant) bugs are found in hospitals (med word: nosocomial). You're relatively safe from this stuff when you're out in the community.
    2) TAKE ALL OF YOUR ANTIBIOTICS AS PRESCRIBED. Taking just enough to feel better is the worst idea ever - all the bugs left have now been genetically selected for greater resistance.
    3) If the doc says you don't need an antibiotic, don't push too hard - ABs can cause serious side effects and drug resistance in YOU. Remeber - a normal health human has 10x more bacteria than they do human cells - most bacteria are there to help!!!

    1. Re:Some Thoughts from Med School by metachimp · · Score: 2, Interesting

      I had a friend die of bacterial endocarditis. She was 29 years old, and she thought she just had a very bad flu until her left arm went numb. By the time she got to the hospital, she was dead. It's shocking and it happens fast. I saw her a week before and she was fine.

      --
      The system has failed you, don't fail yourself. --Billy Bragg
    2. Re:Some Thoughts from Med School by TheMohel · · Score: 2, Informative

      From somewhere beyond medical school (active pediatrician, actually):

      First, some definitions. "Virulent" describes the ability of a bug to cause disease. "Resistant" describes the (in)ability of a particular antibiotic to kill a bug. The two aren't the same, although you'd be hard-pressed to find a reporter who can tell the difference.

      Staph Aureus is a relatively virulent bug. It likes to infect skin and soft tissues, it elaborates a variety of toxins, and I've seen otherwise healthy people die of it. It's the bug that causes one of the forms of Toxic Shock Syndrome.

      None of the MRSA or VISA (Vancomycin Intermediate Staph Aureus) or VRSA strains are particularly more virulent, but they all have the ability to live in the presence of methicillin, and, in the case of the VxSA bugs, in the presence of some amount of vancomycin. There are still antibiotics that will kill the bugs, but since vancomycin was the one that ALWAYS worked, people got pretty worried about not having it available.

      You're right that most of these are nosocomial, but recent reports (a year ago or so) of people dying of community-acquired MRSA makes this a less comfortable assumption than it used to be.

      Every time you use an antibiotic, you create resistant organisms (or rather, you select the organisms that are resistant by killing the rest). In most cases that doesn't matter, because you reduce the load of organisms enough that the body can take care of the remainder. In some individuals (especially those with chronic diseases that make it harder for their own systems to clear the bugs) you never do get complete killing; those people (the old, the sick, and the congenitally disabled) are the ones that most often develop clinically significant resistant organisms. They're also the ones most likely to need whole bunches of antibiotics, so it's a hard problem.

      I've lost count of the number of people who have asked me for antibiotics for their colds. I don't bother talking about resistance, because nobody cares (or believes it will happen in THEIR body). Instead I (a) explain that they're going to get better, that (b) fluids and analgesics are the best ways to keep from feeling too bad, and that (c) if I gave them antibiotics, I could give them a really nice case of diarrhea to go with their colds. Most people respond well to this line of argument.

      I also explain how to look for signs of an opportunistic infection (otitis, pneumonia, etc.), and that I WILL treat those if it's indicated. Most of the patients/parents I work with seem to go away happy, and I can relax because good old Amoxicillin (high-dose BID, natch) continues to work like clockwork the few times I need to give it.

    3. Re:Some Thoughts from Med School by mesocyclone · · Score: 3, Informative

      One issue that I haven't seen mentioned in this thread is the spread of resistance in cultures where antibiotics are frequently used without prescriptions or medical advice.

      In many third world countries, antibiotics are available by the pill. People take them until they feel better or can't afford any more.

      Without significant education (and perhaps changes in incentives), this will lead to widespread resistance, without invoking first worlder's ignoring their doctors' adivce or agricultural use of antibiotics.

      In addition, certain subcultures in the US have similar problems. One of the scariest bugs out there (far scarier than MRSA) is multi-drug resistant tuberculosis. TB is common among street people, due to their lifestyle. Unfortunately, the same psychopathologies that lead to them being homeless also lead to failure to follow proper antibiotic treatment regimes. For this reason, states are now starting to reinstate the process of forced treatment - in confinement if necessary.

      If you have TB and you don't follow the treatment protocols, you can be confined to a treatment facility until the TB is cleared (which may be never if it is highly resistant).

      Making this even worse is that many of the street people are also heroin addicts, and contract AIDS. Then we have a paradise for the TB - weakened immune system in a person who doesn't adhere to proper antibiotic use.

      It is also spreading very rapidly in Russian prisons, btw, and is also a major killer in the third world.

      The reason TB is so scary is that it is a very serious disease (often fatal) in a healthy person, and it is spread through the air. You can catch it on a bus or walking down the street. Most TB is resistant to some antibiotics, but curable by a (nasty) cocktail of other antibiotics.

      Before the development of Streptomycin, TB was common in the United States. Many people spent the last months or years of their shortened lives in TB Sanitoria, often experiencing all sorts of ghastly treatment.

      --

      The only good weather is bad weather.

    4. Re:Some Thoughts from Med School by IKEA-Boy · · Score: 1

      In many third world countries, antibiotics are available by the pill. People take them until they feel better or can't afford any more.

      Not only that, in many third world countries doctors deliberately give too low dosages of antibiotics so patients will come back for more and thus pay more money. Travelers to third world countries should be aware of this and check with home if the dosage/duration is strong enough.

    5. Re:Some Thoughts from Med School by Rob+Simpson · · Score: 1

      Good post. For extra emphasis (and fun), you could always describe pseudomembranous colitis to them in excruciating detail. Death by diarrhea - not a good way to go, especially over a silly little cold.

  54. While we're on this funny tangent by serutan · · Score: 2

    If a drug company unwittingly released some harmful, proprietary DNA into the world, would it be an IP violation for another company to produce a cure? (since the cure couldn't have existed without the problem)

    1. Re:While we're on this funny tangent by _ph1ux_ · · Score: 2

      thats a really interesting thought. Will there be such a thing as proprietary DNA? In this crazy time - I am sure there will be attemtps...

      But i think that any DNA and Gene sequence, due to its very nature, should be public domain always - no matter what.

  55. Attention moderators by Compact+Dick · · Score: 1


    The parent post is not offtopic, but informative. Instead of wasting your points on my post, use them to mod up the parent.

    Thanks
    CD

  56. +1, Ignorant (Ignorance is bliss) by Zen+Programmer · · Score: 1

    Yeah, thank God we have phlebotomy (blood-letting) to treat West Nile or we would really be screwed.

  57. SA by zogger · · Score: 5, Interesting

    --long time ago I had an SA infection, it is TRULY sucky, incredibly hard to get rid of. took me six months or so to beat it. At the time I was put on erythomycin (sp).

    With that said, past few years been using colloidal silver on external wounds/infections, works quite well. I was skeptical at first until I tried it. Still using it when needed. Much better than any store bought/prescription antibio cream I ever tried. The only bummer is, it's very inexpensive. You can make it yourself easily or buy it cheaply pre-made, variety of places. People have this ingrained almost religious belief that stuff has to cost a lot of money and come from the medical deity to be effective. (Almost like the almost religious belief that software has to come from an expensive closed source place to be any good). You don't get that "full" satisfaction of paying mucho dinero for it so you know it'll work, like big pharmco products.

    Yes, I know there are some issues with taking it orally by the 55 gallon drum, I'm not recommending that at all, but for some reason those silver particles will sure kill the cooties. No idea if effective or not on SA, but given that the medcos are stumped, well????

    Not to be construed as medical advice, closed track, illegal where void and like that there.

    1. Re:SA by CrackHappy · · Score: 1

      Interesting link about Colloidal Silver. Anyone else have any "medical" information on CS? http://www.colloidal-silver.com/whatiscs.htm

      --
      1f u c4n r34d th1s u r34lly n33d t0 g37 l41d Capitalization really works: i helped my uncle jack off a horse
    2. Re:SA by Mac73117 · · Score: 0

      I've read the same thing about silver. It seems that silver will kill almost any bacteria. There is a documented case (forgot the url) about a doctor who contracted Lymes disease and was paralyzed from the chest down as a result. He found some old medical research about silver solutions and experimented on himself. Within in weeks he was walking. This is why 'silver'ware was created. The silver particles rubbing off in the mouth gave the user a little edge against bacteria.

    3. Re:SA by Anonymous Coward · · Score: 0

      Right. Wearing hats made out of tin foil has a very similar effect, from what I hear.

    4. Re:SA by Nihilanth · · Score: 2

      be sure to post pictures if you turn grey-blue!

    5. Re:SA by metachimp · · Score: 1

      That's cool! She looks like a moon elf!!

      --
      The system has failed you, don't fail yourself. --Billy Bragg
    6. Re:SA by Mike+Monett · · Score: 1, Interesting

      "With that said, past few years been using colloidal silver on external wounds/infections, works quite well. I was skeptical at first until I tried it. Still using it when needed. Much better than any store bought/prescription antibio cream I ever tried."

      I agree completely. Colloidal silver is the answer to bacteria and virus infections, but the pharmaceutical industry is doing everything in its power to stop people from using it, since people would not need their expensive antibiotics anymore. They got the FDA to ban web sites that offer it for sale, and to present phony information on the dangers of protein compounds, which have nothing to do with colloidal silver.

      I got an attack of shingles last year - my doctor told me I had sprained a muscle and to take some asparin. This only made it worse. I went to a different hospital several days later, and the incoming nurse spotted the symptoms immediately. I didn't wait to see the doctor, but went straight home and brewed up a batch.

      For more information, please see my report on "Shingles and Colloidal Silver" at
      http://www.geocities.com/mrmonett/shingles/0shin.h tm

      The usual disclaimers apply. I am not a doctor, this is not medical advice, if you have problems go see your doctor, etc...

      Best Regards,
      Mike Monett

    7. Re:SA by Chops · · Score: 2

      Check out "Colloidal Silver: Risk without benefit" for a representative sample of the medical community's opinion of colloidal silver. I myself have been using nothing at all on external wounds/infections, and that's worked quite well for me.

    8. Re:SA by plugger · · Score: 1
    9. Re:SA by Anonymous Coward · · Score: 0
      With that said, past few years been using colloidal silver on external wounds/infections, works quite well.

      And the great thing is, not only does it help against bacteria and viruses, but it also makes you resistant to vampires.

    10. Re:SA by zogger · · Score: 1

      HAHAHAHAHAHAH! thanks man, if you're gonna troll, make it funny!

      ya, it MUST work, haven't had any vampires attack since I been using it!

      Wait, isn't silver for werewolves, as in silver bullets? Either way, none of them critters around here either! Garlic* for vampires.

      *garlic appears to have natural antibiotic properties they are finding out, as does orgegano oil. Why they work, I don't know. How effective, I don't know, I like both those things though and they are part of my diet.

    11. Re:SA by numark · · Score: 1

      No offense, but I tend to seriously doubt anything that's labeled with the typical "medical conspiracy theory." And, I highly doubt that a doctor would diagnose a sprained muscle if what actually happened was shingles. They're two totally different things, with totally different symptoms. In other words, either you've got a really, really bad doctor, or there's some embellishment in your story. I won't speculate on to which it is.

      There is NO cure-all for bacterial and viral infections. NONE. If there was, you would hear about it in prominent medical journals. But so far there's been a lack of any evidence that colloidal silver works in anything other than sales literature. Why, you may ask? I can tell you: because it DOESN'T work.

      Oh, and by the way, the FDA has no approval to ban web sites that sell dietary supplements. That's the FTC's job, because it's a case of false advertising. And let me tell you what, the FTC isn't going to shut down a web site just because some vaguely-defined "pharmaceutical company" wanted it shut down. Please, give us readers a little bit more credit than that.

      Furthermore, you web site has a link to an "FDA Safety Report." All that link leads to is a page on a sales site (NOT an FDA site) that purports to be a letter from the FDA saying that no adverse reports have been reported to HHS. Here's a few links to FDA sites, which I trust more, and some quotes from each:

      "colloidal silver or silver salts are not recognized as safe and effective and are misbranded."

      "Furthermore, FDA has no information that your product is generally recognized as safe and effective for the above referenced conditions" [referring to a site selling colloidal silver for killing bacteria]

      Nothing against you personally, I only feel that a report like this should be countered with views from the other side. Let each reader be their own judge.

      --
      Want Slashdot headlines on your site? Try SlashHead
    12. Re:SA by Mike+Monett · · Score: 1

      • No offense, but I tend to seriously doubt anything that's labeled with the typical "medical conspiracy theory." And, I highly doubt that a doctor would diagnose a sprained muscle if what actually happened was shingles. They're two totally different things, with totally different symptoms. In other words, either you've got a really, really bad doctor, or there's some embellishment in your story. I won't speculate on to which it is.

      No conspiracy. Incompetent doctor. Smart nurse:)

      • There is NO cure-all for bacterial and viral infections. NONE. If there was, you would hear about it in prominent medical journals. But so far there's been a lack of any evidence that colloidal silver works in anything other than sales literature. Why, you may ask? I can tell you: because it DOESN'T work.

      Millions of people say you are wrong. See the links at the bottom of my web page for articles in prominent medical journals, and the test results by recognized universities.

      • Oh, and by the way, the FDA has no approval to ban web sites that sell dietary supplements. That's the FTC's job, because it's a case of false advertising. And let me tell you what, the FTC isn't going to shut down a web site just because some vaguely-defined "pharmaceutical company" wanted it shut down. Please, give us readers a little bit more credit than that.

      See http://www.fda.gov/cder/warn/cyber/2002/CFSANnatur esrx.htm If that won't shut down your web site, I don't know what will:)

      • Furthermore, you web site has a link to an "FDA Safety Report." All that link leads to is a page on a sales site (NOT an FDA site) that purports to be a letter from the FDA saying that no adverse reports have been reported to HHS.

      Other copies of the same report are on the web. Don't you think if they were false, the FDA would shut them down instantly?

      • Here's a few links to FDA sites, which I trust more, and some quotes from each:

      More misdirection. You are confusing the dangers of silver compounds with the effect of colloidal silver. They are different substances.

      If you wish, I will supply urls for companies that use silver in various products approved by the FDA for sterilization, burn wounds, etc. And US patents including photos of the healing effects of electrolytic silver on infections that previously defied antibiotics.

      Good post, but bad info.

      Regards,

      Mike Monett
    13. Re:SA by numark · · Score: 1

      If you wish, I will supply urls for companies that use silver in various products approved by the FDA for sterilization, burn wounds, etc.

      I know of what you speak, it's called silver sulfadiazine, and it's an antibiotic ointment used on burn victims. But that silver is much different than colloidal silver, and it's been proven to work effectively without many side effects. I guess I'll just never be convinced about colloidal silver :)

      --
      Want Slashdot headlines on your site? Try SlashHead
    14. Re:SA by Anonymous Coward · · Score: 0

      Okay. You are open minded.

      What you overlook is the condition:
      Diabetic.
      Infection in an extremity.
      Older.
      In a hospital.

      This is the medical industry falling flat on its face.

      Fact. The world doesn't know how to treat diabetes, much less diabetic infections.

      Medical industry in turmoil concerning the best treatment of this killer. Not surprisingly, most diabetics suffer from extreme vitamin deficiences and food allergies that most doctors and labs don't even notice, particularly trace minerals such as chromium. Vitamins B-6, E and C are commonly low in diabetics as are several amino acids. Infections are common.

      I bet this patient was given crappy hospital food or glucose drips without the necessary trace minerals and Amino acids. The blood glucose may test fine, but this does not mean the machine is running clean.

      As a Type I diabetic who has had the disease for over 34 years and has not seen a doctor for more than a regular checkup in the last 14 years, all I can say is I believe in colloidal silver and a good vitamin supplements helping this person more than most anti-biotic perscriptions ever could.

      I would be dead if I had listened to all the crap doctors told me. And yes I was once a patient of Charles M. Kilo, one of the world renown diabetic doctors. I have lived without health insurance. I still reuse needles. I buy my medicines and vitamins with cash. I never ever test my blood sugar with the crappy and expensive nicely packaged treatments. I never read the nicely made brochures at the hospitals.
      I don't count my calories or other worthless dietician recommended crap. If I didn't have to overpay the cursed health insurancy industry through my employer I probably would save over $2,000 dollars a year by not doing as I'm told.

      I'm in good health. It's by not listening to the people who are industry born and bred have I survived. Several diabetics my age have died this year. I get a newsletter at work about diabetic fund raisers. They always trot out a story of some poor diabetic who doctors couldn't rescue.

      What a waste of money. People with long-term healthcare needs are not served well in the US. Why? Because the US is not practical. Pharmacists can't just sell drugs without perscriptions.

      Getting this far was not luck. I was in much worse health before I educated myself on alternative treatments. Colloidal Silver works. I've had eye infections in which it just works. Penicillin works too. But Colloidal Silver gets the job done without a trip to the doctor, a trip to the pharmacist, waiting for the questions about insurance or "do you have a card?" . It's all crap. Just money grubbing crap! Make your own colloidal silver. Make it cheap and proud. Don't expect the institutional money grubbing to save your long-term health.

    15. Re:SA by jafac · · Score: 2

      Yes, I know there are some issues with taking it orally by the 55 gallon drum, I'm not recommending that at all,

      That is an incredibly dangerous understatement!
      Mostly because there are quacks and charlatans out there trying to sell people orally-adminsterd silver solutions.
      the "issues" are: It turns your skin grey. PERMANENTLY. ALL of your skin. It ain't pretty.

      --

      These are my friends, See how they glisten. See this one shine, how he smiles in the light.
  58. Chicken Pox vaccine, MRSA staph by RobertB-DC · · Score: 1

    What will they sell us once their magic potions no longer work?

    Well, there's always the Chicken Pox vaccine. Merck is making a killing (sorry) by preying on the fears of parents. Despite the fact that 99.99% of children recover from the disease (caveat emptor on that link), the vaccine is being pushed with FUD directed at health professionals (leading to news articles like this one). These tactics have been wildly successful -- now, schools are requiring students to be vaccinated against Chicken Pox as though it were as deadly as measles or whooping cough.

    This despite the fact that your child is more likely to die on the way to the doctor to get the shot, than to die of Chicken Pox.

    My wife is a clinical tech at a major Dallas children's hospital, and the off-the-record opinion among all the health workers there is that the vaccine is nothing but a boondoggle for its manufacturer. Meanwhile, she and the rest of the team are dealing with bugs like MRSA -- Methicillin Resistant Staphylococcus aureus. In fact, this BBC article from last month details the fear that MRSA staph would pick up Vancomycin resistance because of antibiotic overuse.

    Gee... I wonder who stands to gain the most from both the current overuse of antibiotics and from the development of the "next generation" of overprescribed medications?

    --
    Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
  59. obsessive-compulsive by MacAndrew · · Score: 5, Informative

    Not to push you over the edge, but the antibacterial soaps are controversial; many studies show they are little more effective than regular soap. Some contend the antibacterial ingredients can cause problems all their own.

    Most bacteriocides that you'd be willing to put on your skin take a while to work, more time than you'd have the soap on. The most effective treatment is a good scrub, which physically scrapes the bacteria away -- not glamorous but effective. Most of us do a lousy job at handwashing -- it needs to be thorough and repeated during the day, as the bacteria multiply on your skin -- myself included, and I have two of those little disease vectors called "children."

    Only 40% of people wash their hands exiting public restrooms, one study showed (imagine being the data-taker); the problem there being the encouragement of the fecal-oral route of disease transmission from the non-handwasher to others. I'll let you visualize what fecal-oral involves. So be a good citizen and lather up.

    Oh, and the next time the press reports someone getting sick from beef tainted with E. coli, note that "coli" means colon, where these bacteria were discovered. These E. coli come from careless slaughtering practices and, stated frankly, mean that "there's manure in the meat." (quoting the muckraking author of the excellent Fast Food Nation)

    It's a microbe's world after all.

    1. Re:obsessive-compulsive by Zordak · · Score: 1
      Only 40% of people wash their hands exiting public restrooms, one study showed (imagine being the data-taker); the problem there being the encouragement of the fecal-oral route of disease transmission from the non-handwasher to others. I'll let you visualize what fecal-oral involves.
      You do realize that your just ruined my lunch for a week, don't you? And for the record, I always wash my hands thoroughly after using the bathroom, but I wonder if it has really helped as soon as I have to touch the handle to open the door.
      --

      Today's Sesame Street was brought to you by the number e.
    2. Re:obsessive-compulsive by MacAndrew · · Score: 2

      Don't touch the handle. Either trail someone else or use your used paper towel to grab the handle.

      Sorry for any indigestion. :)

    3. Re:obsessive-compulsive by mesocyclone · · Score: 2

      A recent study showed that using isopropyl alcohol hand cleaners is far better than hand washing with antimicrobials.

      --

      The only good weather is bad weather.

    4. Re:obsessive-compulsive by MacAndrew · · Score: 1

      I'd expect that to dry the skin...

      Lately I'm partial to irradiating my hands, but I understand there may be side-effects to that as well. Sigh. (actually, Roengten is said to have given his wife cancer doing this.)

    5. Re:obsessive-compulsive by CharlieG · · Score: 2

      RE not scrubbing LONG enough

      The way I was told by some Microbiologist somewhere (Took a course "back when") was to recite "Twinkle Twinkle Little Star" under your breath - it's about the right length!

      --
      -- 73 de KG2V For the Children - RKBA! "You are what you do when it counts" - the Masso
    6. Re:obsessive-compulsive by canadian_right · · Score: 2

      Fortunately, bacteria hae real hard time growing on stainless steel. So you are likely ok. If paranoid, use a paper towel to open the door.

      --
      Anarchists never rule
    7. Re:obsessive-compulsive by Jeriki · · Score: 1

      You make several good points but lets correct a couple of things: Escherichia coli gets its' name from being a gram-negative bacteria with colonies that grow in a certain shape of cluster that I don't remember right now. And E. coli infections don't come from careless slaughtering practices, the problem is that E. coli doesn't harm cattle the way it harms humans(especially the O1H-57 strain that is so lethal to us) so E. coli can become systemic in a cow without it harming them, so when it's slaughtered the bacteria are already in the muscle.

      --
      -witty .sig
    8. Re:obsessive-compulsive by MacAndrew · · Score: 2

      Completely false. What the Heck is an E. coli ?

      E. coli live in the gut. If they were to become "systemic" in the cow -- even a "friendly" strain --- the cow would likely die.

      It takes careful reading of the USDA or FDA materials to find anything even close to an admission that the problem lies in spreading fecal matter (shit) around during slaughter -- understandable from a beef marketing standpoint, but not consistent with informing the public of the truth. The USDA emphasizes testing, irradition, recalls, cooking .... but not source reduction. Here's as direct as they seem to get:

      "How is E. coli O157:H7 spread?

      The organism can be found on a small number of cattle farms and can live in the intestines of healthy cattle. Meat can become contaminated during slaughter, and organisms can be thoroughly mixed into beef when it is ground."

      CDC (E. Coli)

      The truth shall set you free. But maybe not that cow.

    9. Re:obsessive-compulsive by jafac · · Score: 3

      and I have two of those little disease vectors called "children."

      While I don't think you mean to blame your children, it's really not their fault.

      Last year, my kids were homeschooled, and for that entire year, nobody in my family got sick. Not one cold, not one flu, nothing.

      This year, we've had our kids back in public school, and we've already had one stomach flu and one cold work it's way through. In two short months.

      In previous years, we've had nastiness like chicken pox, measles, and. . . head lice!! All picked up from other kids at public school.

      Why do parents send their sick kids to school so they can infect other kids, and spread diseases to their parents?

      I personally blame the public school system for head lice. They could DO something about that. But with most families having BOTH parents working, kids can't take a sick day without making one of the parents take a sick day. So the parents send the kids to school in most cases, unless the kid's physically unable to prop themselves up in their desk. So mainly, I'm blaming the crappy labor standards that discourage parents from taking sick days for their kids. And I'm blaming crappy "modern industrialism" for eroding wages to the point where two adults MUST work in a family in order to maintain an average standard of living.

      Homeschooling and having my wife stay at home allowed our family incredible freedom, for vacations, etc. But my getting laid off and taking a job where I now make about 2/3 what I was making, changed that situation.

      --

      These are my friends, See how they glisten. See this one shine, how he smiles in the light.
    10. Re:obsessive-compulsive by 3am · · Score: 1

      Not quite.

      It showed that hospital workers were too overworked to take the time to properly wash their hands with soap and water, which takes close to a minute when done properly.

      Their conclusion was that using alcohol-based gel hand cleaners resulted in more efficient health care, because there were fewer secondary infections resulting from poor hygiene.

      See it here:

      http://www.asmusa.org/pcsrc/42icaac/1345.htm

      --

      A: None. The Universe spins the bulb, and the Zen master merely stays out of the way.
    11. Re:obsessive-compulsive by Anonymous Coward · · Score: 0

      I hope you realize that children are supposed to get bacteria from other kids, so their immune system develops. If you get sick from that bacteria, it suggest you didn't get enough exposure when you were kid yourself. And now you're trying to make your kids the same way, to get sick too easily.

      And I bet personal immunological resistance will be far more important in the future, if we indeed are losing the antibiotic war against bacteria, them becoming resistant faster than we can come up with new antibiotics. In that situation it's up to our bodies to be able to keep those resistant bacteria under control.

  60. Parent FUNNY, mod! /nt/ by Anonymous Coward · · Score: 0

    Nope, no text here.

  61. A pessimistic definition of "alive"... by Just+Some+Guy · · Score: 2

    ...is that we're all one breath away from a corpse. Seriously, take a deep breath, hold it, relax, and exhale. Now, don't do it again - ever. See?

    --
    Dewey, what part of this looks like authorities should be involved?
    1. Re:A pessimistic definition of "alive"... by Dr.Dubious+DDQ · · Score: 2

      True. After all, "Health" is merely the slowest possible rate at which one can die... :-)

  62. Dirt is good for you by TamMan2000 · · Score: 5, Interesting

    There is even recent research that even suggests that children exposed to pets (and the inherent uncleanlyness) have lower incidence of asthma and allergies down the road.

    --
    "I'll have a Guinness, no wait, make that a Coors Light" -Grad student I work with, who shall remain anonymous...
    1. Re:Dirt is good for you by kevcol · · Score: 1

      Yes, and I heard that farmers whose livestock doubled as sex partners had lower incidence of... oh nevermind.

  63. Good example of creationist damage by Phil+Karn · · Score: 1, Flamebait

    The development of antibiotic resistance by bacteria is one of the most important examples of evolution in action. Yet when so many people deny the reality of evolution because of religious superstitions, how can they be made to understand the dangers of antibiotic overuse?

  64. cockroaches, Spam , and bacteria by brainboyz · · Score: 1

    You forgot Twinkies!

  65. FYI: Colloidial Silver Not So Good ... by Kostya · · Score: 5, Informative
    Check out this link for some more info. I'm not saying it didn't work for you, but there appears to be heaps of evidence for why you might be a little concerned about regular use. Apparently the US FDA "has concluded that the risk of using silver products exceeds any unsubstantiated benefit."

    And for my own favorite test, just like chiropractric, colloidal silver users make some wide, sweeping, and exagerated claims for what silver "can cure". I mean crap, that's a huge list of things it will cure or alleviate. You just have to wonder when you see that many claims of a miracle medicine/tonic.

    --
    "Doubt your doubts and believe your beliefs." -- Switchfoot, Ode to Chin
    1. Re:FYI: Colloidial Silver Not So Good ... by Mike+Monett · · Score: 1
      Sorry, your post has so much misinformation I just have to comment.

      • Check out this link [quackwatch.org] for some more info.

      Stephen Barrett is a master of fud and misdirection. He confuses you by citing references to silver compounds, which are not the same as colloidal silver.

      He claims we do not know the concentration of silver needed to cause Argyria. He states "The amount of silver required to produce argyria is unknown." He is a doctor. He knows this is not true.

      See the links at the bottom of my web page at http://www.geocities.com/mrmonett/shingles/0shin.h tm The concentration of silver needed to cause Argyria is well known, and is far more than can be obtained by drinking colloidal silver.

      Barrett adds information on undocumented tests showing commercially-purchased collidal silver may be contaminated or contain no silver. This may or may not be true, but why buy it when you can make it so easily?

      • I'm not saying it didn't work for you, but there appears to be heaps of evidence for why you might be a little concerned about regular use.

      Millions of people take colloidal silver each day. There is no documented case of ill effect, except perhaps herxheimer, which is the toxic effect of killing off large numbers of harmful bacteria.

      • Apparently the US FDA "has concluded that the risk of using silver products exceeds any unsubstantiated benefit." [nih.gov]

      More misdirection. Silver compounds such as silver nitrate and silver protein can have much larger concentration of elemental silver, which can cause Argyria. These have nothing to do with colloidal silver, which is a completely different substance. The EPA has no record of anyone being harmed by taking colloidal silver. See the links at the bottom of my web page for the EPA response to a request through the Freedom of Information Act.

      • And for my own favorite test, just like chiropractric, colloidal silver users make some wide, sweeping, and exagerated claims [colloidal-silver.com] for what silver "can cure". I mean crap, that's a huge list of things it will cure or alleviate. You just have to wonder when you see that many claims of a miracle medicine/tonic.

      These are not claims made by vendors. These are testimonials made by people just like you and me. They tried it and report the results. They have nothing to sell.

      Colloidal silver works. We cannot say the same of the drugs the pharmaceutical industry wants us to buy.

      Good evening!

      Michael R. Monett
  66. Why not simply perscribe 2 or more antibiotics? by dsanfte · · Score: 2, Insightful

    I see people on one antibiotic, say Vancomycin, and the germs becoming resistant to them. Well, why not just perscribe 2 or 3 different antibiotics? That way if BacteriaA develops a resistance to AntibioticA, AntibioticB and C are still around to kill it, and thus it does not survive.

    With one antibiotic, developing resistance is almost a certainty. With three or more antibiotics, the odds of a pathogen developing a resistance to all three at once must be nearly impossible.

    Why is this not done?

    --
    occultae nullus est respectus musicae - originally a Greek proverb
    1. Re:Why not simply perscribe 2 or more antibiotics? by drmike0099 · · Score: 3, Insightful

      This is generally a bad idea, although it's used in some really serious infections if it's required (like endocarditis) if the antibiotics have a synergistic effect.

      Contrary to what is apparently popular belief, antibiotics are not all nice and can be taken whenever you feel like it. Antibiotics can cause some of the most hideous allergic-type responses of anything on earth (like Stevens-Johnson syndrome) that are often fatal. This is pretty rare but not as rare as we'd like, and there's no way to predict when it will happen, since it can happen to you even if you've taken that medication before without a problem.

      The real answer to this lies with the consumer. Don't come to the doctor and want antibiotics. In the majority of cases of upper respiratory infections, diarrhea, and other problems, antibiotics are useless. It's the subtle (and sometimes not-so-subtle) demands for antibiotics that make docs give antibiotics to patients in the first place rather than spend another 10 minutes explaining to a progressively more angry patient why the doctor won't "give them something to make them feel better."

    2. Re:Why not simply perscribe 2 or more antibiotics? by numark · · Score: 1

      I don't even want to think of the toxicity that would be involved in a regimen like that. You'll never be able to kill all bacteria. Resistant strains will survive. What's the point of mixing three antibiotics, each with specific rare toxicities, and then put them together without knowing how they react? The answer isn't more antibiotics. It's educating people that viruses are immune to antibiotics, and simple infections don't need a course of antibiotics to heal. The human immune system is an amazing machine, and it will preserve life. There's no need to muck around with it for a day or two of quicker relief.

      --
      Want Slashdot headlines on your site? Try SlashHead
  67. Re:Geeks outliving everybody else? think again! by Anonymous Coward · · Score: 0

    Just remember that scientists have researched that there are more than 4000 germs on a typical office keyboard. That's more than in a toilet!

  68. Mod parent up by Anonymous Coward · · Score: 0

    This is an EXCELLENT IDEA.

    1. Re:Mod parent up by Big_Breaker · · Score: 1

      That would be fine if people were willing to isolate themselves when taking antibiotics. Because no one would want to do that for strep throat doctors prescribe a single common anti-biotic that shows promise in the petri dish.

      If people took a cocktail of antibiotics for every sniffle we would find the super bug very fast.

      Not only would the super bug have no "bacterial competition" in the host to slow its proliferation but any transmition of bacteria would have a very high likelihood of being from the superbug strain.

      Basically its good to crowd out weak resistant bugs with stronger vulnerable ones.

      Cocktails are a Bad Bad idea for the general public.

  69. Argyria: I'm blue, ab a dee ab a dye... by RobertB-DC · · Score: 4, Informative

    Hey, great plugs for "Colloidial Silver". It's natural, right? And anything natural must be a Good Thing, right?

    Yeah, kinda like Hemlock is natural.

    Check out these links before you hit the natural foods store:

    Rosemary Jacob's Argyria Pages -- her skin is a fetching shade of blue-grey, somewhat like the robot on Futurama.

    Politician turns blue from drinking 'health' solution -- the Libertarian US Senate candidate from Montana would have had the distinction, if elected, of being the only Blue member of Congress. (I'm a Green, myself).

    --
    Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
  70. Detroit. by Anonymous Coward · · Score: 0, Redundant

    Nuke the site from orbit! It's the only way to be sure !

  71. You *have* to be joking by Kostya · · Score: 3, Interesting
    Listen, creationist may be a pain, but you aren't seriously blaming the rise in AB resistant bacteria strains on the creationist dogma, are you?

    Don't be an idiot. Where's the evidence (real or anecdotal) that the average guy who doesn't finish his antibiotics says to himself, "Well, golly, since evolution is just atheist propoganda, there is no reason for me to fear antibiotic resistance developing in bacteria--THEREFORE, I will now stop taking my antibiotic regime."

    Don't be stupid.

    --
    "Doubt your doubts and believe your beliefs." -- Switchfoot, Ode to Chin
    1. Re:You *have* to be joking by metachimp · · Score: 1

      The creationist's faith in the healing power of the Holy Spirit (TM) should preclude their using antibiotics altogether.

      Oh wait, I forgot. Bible thumpers are only anti-science when it furthers their theocratic agenda.

      --
      The system has failed you, don't fail yourself. --Billy Bragg
    2. Re:You *have* to be joking by Cro+Magnon · · Score: 2

      Actually, SOME Bible thumpers ARE against certain medical treatments. Jehovah's Witnesses are against blood transfusions.

      --
      Slow down, cowboy! It has been 4 hours since you last posted. You must wait another few hours.
    3. Re:You *have* to be joking by metachimp · · Score: 1

      I wish they all were. There would be less of them to bother us sensible people

      --
      The system has failed you, don't fail yourself. --Billy Bragg
    4. Re:You *have* to be joking by Phil+Karn · · Score: 2
      No, I'm perfectly serious. Medical researchers have been trying for decades to get the message out to the public and their representatives about the consequences of antibiotic misuse and overuse. But the only way they can explain their warnings is to invoke basic evolutionary principles.

      Only evolution clearly explains how and why the widespread use of antibiotics causes the development of antibiotic-resistant strains of bacteria: the presence of an antibiotic causes natural selection to begin selecting for strains of bacteria that are resistant to that antibiotic. Pretty soon that antibiotic stops working.

      But as soon as most people (and legislators) hear the "e-word", they stop listening. They know (because their preachers have said so) that evolution is a wicked falsity concocted by a bunch of atheistic scientists. So if the scientists have to invoke evolution to argue for more selective antibiotic use, then their warnings are obviously bogus!

      This is just one example of how widespread scientific illiteracy seriously affects public policy. We all lose.

  72. Like allergies by phorm · · Score: 5, Interesting

    Sometimes this works backwards, but I used to have some really bad allergies to animals: cat fur, feathers, etc.
    After toughing it out in clean fresh air, coupled with visits to the chickens in the barn, etc, most of my animal allergies went away. I was still allergic to cats, but got rid of that after we got three of the shedding creatures.
    In reverse cases, sometimes the allergies chip away at the immune system, causing gradually increasing sickness. But in most cases I've heard of, low exposure over time builds tolerence.

    *Note: That's low exposure, stuffing a kid with allergies in a house of 50 cats is probably not recommended in the short run...

    1. Re:Like allergies by Anonymous Coward · · Score: 0

      Your own case may be more due to the attitude and otherwise cleaner environment than exposure treatment. I know only one similar experience, and the guy also moved to the cleanest part of Finland and tried very hard to get rid of his allergy.
      I, on the other hand, got my allergy through overexposure to some plants that cause allergy. Staying away from them for ten years has lessened the problem to mere occasional sneezing.

      I would also discourage exposure treatment in general. Research that children with animals have less allergies, is most likely faulty. Families who have children with allergies, have less animals. This is the real causal relationship.

    2. Re:Like allergies by Grizzlysmit · · Score: 1

      Yup it's all about balance but, too little hygiene and you get real sick, but go the modern Paranoia route and big problems. But allergies can be far more complex, especially if their real bad like is the case with me.

      --
      in my life God comes first.... but Linux is pretty high after that :-D
      Francis Smit
    3. Re:Like allergies by phorm · · Score: 1

      A lot of it is about dosage. It seems that a lot of the allergy shots that they give kids are mostly like vaccines, dead or miniscules samples of a substance that they are allergic to, to build an immunity.

      Cats and dogs, etc I got over. But one summer during burning season I inhaled a bunch of sagebrush smoke (myself being allergic to sage/sagebrush) and had hives and shakes for 3 months. I take that same stuff in the shots, but it's a whole lot less dosage and spread over more time. Inhaling an allergen in smoke form into one's lungs, not good...

    4. Re:Like allergies by iabervon · · Score: 2

      Whether you get an allergic reaction depends (in my experience, at least), on the total quantity of allergens you're being exposed to, compared to the quantity you're usually exposed to. So constant exposure will improve your tolerance, but extra exposure at a particular time will make you sick. And if you're exposed to something during the night but not during the day, you can get a reaction every night.

      It makes a lot of sense, actually. It's a feedback system for responding to unusual situations while adapting to different normal conditions, sort of like just about everything in nature.

    5. Re:Like allergies by Anonymous Coward · · Score: 0

      Here is an interesting fact. Societies with low rates of pathegenic diseases / parasites have rampant allergy problems. Societies with rampant parastitc/pathogenic problems have extremely low rates of allergies.

      Now, I suffered from SEVERE allergies (and asthma) as a kid. I made a choice when I was fifteen. I chose pathogens and parasites. The right pathogens made my colon happy, and the right parasites made me healthy.

      Since purposely populating my body with 'parasites' my allergies have ALL gone and I have not had an asthmatic attack since 1984.

  73. heroine v. heroin by MORTAR_COMBAT! · · Score: 2

    If that heroine is Sarah Michelle-Gellar as Buffy, count me in as an addicted user.

    However, heroin involves sticking a needle into my arm. Not going to freaking happen.

    --
    MORTAR COMBAT!
    1. Re:heroine v. heroin by Anonymous Coward · · Score: 0

      SMG? Yeeechkk!

    2. Re:heroine v. heroin by Anonymous Coward · · Score: 0

      Yeah, Alyson Hannigan (Willow) is much better. SMG has a weird nose and is overrated.

    3. Re:heroine v. heroin by MORTAR_COMBAT! · · Score: 2

      I complete agree that Willow is much better. However, SMG is the "heroine" of the show, and thus my not-so-clever treatment of the "heroine v. heroin" would not have been as valid.

      --
      MORTAR COMBAT!
  74. MRSA actually means.. by chazR · · Score: 5, Interesting

    (Completely agree with parent post, minor correction, then rant)

    MRSA actually means Methicillin Resistant Staphylococcus Aureus.

    Now we have VRSA. Vancomycin Resistant Staphyloccocus Aureus.

    There are no "wonder drugs" in the pipeline. We're reaching the end of the road for antibiotics. It won't be sudden, but it will happen.

    Many diseases we currently think of as relatively trivial are going to become real killers again. Millions of people are going to die.

    It won't be the young, fit and healthy as much as the very young and the very old.

    But let's keep feeding the antibiotics to farm animals. It makes them more profitable. Got a slight viral cold? Demand antibiotics. It's your right.

    It's the tragedy of the commons again.

    Crazy question for microbiologists: Is it possible that resistance to a specific antibiotic costs an organism enough that it could no longer out-compete it's non-resistant cousins? Would it be worth infecting someone who has a resistant strain with a non-resistant strain in the hope that the non-resistant one will 'win'? Then, (if the patient still lives), treat that with antibiotics?

    Or are you going to get so much genetic transfer that it's worse than dangerous?

    1. Re:MRSA actually means.. by EchoMirage · · Score: 2

      Now we have VRSA. Vancomycin Resistant Staphyloccocus Aureus.

      Okay, this freaks me out; Patients have to be given Vancomycin via a catheter, because if they give it to you through a regular IV line, it can destroy the veins in your arms because it's so powerful. As I understand it, it's kind of like pumping Clorox into your veins to kill the staph.

      If there's a strain of staph that's immune to Vancomycin now, well...eek, that's absolutely terrifying.

    2. Re:MRSA actually means.. by mrpastry · · Score: 2, Informative
      Crazy question for microbiologists: Is it possible that resistance to a specific antibiotic costs an organism enough that it could no longer out-compete it's non-resistant cousins? Would it be worth infecting someone who has a resistant strain with a non-resistant strain in the hope that the non-resistant one will 'win'? Then, (if the patient still lives), treat that with antibiotics?

      Similar things have been done. Since most staph usually just colonize patients' noses rather than causing infections, you can block transmission by deliberately implanting relatively a-virulent strains in patients' noses. This was done buy a microbiologist called Shinefield in a series of experiments in neonatal units in the 50s and 60s. Another approach is to use viruses that target bacteria but not human cells. This has been used a lot in the former Soviet Union, and there's a good bit of research now going on into such methods in the West. It is certainly possibly that resistance costs will lead to drug-sensitive strains winning out in the long run if the antibiotic selective pressure is withdrawn. However, it really would be pretty crazy to deliberately cause an infection (rather than just colonization) in a patient with a second virulent bug.

    3. Re:MRSA actually means.. by Belgand · · Score: 2

      Off-hand I'd say it would be more dangerous due to the level of gene transfer involved. The possibility that the resitant strains manage to crowd out the non-resistant seems far less likely to me. Then again, I'm merely a microbiology undergrad and I tend to focus more or molecular genetics than pathogenic microbiology, but I've had at least one dedicated pathogenic course.

    4. Re:MRSA actually means.. by NilesDonegan · · Score: 2, Informative

      There are definitely examples where an antibiotic-resistant strain is less fit than its wild-type strain in an antibiotic free setting. However, it seems that there are many more examples where the bugs just keep holding onto the resistance genes for decades, even when the antibiotics are no longer prescribed. So while it may be theoretically possible to infect someone with a more fit, less resistant strain, you'd probably kill the person due to the shock induced by the immune system reacting to so amy new bacteria.

      There's this beautiful study done by a fellow in Florida where he's created a new strain of Streptococcus mutans (the critter that causes the majority of cavities) that kills its cousins (other S. mutans without the resistance gene) and also doesn't acidify your mouth. The end result is that a bad Strep is pushed out (so to speak) of your mouth by a good, non-cavity forming, Strep. It's going to be marketed in about 5 years like the fluoride rinses that you get at the dentist - only this time, no cavities for life!

      And one more thing about preventative bacteria - probiotics as well as the indigenous flora in your body. Many pathogenic bacteria have a tough time competing/establishing a flagella-hold in a normal setting due to the presence of pre-existing, normal (i.e. non-pathogenic) bacteria. However, if you take antibiotics that are broad-spectrum (i.e. CIPRO (damnit!!!)), you can wipe out the good bacteria, allowing the bad bacteria to establish and cause lots of problems. So don't self-medicate!

    5. Re:MRSA actually means.. by Silvermask · · Score: 1

      Something you said reminded me of an article I read once (which I can't really find now). It was written by someone who contracted a highly resistant "superbug" while in the hospital.

      In a nutshell, it said that so-called "superbugs", while being strong against antibiotics, have quite weak defenses against other bacteria, fungi, and viri. The fact that he was already on antibiotics and the hospital was a pretty sterile environment would explain why he would have so few natural benign or not-too-harmful microbes in his system.

      He then mentions that his doctor basically told him to go home, go outside in the fresh air and sunshine, and more or less roll around in the dirt, which would expose him to plenty of "regular germs" which would push out the "superbug".

      Granted, this article was on a rather closed-minded, high-and-mighty, conservative Christian creationist site, so I don't know how medically accurate it is. (While I am in fact a Christian and a creationist, I was still put off by the fact that they were ever-so-self-righteous)

      But, the theory does make sense. As far as I know, it's generally seen that people (some people in particular) are more susceptible to the candida mold (responsable for oral thrush and yeast infections, if I'm not mistaken) when on antibiotics, because the antibiotics kill the bacteria that are the natural enemy of the fungi.

      Insert standard medical disclaimer here. Don't go and play in the mud without asking your doctor first ;-P

      ~Silvermask

      --

      "Wild nights are my glory"
    6. Re:MRSA actually means.. by cbnewman · · Score: 1

      Red Man Syndrome (which can lead to vascular collapse and death) is caused by IV infusion that is too fast. Impurities in the preparation also contribute to the vascular effects (probably histamine mediated). Note: this is not an allergy to vancomycin! Slow IV infusion (1000 mg per hour) with high purity vancomycin greatly reduce the incidence of adverse effects.

    7. Re:MRSA actually means.. by rosewood · · Score: 2

      You can see this on a smaller scale

      Ever notice how a lot of people that dont get out and play and get exposed to germs and scrapes and bruises etc. as a child become very delicate adults?

      Also, look at the history of Polio. It was when we cleaned up the streets that the outbreaks occured.

    8. Re:MRSA actually means.. by Anonymous Coward · · Score: 0

      Vancomycin is impressively toxic stuff. One reason that the research pipeline for broad-spectrum antibiotics was allowed to become empty is that it was generally accepted that there was no way to develop a Vancomycin resistance. That it happened is a tribute to the incredible adaptability of the bugs.

    9. Re:MRSA actually means.. by Anonymous Coward · · Score: 0

      >Crazy question for microbiologists:
      Just a biologist.

      >that resistance to a specific antibiotic costs an >organism enough that it could no longer >out-compete it's non-resistant cousins?
      I do not think so, the costs once a gene encoding for a protein causing resistance exsists, it can be turned on/off at need. The so called 'genetic load' of one gene is neglible under normal circumstances.

      >be worth infecting someone who has a resistant >strain with a non-resistant strain in the hope >that the non-resistant one will 'win'? Then, (if >the patient still lives), treat that with >antibiotics?
      I doubt the patient still lives, and also, as I said, the outcompeting is not likely to work, in addition 1 left over resistant gene will spread like hell over all bacteria once you actually give the antibiotic (because the stress induced by the stuff is likely to induce the conjugating of bacteria and exchange their (resistance) genes.

    10. Re:MRSA actually means.. by Grizzlysmit · · Score: 1
      We're reaching the end of the road for antibiotics. It won't be sudden, but it will happen.

      We don't actually know that, we may yet find heeps more due to some new break through, BUT we'd be FOOLS to BANK on that! Still I'm sure we will find other ways, perhaps using natural enemies of the bugs etc, like we've done with controling pest species, in the macro world, it'll be challenging but we know heeps more about it all than we did before penicillin.

      --
      in my life God comes first.... but Linux is pretty high after that :-D
      Francis Smit
  75. Re:A grain of salt except in sterial enviroment! by plugger · · Score: 1

    Staph is found in the general poulation. A significant proportion of us are carriers. So please, wash your hands after you pick your nose :)

  76. Re:A grain of salt except in sterial enviroment! by proteinaceous · · Score: 1

    > Staph is a normally not seen in the general poplution.

    Actually, S. aureus is fairly common in the general population. It is often found on the skin and hair and in nasal passages. Generally, it becomes a problem if it gets into the bloodstream.

  77. wrong by blach · · Score: 1

    It is Staph, not Staff. I hope you were joking.

  78. numbers and sense by MacAndrew · · Score: 2

    Read even more slowly. The article says:

    Staph aureus is a common pathogen that infects about 400,000 U.S. hospital patients a year. About one-quarter of them die. For decades, scientists have been dreading -- but expecting -- a staph aureus strain to emerge that is resistant to vancomycin.

    This means that "common pathogen" staph, not a super strain that the article is supposedly about, kills 100,000 people already weakened enough by something else (it is implied they're hospital patients when infected). This is nothing new, and it's certainly not the "dreaded" strain of antibiotic-resistant bacteria doing the damage. The current death rate certainly illustrates that infections and hospitals can be dangerous to vulnerable persons, but it doesn't belong in this story.

    The presentation is confusing, out of carelessness or a desire to pump up the story.

  79. Of course by tswinzig · · Score: 2

    But then you need bacteriophagephage to kill the phage.

    --

    "And like that ... he's gone."
    1. Re:Of course by Anonymous Coward · · Score: 0

      And then bacteriophagephagephage to eat the bacteriophagephage.

  80. Inevitable, worryingly by salimma · · Score: 4, Insightful

    The hospital that my father works in has had similar cases in the past: infections that would only respond to the latest antibiotics.

    This is rather worrying, especially when you think that the main cause of all this resistance buildup is GPs prescribing antibiotics copiously (at the behest of patients, true, but what's wrong with giving placebos? Probably will get them lawsuits for misleading the patients, hmm) and commercial farming where antibiotics are used liberally to stock up the animals..

    --
    Michel
    Fedora Project Contribut
  81. uncertainity principal prevents this by Indy1 · · Score: 2, Insightful

    what your suggesting was proposed by a French scientist a few hundred years ago by the name of Laplace. It is usually referred to as Scientific Determinism. However, modern quantum mechanics theory and the uncertanitity pricipal have shown that it is not possible to predict everything in the universe to the degree of precision that Laplace had hoped for.

    --
    Lawyers, MBA's, RIAA? A jedi fears not these things!
  82. matter of opinion and use, IMO by zogger · · Score: 2

    --hmm, seems I made a point about not scarfing down gallons of it in the original post. I use it externally, and as a mouthwash/rinse with some salt stirred in. works great for me for that purpose as well. Took care of a tooth infection deal I had when the 40$ prescription stuff didn't phase it. I think I tried swallowing some straight twice or thrice but not beyond that, just for the taste and to feel it. zip, tastes like water.. If faced with like a biowarfare attack scenario, with nothing else, I plan on trying it should I get infected. Not counting on uncle sugar to have remedies for warsaw pact turbocharged and blended biowarfare cooties. I look at it as a "whut the heck" deal in a case like that, similar to these people now who are being treated by being basically stared at.

    Like, cut me some slack that the shots for civvie smallpox will be effective against weaponised.

    With that said, let the people with advanced SA rot, rather have them rot away then perhaps turn blue colored, right? Me, I still got a big chunk gone in my leg from the stuff, had I known about CS back then I SURELY would have tried it on it, heck, tried everything else they had at the time, I mean everything.

    And why do they use silver in drinking water filters and some of the newer better quality swimming pool water filters?

    Don't know, not a chemist, maybe someone noted it worked. Maybe size of dose has something to do with it, and size of particle suspended. No idea. will say it works better on external infections than anything I ever saw or used. And fast too, and seems to help with scarring problems. Of course at 2 cents a gallon to make it, I can't see any big companies falling over themselves to "prescribe" it or "recommend it" to doctors. I sorta have they impression they dig on the 40$ a pill stuff more, just a hunch, but something I've noticed the past several decades.

    And would they stoop to an "anti missile" propoganda defense on the ole intarweb? Naw, why would they do that to protect their 200 billion business, generally speaking?

    Internally, no idea. I think taking large doses of anything is usually a bad idea, just because something is sold from the pharmco and is manufactured by some large konzern doesn't mean it is either safe, nor even effective. Was just reading about lariam for instance. Gee, gimme some of that stuff-not!

    Remember , always trust official doctors and government spokes persons, they never tell whoppers, like about agent orange and dioxin (safe as mother's milk) or gulf war syndrome (it's all in your head) or thalidomide (here, take this for motion sickness, it's safe), or lately the lariam for malaria.

    Sure, they never lie about anything, they got 100% verified track record of being scrupulously honest. They've never lied to protect big business profits, never. (anthrax shots in the military)

    I'm only relating my anecdotal, to each their own. I avoid quack stuff too, just I don't pick and choose one "side" or the other, that's just denying yourself data, and it falls into the lame category.

  83. the above-mentioned article by H0NGK0NGPH00EY · · Score: 1

    Google.

    Whew. That was hard.

    --
    Do not read this sig.
  84. Grapefruit Seed Extract - the natural alternative by FireHorse · · Score: 3, Informative

    The latest all natural fad being used as an anti-microbial is "Grapefruit Seed Extract" (commonly called GSE).

    I discovered it when it was recommended to me for a nasty GI virus that wouldn't go away by normal starvation. Killed the sucker right off. As a nursing student I will be trying to bring this into any hospital I eventually work for.

    Hopefully, and I don't see why not, it will work against antibiotic resistant bacteria and viruses.

    A good overview

    Here's a good summary from another site:

    Grapefruit seed extract is derived from the bioflavonoids found in the seed and pulp. Its anti-germicide action has shown a growth-inhibiting effect on bacteria, fungi, parasites, and viruses in several in vitro studies. The effectiveness of grapefruit seeds was discovered accidentally by a doctor, who noticed that the seeds did not decompose in his compost file. Further examination revealed that the grapefruit seeds killed any microorganism that tried to decompose it. Laboratory studies have shown it to be effective in inhibiting bacteria such as Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. Grapefruit seed extract has been formulated by a number of manufacturers for various uses, including an internal bactericide, water disinfectant, skin cleanser, and first-aid spray. Grapefruit seed extract is also a treatment for house pets and livestock that may be susceptible to bacterial infections from a variety of sources.

  85. So then both, actually by error0x100 · · Score: 1

    The surviving bacteria swapped genes from another organism, thus "evolving" to allow them to survive, while the rest of them (quite probably the majority) did not, and died. However, the one(s) that remained, with the resistance, multiplied. Sounds like both to me.

  86. How HIV works by blach · · Score: 1

    Hi, let me go ahead and clear up something that someone else was wondering, and about which you seem to be a little confused.

    HIV is the Human Immunodeficiency Virus. It is the virus that causes AIDS, which is Aquired Immune Deficiency Syndrome. A Syndrome, in medical parlance, is a group of symptoms that occur together. So AIDS is a condition, caused by the virus HIV.

    Anyway, now on to the show. The reason HIV is so hard to destroy is that unlike most lifeforms, when it makes a copy of itself, it makes an "error" FAR more frequently than in, e.g., our cells. That is, HIV's reverse transcriptase makes an error something like 1/1000 base pairs copied, which is why we cant make a molecule to specifically attack HIV .. because it changes so much.

    Theoretically it could indeed become airborne, but, as another poster suggested, I don't know if a) it already is and b) if so, or when, how many ppm / particles / whatever it will take to get someone with a normal immune system sick.

    Cheers!
    James
    Certified Dork

  87. Not quite. by wilgamesh · · Score: 4, Informative

    Multiple anbitiotic resistance in bacteria is documented. I can refer you to a brief article which shows that the med community is aware of it.

    * Tenover FC, Hughes JM. The challenges of emerging infectious diseases: development and spread of multiply-resistant bacterial pathogens. Journal of the American Medical Association 1996;275:300-304.

    Also, we can consider this from two points of view and see why it's reasonable:

    1.) bacteria can transfer genes from one to another by plasmid - a plasmid is a small circle of DNA that's not part of the bacterial genome. so one plasmid can code for resistance to antibiotic A, and another plasmid can code for resistance to antibiotic B. this modularity just from the molecular biology of bacteria makes bacteria well-equipped to deal with multiple assaults. a bacteria doesn't have to independently develop resistance, it can acquire it easily from another bacteria, mix and match etc.

    2.) the nature of darwinian selection of the survivalists means that, while it is *unlikely* for any particular bacteria for develop resistance, *once* it does develop resistance, then it will likely survive and multiply under heavy antibiotic environments.

  88. Just had a positive TB test as well. by Anonymous Coward · · Score: 0

    Last month I had a nasty respiratory infection (coughing up blood, night sweats, etc...) so my doc tested me for TB. The skin test was positive but my sputum tests were negative and Amoxycillin cleared it up. There was a spot in one of my lungs, but he hasn't prescribed INH. Do ou know they prescribe it to everyone with an inactive infection, or just those considered to be at risk for becoming active? If the side effects are nasty, I'm not sure I want to take it since only 5% of those infected ever develop active TB.

    I am a bit pissed-off that I've been infected. I live in a city with a lot of street people and immigrants. I used to have a real liberal attitude towards both but this experience has made me reconsider my opinions. If we don't either do something to cure these third world health problems or close our borders and kick the bums off of the street, all of those old diseases are going to come back to haunt us.

    1. Re:Just had a positive TB test as well. by Anonymous Coward · · Score: 0

      Fuck you nazi.

    2. Re:Just had a positive TB test as well. by ackthpt · · Score: 1
      It was prescribed because within two years I went from negative to positive. It's not really so bad, I just have to cut back on beer and watch a few things. I had a reaction on Friday night and it scared the heck out of me. The main concern is that TB is very difficult to kill, partially because the body's defense it to trap it. That means it could reside, quietly for decades then come out when I'm 70+ and have a bad bronchial infection. BOOM!

      By and large I don't worry much. There's worse things, and I've lived through one of them. Eat well, exercise, get rest and you're probably pretty safe. People who get TB and die generally live in shitty conditions and have poor diets.

      --

      A feeling of having made the same mistake before: Deja Foobar
  89. DAVE THOMAS ASSASINATED BY RONALD by Anonymous Coward · · Score: -1, Troll

    according to the Clown Postulats, MCD's mascot is an evil being.

  90. DNA Exchange between bacteria by Guppy · · Score: 2

    "It's not so much 'theft' as 'mating'. . .gene exchange is just one method by which bacteria maintain genetic diversity."

    While some kinds of bacteria will exchange DNA through a process similar to mating (called conjugation, no less), others can pick up DNA from dead bacteria (micronecrophilia? :) ), bacteria species not their own, and even stray bits of DNA floating in the environment.

  91. After Intervention: Long term planning. by wilgamesh · · Score: 2, Interesting

    Aside from increasing awareness of antibiotic resistant bacteria (ARB), and increasing intervention efforts, the big questions that should elicit the most worry are:

    1.) whether intervention, by diminishing use of antibiotics will be _effective_?

    2.) And what is the timescale in which we'll see our intervention efforts start to work?

    Regarding 2., I mean to ask, how long will it take before the ARB begin to go away and be replaced by normal bacteria? If it's quick, then we should not be so worried. And that would be a silver lining for those who are thinking of tackling this problem. If it takes a very long time, then we should worry more.

    And even more importantly, for the long-term planning people

    3.) Once ARB have been reduced in bacterial populations, how easy is it for bacteria to acquire resistance again?

    For answering 3., unfortunately, it's probably _not_ the same as bacteria acquiring resistance for the first time. From the molecular biology of antibiotics and bacteria, we know some antibiotic resistance genes are placed onto plasmids. Plasmids are separate from the bacteria. They are small, modular pieces of DNA that can encode resistance. Once you develop resistance, you can keep or pass these plasmids around until needed. Even if resistant bacteria die, the plasmids may still remain in existence. Thus the molecular biology of bacteria tells us we should consider these things to fully understand our intervention efforts.

    We are uncertain, I believe, of the evolutionary time scales of all these events. (except for the one telling us how long it takes for antibiotic resistance to develop!)

  92. (OT) Willow? by yerricde · · Score: 1

    Yeah, Alyson Hannigan (Willow) is much better.

    I could have sworn Willow was a man, a midget, played by Warwick Davis.

    --
    Will I retire or break 10K?
  93. Next time you go to the dot-org pavillion at LWCE. by kevcol · · Score: 2, Funny

    Don't let Malda sneeze near you:

    Staph aureus can live innocuously in the nose of a healthy person. About 5 to 10 percent of Michiganders have it and don't know it, said William Brown, a Wayne State University pathology professor.

  94. Theft? More like hot SEX. by yerricde · · Score: 1

    gene exchange is just one method by which bacteria maintain genetic diversity.

    Genes are software. Thus, bacterial conjugation is a form of software exchange, or "SEX" for short. Or is it piracy?

    --
    Will I retire or break 10K?
  95. Weaponized? by almightyjustin · · Score: 2, Insightful

    Not that bacterial resistance isn't bad enough by itself, but I think it's not inconceivable that "superbugs" resistant to everything at once could be created intentionally as biological weapons...that would be fun...

    --

    Omnes arx vestrum sunt adiuncta nobis.

  96. Antibacterial != Antibiotic by Anonymous Coward · · Score: 2, Informative

    Triclosan is not an antibiotic. Antibiotics such as vancomycin are a mold. Triclosan is a chemical.

    Despite very wide use, so far no one has discovered organisms developing resistance to triclosan. Which is not to say it can't happen, but so far it seems ok. Furthermore, triclosan is not something you can use to fight infection, so medically speaking it is irrelevant anyway.

    If there is a problem with triclosan, it is that people could be exposed to abnormally few bacteria, and that perhaps this could weaken the development of the immune system (or something).

    Personally, I doubt that bacteria will develop a resistance to triclosan. It would probably be about as difficult as developing a resistance to alcohol, which is apparently pretty much impossible for the poor little bacteria. Too bad for them.

  97. The really scarey bug by Bruce+Losis · · Score: 1

    S. aureus is scarey, sure, but really only if you are already sick or immunocompromised. The really scarey bug, one that was almost under control until relatively recently is Tuberculosis .

    There are a number of MDR Tuberculosis strains (many originating in the former USSR, but also in the drug ghettos of New York).

    The difference between S. aureus and Tuberculosis from the point of view of community health is that to get consumption (from an epidemiological point of view), all you need is to live in high density housing in an area where Tuberculosis is present. The advent of MDR strains makes the likelihood of an infected individual being nearby higher and the possibility of treatment less (already difficult with 6 month courses of antibiotics being the norm for standard strains - the main cause of MDR appearance seems to be drug users going off courses and poor hospitals in old Soviet backwaters).

    There's just so much to look forward to!

    --
    Don't believe the nonsense, unless you hear it from me directly.
  98. Drug Resistance Biotics by yoink! · · Score: 2

    My father, a physician and microbiologist, has had to deal with many resistant biological organisms as of late. He is an vocal opponent of prescribing antibiotics for every little sign of illness, something that has become all too common these days. We often forget how much easier it is for small organisms with low, or single cell counts to adapt to change.

    Another one of my friends recently got a job doing biological analysis of airborne organisms in one of Montreal's biggest hospitals and has found a surprising number of drug-resistant bacteria.

    Unfortunately it's something we'll have to live with, and for the drug companies it's a gold mine. They can charge whatever the market will pay for the latest designer anti-biotic. In the end, and as with many things, we will suffer for the excesses of the past, but we can affect a change. It's all in attitude. OpenSource drug companies... now that's wishful thinking.

  99. uncertainity overridden by omnicience by sheWhoWalksWithToesL · · Score: 1
    ..Because if God is REALLY the all-powerful being that we believe him to be, it follows that He knows all about everything we know, and even more, which we are still endeavoring to discover. Just because we have the Heisenburg Uncertainty Principle doesn't mean that God doesn't know what will happen anyway based His knowledge of more explicit and elegant laws of nature.

    The question was previously posted about whether God knows everything that will happen or whether we have free will. My answer to that is that we are spirit children of God, and just as a parent knows the faults and virtues of each of their children, God knows how each of us will act in a given situation, because He knows us. He is also kind enough to let us do what we want to do, because He wanted us to learn by our own experience. But because He must be a just God too, He allows us to experience the consequences of our actions, good and bad. This is a big topic, so I can only be brief.

    I personally believe that Creationism and Evolution are pretty much the same thing, but one theory leaves God completely out of it. There is no reason why the period of a day in the Bible has to be 24 hours long, just like the expression of doing something "in the 11th hour" doesn't necessary mean it was done at 11 o'clock or that it was an hour long. Just as "in the 11th hour" implies preparatory action taken just before it was too late, perhaps a day out of the week of creation was an age of working on a particular stage until it was done. How would a timeless God describe creation to a mortal?

    --
    -SheWhoWalksWithToesLikeCobras Please enter any 11-digit prime number to continue...
    1. Re:uncertainity overridden by omnicience by junkgrep · · Score: 2

      ---He is also kind enough to let us do what we want to do, because He wanted us to learn by our own experience.---

      This doesn't make any sense of "free will" unfortunately. "What we want to do" and how we "learn by our experience" is pre-determined also, whether we are "spiritual" or not. Simply calling something "spiritual" doesn't solve the problem that choices cannot preceed the nature of the chooser, and it was either god or random chance that determined that nature.

      ---I personally believe that Creationism and Evolution are pretty much the same thing, but one theory leaves God completely out of it.---

      How so: one requires an intelligence to work, the other gets along fine without one. They're very different sorts of explanations, and the latter doesn't have the problem of circular explanation (i.e., to explain the origin of intellient beings, you must first posit the existence of an intelligent being)

  100. Medical Aikido by infonography · · Score: 1

    How about we want them to keep evolving toward a state where they need the antibiotics to survive only to pull the chair out from under them by withdrawing it later. Hmmm, there is a though, cure a disease by cutting off the cure. Man the Big Parma companies will just love that idea. They will send you to a Detox to clean out.

    --
    Sorry about the writing. Robot fingers, you know? Cliff Steele in DOOM PATROL #23
  101. not true at all!! by Anonymous Coward · · Score: 0

    Nearly all nutritionists will tell you that not eating meat at all is doing as much harm to you as it is doing good.

    I call bullshit here!! vegetarians live longer and healthier, vegans even more so.

    most nutritionists who don't get their info from the meat-and-dairy industry lobbyists would say that animal products are optional and overall unnecessary.

    1. Re:not true at all!! by WWE-TicK · · Score: 0, Troll

      The problem with a strictly vegetarian diet is that the protein obtained from plant sources are not complete proteins (they lack certain amino acids which your body needs). While it's possible to mix and match your food obtained from plant sources to achieve a more complete amino acid profile, it is way more easier to obtain the majority of your protein from animal sources. Failure to do so will result in a protein deficiency.

      However, your average dumbass vegetarian do not know this. They say they don't eat animal products because "it's healthier", yet they'll eat a bag of potato chips and wash it down with a pepsi. Healthy my ass. A vegetarian diet is NOT necessarily healthier. Most of the vegetarians I've met don't have the faintest clue regarding proper nutrition which would explain why they usually look pastey, thin, and generally unhealthy.

    2. Re:not true at all!! by WWE-TicK · · Score: 0

      Troll? Idiot moderators.

    3. Re:not true at all!! by fitten · · Score: 1

      Heh... this moderation finally convinced me that the moderators have no clue.

      This post is right on the money. Go ask your family doctor if you want confirmation. I will ignore moderation from now on I guess. You can't trust it anymore.

  102. Slashdot Users... by Anonymous Coward · · Score: 0

    should not be allowed to even comment on biology.

    You people are frightening and ill-informed. It would be like going to Dr. Google for all your health problems.

    toby

  103. Another reason why GMO antibiores markers is bad by SysKoll · · Score: 5, Insightful

    Vancomycin-resistant staph is really bad news. Vancomycin was the last line of defense among antibiotics that have been tested. Its successors are very recent and might have side effects that haven't been detected yet. Not to mention that they are very expensive.

    That's one more reason why it's a bad idea to use antibiotic resistance genes as selection markers in genetically modified organisms (GMOs). The process goes like this: A researcher wants to splice, say, a sheep's wool-producing skin gene into common corn so that the GM corn will have wooly fibers (cheaper wool, great!). The researcher prepares thousand of modified cell cultures. The gene splicing has succeeded in only a small percentage of them. How does he select the cells with the spliced gene? Easy: He also splices another gene, coding for antibioresistance (ABR), and looks for its signature in the Petri dishes, using standard reagents.

    Then when the wooly corn is marketed, all its cells carry the same ABR gene. Eat the corn, and the bacteria in your guts get a chance to acquire the ABR gene from exposure to it. Then you get sick. The doctor prescribes antibiotics. All the E. Coli in your guts are killed, except the infinitesimal fraction that acquired this ANR gene. Then the surviving fraction repopulates your intestine. All your E. Coli population is now ABR. They will transmit the gene to some pathogene sooner or later.

    Understand me, I don't really think that GMO are evil. Some GMO are actually very good ideas. The problem is that implementation of the idea with selection through ABR is very dangerous. Look it up for yourself.

    -- SysKoll
    --

    --
    Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/

  104. Genesis 1:11 by Anonymous Coward · · Score: 0

    'And God said, Let the earth bring forth ...'

    Hmmm.. sounds like an evolutionary process to me !

  105. Re:Grapefruit Seed Extract - the natural alternati by Reziac · · Score: 3, Interesting

    I don't know about this guy's compost pile, but I can tell you from my various attempts to sprout grapefruit seeds, that they do indeed rot (quite nastily) if conditions are too wet and the seed "drowns". OTOH, *NO* seed decomposes so long as it is still alive. So there's nothing unique about grapefruit seeds in this respect.

    However, you might look into apple seeds. When I was a kid, I discovered that a peeled and crushed apple seed held against a canker sore for 10 minutes would cause very rapid healing in 90% of cases. Maybe a cyanide compound of some sort, killing a specific pathogen, I dunno (never bothered to pursue it, no idea if anyone's researched it).

    --
    ~REZ~ #43301. Who'd fake being me anyway?
  106. Re:Another reason why GMO antibiores markers is ba by dlamming · · Score: 1

    The resistance markers used are commonly things like ampicillin. While bacteria in the lab may be sensitive to this, most organisms in the wild became resistant long, long ago. You don't need to worry about resistance markers used in the lab, even for crop selection.

    --
    Not only am I a scientist, I play one on TV
  107. Non-antibiotic staph cure by freejung · · Score: 5, Interesting
    I live in the tropics, and I and many others in this area have recently contracted a highly antibiotic-resistant strain of staph. It responds to antibiotics to some extent in some people, but in others antibiotics seem to have little effect. I know a guy who has had it for a year or more, his leg is half gone, he's been in and out of the hospital several times and he can't seem to get rid of it.

    I and many others have cured ourselves without antibiotics, and I want to tell you how. This by no means qualifies as official medical information, it's just what happened.

    Disclaimer: I am not a doctor and this is not a scientific analysis. This is just my story. It worked for me. If you have staph you should seek medical attention immediately. It's no joke, and even the doctors may not be able to help you.

    OK, if you have a weak stomach, stop reading now.

    First I should explain how staph attacks you, typically. Usually what happens is that you get a nick on your lower leg, and it just won't heal. Soon you have a festering infection which grows rapidly. It's amazingly efficient and agressive. It eats a sizable hole in your leg, and then starts to spread. You start getting pimples on other parts of your body which quickly grow and soon your are covered with round, dime or quarter-sized oozing festering holes. It's pretty horrifying. If you don't do something about it, you will end up with serious problems.

    I was infected for a couple of months, but I recovered without antibiotics, and many others have by using similar techniques. I have thought about the whole experience a lot, and I think I can identify the core elements of a successful staph cure. These elements can be divided into two main categories. First, you must have some kind of internal defense to prevent the spread of the staph through the bloodstream and the intercellular fluid. In the usual cure this is done by antibiotics, but these are losing their effectiveness. But fortunately your body comes equipped with an immune system for this purpose, but you must do everything you can to strengthen it and give it the advantage over the bacteria. Secondly, you must have some sort of external attack. This is the really horrible part. The staph burrows under the dead flesh it kills, making it extremely difficult to attack from the outside.

    Internal Defense

    • NO SUGAR!!! You must avoid sugar, starch if possible, fat, alcohol and cigarettes at all costs. Your life may actually depend on this, so don't try to cheat. This is the staph diet, and the staph will rigorously enforce it. Staph appears to feed on the sugar in the intercellular fluid, mostly in the fatty tissue just under the skin. When your blood sugar goes up, it goes crazy. One night I couldn't stand the sugar cravings any more and I ate 6 banannas. The next morning I woke up with 20 new sores starting. When I did finally get rid of it, it was only when I stopped eating sugar completely. Everyone who has had staph agrees on this. Avoiding sugar is the only way to stop getting new sores.
    • Bolster your immune system. Do anything you can to do this. Get lots of rest, drink lots of fluids, eat vitamin C and other antioxidants, do anything you can think of to strengthen your body's defense. Alcohol and tobacco weaken your immune system, and must be avoided. There are a number of local herbs which people say help, I can't really give evidence on these one way or another and besides they probably don't grow where you live.
    • Consider taking antibiotics anyway. I didn't, but sometimes they help somewhat even if they don't completely kill the staph. The resistant strain seems to have a higher survival rate, but it does still kill some of them. But taking antibiotics does not exempt you from the other elements of the cure, so don't even think about slacking off. Curing staph is a full time job, and you must give it your whole attention.

    External attack

    This can be divided into two phases. In the first phase, the staph colony is expanding into the flesh around it, and your attack must be very aggressive. In the second phase, your body has isolated the colony and built a membranous wall around it. Then the treatment must be very gentle.

    Phase one; Expanders:

    • This is the really horrible part, so brace yourself. The staph burrows under the dead flesh it kills, leaving a hard, tough gray scab. This material is incredibly strong, we should be using it in high tech aircraft design or something, it's amazing. This stuff must be removed by any means necessary. This is not fun. Some people take the leaves of a certain plant, boil them, take a handful and scrub the wounds hard until the scabs come off. This is horribly painful, and takes a long time because the leaves are soft. Some use a scrubby, brillo pad, or steel wool. This is even more painful, but is much faster. However, it does a lot of peripheral damage, which then gets infected. Personally, I used a razor blade, and just gouged that shit out of there. This is also horribly painful and takes a long time and is really really disgusting (the worst part is the smell of your own rotting flesh), but it is very precise and it works nicely. You must do this at least once a day, preferably twice or even three times. The staph grows fast.
    • Disinfectant. Once you have removed the dead flesh as completely as possible (you will know you have done this because when you get down to the living flesh it starts to bleed profusely, and it really starts to hurt like hell), you must disinfect the area thoroughly to kill as much of the colony as possible. This is just a numbers game. Exponential growth is a bitch. Some use hot water with a lot of salt, but I prefer hydrogen peroxide and chlorine, which are highly toxic and quite effective. Iodine for some reason seems to have little effect. Washing afterwards with antibacterial soap is also a good idea.

    During this phase, I think the wounds should be left open. This is to encourage them to ooze pus, which is actually a good thing because it establishes an outward flow of fluid and slows the staph down. The objective of this phase is to slow the growth of the colony enough for your body to build a membranous wall around it, isolating the infection from the intercellular fluid and allowing the healing process to begin.

    Phase 2; Contractors:

    You will know you have entered this phase when you stop finding so much dead flesh, and the colony slows its growth. At this point you build a wall around the infection, and within a couple of days the remaining dead flesh outside the wall should come off easily, without extensive scrubbing. Now you must change your approach:

    • Scrub the wounds gently with boiled Coralito leaves or a soft cloth. The idea is to remove the loose organic matter without damaging the wall.
    • Continue to disinfect after each scrub.
    • Cover the wound. The absolute best way to do this is to take this one kind of leaves called Coralito or Red Top, toast them to a fine powder over a low heat, and apply this powder to the wound after disinfecting. This hurts like hell for some reason but is very effective in drawing out the fluid and protecting the wound. In this phase the wound will ooze a lot. That's OK, even though it's pretty nasty.

    Gradually the wound will begin to shrink. You must stick with the treatment rigorously and stick to the diet mercelessly. The cases that go on and on are the ones where the person simply cannot force themself to avoid sugar, alcohol and cigarettes, and just keep getting new infections.

    Also, a note about clenliness. It's really important. You must clean and disinfect your entire environment completely all the time, especially your clothes and bedding. Do lots of laundry, take lots of showers, use chlorine liberally.

    Well, that about covers it. After two months of this horrible daily torture, I finally got a grip on my sugar consumption, cured my last big sore, and recovered. I have big scars on my legs to tell the tale, but I'm actually grateful for the experience. It builds a hell of a lot of will power, which is useful stuff.

    Good luck, and may the Force be with you.

    1. Re:Non-antibiotic staph cure by greginno · · Score: 1

      Jesus man, that sounds absolutely terrible.

  108. To help reduce a cold/viral infection... by Cef · · Score: 3, Informative

    So many people take anti-biotics for everything, and don't complete their prescribed courses, that people forget the other tried and true methods of helping your body and immune system fight a cold.

    1. Inhalation of steam and an antiseptic agent.
    Eucalyptus oil or Tea Tree oil in water, then heated/boiled is a great way to kill off bugs in the air. Very good for throat/nasal infections. Scented burners are good value for this.
    2. Acidic foods/liquids.
    This includes oranges, lemons, apples, grapefruit and tomato, including juices of those. Vinegar, particularly cider and malt vinegar, can be good if used as a mouth wash/gargle or ingested (if you can). Salt is also a good thing to ingest when ill, but as always, too much is bad for you. Yes, I am advocating salt'n'vinegar potato chips here. *grin*
    3. Mouth washes.
    Cider and malt vinegar work well, as does salt water. Iodine throat wash (commonly found under the "Betadine" brand) is also very good, but don't swallow it. Listerine and other mouth washes (for teeth care/plaque) are also good value. And brush your teeth too.
    4. Suppliments/herbal treatments.
    Echinacea, and other herbal suppliments can help, though be warned that some may have bad or deadly side affects for some people. Ginger is used lots in Chinese medicine, and is apparently quite good for helping someone overcome a cold, but some people are allergic to it. Vitamin suppliments are also good if you haven't been eating right, or can't keep a lot of food down.
    5. Fluids.
    The kidneys are a primary place for a virus to be flushed from the human body. Don't drink too much though, as it is possible to kill yourself from taking too much fluids.
    6. Regular wash/shower.
    Sweat is another way for fluids to leave the body, and regular washing helps remove some viruses.

    This is not a definitive list. But I'm hoping someone out there might find it useful. There are a lot of NATURAL ways to fight a cold. The goal is to help out the body. If that is by helping to remove the virus or most of the things the body fights against on a regular basis (air-born contaminants, throat bourne virii, etc), then you body will have more resources to chuck at other areas. Just think of the whole thing as a resource based game, where you are the resource. Remember though that too much of something can be bad though, so balance things out.

  109. Re:Antibacterial != Antibiotic is true, however... by shadowsong · · Score: 2, Interesting

    I remember reading an article about a study where scientists took samles from the dorm rooms of messy college students and also from homes which were cleaned often with anti-bacterial cleaners. There were more germs in the college dwellings, but the germs found in the houses cleaned with anti-bacterial cleaners were much more dangerous. I don't remember the exact conclusions drawn, but there was definitely a link between the anti-bacterial cleaners and the dangerous germs.

  110. A few facts by mrpastry · · Score: 5, Informative
    This story is a big deal because until recently vancomycin has been the one antibiotic microbiologists could reliably fall back on to treat MRSA. Resistance to all other antibiotics has been seen in S.aureus . It's also a big deal because Staphylococcus aureus (the SA in MRSA) is a pretty aggressive bug, unlike say VRE, which, though also effectively untreatable in some cases due to drug-resistance, are pertty weedy bugs that only affect a few very ill patients.

    MRSA strains with intermediate resistance to vancomycin have been seen in many parts of the world since 1996, and patients certainly have died as as result of vancomycin treatment failure. However, these perhaps weren't so scary as the resistance mechanism was a very thick cell wall which made these strains very slow growing and not so viable in the absence of vancomycin.

    What's new is that MRSA strains have now emerged with high-level vancomycin-resistance and this happened by acquistion of the vancomycin-resistance gene (vanA) from VRE. That this was possible was shown in the lab in 1992, but the first time it's been seen in patients was this year. The two reports of Vancomycin-resistant MRSA in the U.S. can be found in the CDC's newsletter:

    MMWR Morb Mortal Wkly Rep 2002 Oct 11;51(40):902

    MMWR Morb Mortal Wkly Rep 2002 Jul 5;51(26):565-7

    How scary is it? Until recently MRSA has been almost exclusively a hospital pathogen, so it's pretty scary if you're a hospital patient with a lot of tubes sticking into you which alow the bugs to get in and cause infections, but if you're well it's not a big threat (doctors and nurses can carry MRSA, but generally they don't develop infections despite a lot of exposure). There have been reports recently of strains of MRSA that do spread well in the community, and that can cause serious infections amongst essentially healthy people. However, these have not been multiply-resistant strains, and really these are no worse than virulent strains of normal S. aureus which have been round for millions of years. The message is, if you're well, don't rush out and buy cipro (this will only helps MSRA as the bugs are resistant to it), and if you're ill, keep away from hospitals.

    Just to rebut a few other comments: over-prescribing of antibiotics probably is very important for encouraging drug-resistantce, but even correct of use of antibiotics will lead to some resistance. Use of antibiotics in animal feed can't really be blamed in this case, as drugs of the same class as vancomycin (glycopeptides) have not been used in animal feed in the US, though they have in Europe. They've probably played a significant role in VRE transmission in humans in some European countries, but in the U.S. hospital prescribing of this and other antibiotics have probably been the driving force.

    1. Re:A few facts by dreamfactory · · Score: 1

      Vancomycin has *not* ever been used in animal feed is europe or anywhere else for that matter. Why? Currently Vacomycin gram for gram is more expensive than gold!

      It's very hard to manufacture also!

  111. Naw, that's the OJ strain by Anonymous Coward · · Score: 0

    OJs moving to West Virginia: the DNA there is all the same...

  112. It's time... by rnd() · · Score: 2

    to wash your keyboard!

    --

    Amazing magic tricks

  113. Just a preview for Saddam's anthrax/smallpox by Anonymous Coward · · Score: 0
    And if we don't get him now, things will get better if we wait?

    Where's the fucking logic in that?

  114. GoldenStaph Closes Australian OperatingRooms et al by ivi · · Score: 2, Interesting


    1. From time to time, something known as Golden
    Staph is reportedly found in our hospitals,
    and it closes any operating theatres it's
    been found in...

    2. There's a double standard of informing people
    who might be working around/with those known
    to have/carry golden staph, &/or communicable
    diseases:

    - police dispatchers alert attending officers
    that suspects are known to carry (unspeci-
    fied) communicable diseases, but

    - health care professionals (who work with
    similar disease carriers) are not told, ie
    officially

    Different ministries / gov't dep'ts,
    different needs/rights to know...

    Go figure! Or better: go improve things! ;-)

  115. This was predicted in Biblical times by ez76 · · Score: 3, Funny

    From Psalm 23:

    "Thy rod and thy staph shall come for thee."

    Clearly, the rod is the bacillus bacterium responsible for Anthrax, and the staph is the aureus.

  116. sub-therapeutic antibiotic use in animals by fldvm · · Score: 1
    Sub-Therapeutic use of antibiotics in food animals is very common. Sub-Therapeutic means feeding animals, usually pigs and chickens, very low doses of antibiotics because they will gain weight faster and make the farmer or producer more money in weight gain than the cost of the antibiotics.

    I agree that Sub-Therapeutic use of antibiotics may not be a good idea but to date there has not been a good study that shows any link between antibiotic use in animals and antibiotic resistantance in human infection. It is all theory at this point.

    Most people don't know you can get antibiotics for food animals without a prescription.

    The FDA is investigating cases of guys in the military buying (and using on themselves) fish antibiotics sold in pill form at the same doses used in humans. I don't know why military guys would do this when they have access to cheap/free healthcare. I guess it has something to do with being willing to jump on a grenade.

    Anyway I had a friend in college who said he didn't like doctors. When he felt sick he would shoot himself in the ass with pig antibiotics he got from a feed store. He wanted me to tell him how much he should use so I told him to use a does between a sheep and a pig:) I finally got him to stop when I explained how he could die from anaphylactic shock.

    I bet he could be trained to jump on a grenade too!

    1. Re:sub-therapeutic antibiotic use in animals by CharlesEGrant · · Score: 1

      I've alway thought that antibiotics in animal feed was an obviously bad idea, but it suddenly occurs to me that I've been overestimating its implact.

      It does seem reasonable that bacteria might develop resistance to the antibiotics actually put in animal feed, but will that affect resistance to antibiotics not used in feed? I would assume that Vanomycin is not used in feed, so I have to wonder how animal feed antibiotics could have any impact on the appearance of Vanomycin resistant bacteria.

    2. Re:sub-therapeutic antibiotic use in animals by fldvm · · Score: 1

      Unfortunately it is not that simple. My understanding is that bacteria that gain resistance by exposure to one antibiotic (or antiseptic) may often gain resistance to other antibiotics. I am not totally clear on this issue but the bottom line is we need more research in the area.

    3. Re:sub-therapeutic antibiotic use in animals by fldvm · · Score: 1
      http://www.asmusa.org/pcsrc/gm2000/17626.htm

      or

      http://www.google.com/search?sourceid=navclient& q=bacteria+resistance+antibiotic+antiseptic

  117. Re:A grain of salt & dash of pepper by MacAndrew · · Score: 2

    I don't mean to over-hype my de-hype (to further abuse the language); just a grain of salt in the context of the article about staph, which I felt to be misleading. This misdirection doesn't imply there's nothing to fear, and infectious disease is certainly going to be a growth business for some time to come. (Of course, it is the job of specialists in the field to worry about what's to come.) But the antibitoic resistant bacteria problem is still largely in the future, a class different from the sort of infections most of us face.

    Maybe that future is arriving faster than I thought... Be nice if we could do something about those "breeding grounds" in the meantime. It's depressing to see someone older go to the hospital with a broken hip to die of pneumonia. Also, the kids who have died because of the poor sanitation in meat packing are so betrayed by a system that responds not with rules but "cook the meat more."

    On prescribing antibiotics, assuming the clinician is not ignorant or pandering, it must be difficult. There's always going to be a fear of injury and liability resulting from undertreatment. This comes up with the treatment of ear infections in infants and toddlers. Most such infection resolve themselves without treatment, but the 1 in 5 (or whatever -- there was a study) that don't can cause hearing loss, impaired learning of speech, and so on.

    FWIW -- not too helpful -- here's the CDC page on antibiotic resistance with a quiz!

    Hmm, cranberry juice cocktail might be used against infection. You never know what will help.

  118. The handwashing stat by swb · · Score: 2

    Only 40% of people wash their hands exiting public restrooms[...]

    I had read a similar statistic, but with a twist. I believe it said that only 30% of people washed their hands after going to the bathroom if they were alone, but if someone else was in there the number went up to like 85%. I'm making the numbers up, but it was a high-contrast situation.

    I had a cow-orker who used to always go take a piss or a shit if he could and not wash his hands before working on the most hated people's computers. He thought it was an indirect way of getting them to kiss his ass...

  119. Hand washing trick 1 by Gorimek · · Score: 2

    The place most people miss when washing their hands is [b]in between the fingers[/b]. You can wash that area in less than a second if you just incorporate it into your routine. And it makes the washing [b]much[/b] more effective.

  120. selection by MacAndrew · · Score: 2

    Interesting about the selective disadvantages of selection.

    It's also not super adaptive for a parasite to routinely murder its host. Exceptions are pathogens that are very contagious or have nice homes elsewhere, either in another species or in some durable form. Anthrax has the unusual strategy of killing its host as fast as possible, before it can mount a defense, and then multiplying its spores throughout the carcass. The spores are eventually released into the soil, get inhaled by the next unlucky ungulate, and off goes another generation.

    I live next to DC, hence my personal interest in anthrax. And in any case, isn't disease fascinating? :)

  121. This proves evolution! by RussP · · Score: 1

    I'm kidding, but I'll bet some genius here on slashdot will claim that the "evolution" of antibiotic-resistant bacteria proves that all life evolved from a single cell.

    --
    I watch Brit Hume on Fox News
  122. Chemotherapy my boy, chemotherapy by gelfling · · Score: 2

    There is a class of cytoxan/cytosporin chemotherapy drugs that are in fact extremely powerful antibiotics. But at any rate the future of antibiotics is in custom tuned monoclonal antibodies.

    Tougher bugs need tougher drugs.

  123. WRONG - Not True by spineboy · · Score: 2

    Vanco is almost always given thru peripheral IV lines. It is NOT like Chlorox and will not destroy your veins. It can cause Red Man syndrome if a poorly purified batch is given too quickly.

    I use it all the time at work, we have patients with bone infections who often need to get it for 6 weeks IV to clear out theinfection, and they're ok.

    --
    ..........FULL STOP.
  124. Sounds like your house has air duct HVAC by Anonymous Coward · · Score: 0

    If so, you need to clean your ducts.

  125. Oliver Cluef*ck strikes again by Anonymous Coward · · Score: 0

    "It's something called EVOLUTION"

    Evolution happens over millenia, not in the course of a petri dish while Hal the Scientist watches.

    Lets put it this way. During our lifetime nothing has evolved. Some things have mutated, and mutation is part of evolution, but mutation is not evolution.

    Now, do you get it? Are you showing a glimmer of "clue"?

    Gadalmighty. I'll bet you went to a college where they teach divine creation is how life got started.

    I hope you're not involved in the sciences in anyway

    1. Re:Oliver Cluef*ck strikes again by MillionthMonkey · · Score: 2

      Evolution happens over millenia, not in the course of a petri dish while Hal the Scientist watches.

      Evolution happens over generations, not millenia! A millenium may have 50 human generations. For bacteria, 50 generations takes about 24 hours.

      Lets put it this way. During our lifetime nothing has evolved. Some things have mutated, and mutation is part of evolution, but mutation is not evolution.

      If you think antibiotic resistance (mutation + natural selection) is not an example of evolution then you are seriously mistaken.

  126. Re: stainless steel by GodsMadClown · · Score: 2, Informative

    Actually, no. Bacteria have a pretty easy time growing on stainless steel. It's brass and other copper containing alloys that they can't take.

    http://www.fastinc.com/foodsafe_copper.htm

    Copper shows antibacterial properties against E. Coli
    Originally published 9/14/2000

    Source: www.foodservicecentral.com

    A recent study, conducted by Bill Keevil, Ph.D., of the Porton Down, UK-based Center for Applied Microbiology & Research (CAMR), found E. coli O157:H7 bacteria survive for much shorter periods of time on copper and brass surfaces than on stainless steel. According to Keevil, this finding has wide-ranging implications for controlling the microorganism.

    The work carried out by CAMR team member, Andrew Maule, revealed that at room temperatures it takes 34 days for E. coli O157:H7 bacteria to die on stainless steel tiles, 4 days to die on brass tiles, and just 4 hours to die on copper tiles. At chill temperatures typical of food storage, the study found that 10% of the bacteria were still alive on stainless steel tiles after 34 days, whereas bacteria were completely eradicated on brass tiles within 12 days and on copper tiles in just 14 hours.

  127. There are studies that contradict... by Anonymous Coward · · Score: 0

    your studies (unfortunately, I have no links).

    One thing that cannot be debated and agreed to even by the most hardened vegan is:

    Meat tastes delicious.

    I think most animals that we kill and eat are proud of the honor that an animal higher on the food chain will use their protein.

    I'm glad to oblige. Animals taste good, and they're good for you. Yum!

    P.S. Their hides look bitchin' on the seats of my BMW.

    1. Re:There are studies that contradict... by jayratch · · Score: 1

      Sure, the hide looks great in your Bimmer.. but really, have you ever actually tasted a buffalo?

      Although, since they're usually "free range", I bet it would solve this drug-meat debate. Oddly, last time I was offered Buffalo meat, it prompted me onto the path of abandoning my vegetarian beliefs, because I realized that like so many, I really had no problem with the eating animals part; we were meant to do that. It's the overprocessing, overconsumption, and mechanization of it that bothers me. Though come to think of it, everything we do to cows, I've met people who've done worse to potatoes, so there goes that argument.

    2. Re:There are studies that contradict... by Anonymous Coward · · Score: 0

      I perhaps don't disagree with you, but you seriously sound like the stupidest person I've ever had the displeasure of reading. Please tell me you're ten years old, and my faith in humanity won't be so mortally wounded.

  128. Why? Because you say so? by Anonymous Coward · · Score: 0

    Son,

    If you're going to get in a verbal fight, come armed.

    When you say:

    "I call bullshit here!! vegetarians live longer and healthier, vegans even more so."

    But can't back that up with a single link or study, then you're nothing but a noisy idiot. I mean you would be anyway, but you're worse without proof.

  129. chiro (Re:FYI: Colloidial Silver Not So Good ...) by mtngrown · · Score: 1

    Chiro is interesting for a couple of reasons. The most interesting is that a good chiro will actually _listen_ to you. Every doctor I have seen either for myself or with my wife in the last 10-20 years always seems to be paying attention to something else... maybe their afternoon golf date or whatever. The second interesting thing about chiro is that it only works if the patient is proactive. Can't take a pill, no no no. Gotta actually do the damn exercises. It requires more work than going to the doctor. A third interesting thing about a good chiro is that if you say your back (or whatever) hurts, they might believe you. In contrast to an MD that may say "its all in your head". (As told to my sister-in-law for years until they discovered, too late, that she had a degenerative bone disease. The pain was "all in her head". Chiro of course would not have helped her, but the orthodox medical establishment didn't really help much either.)

    Lastly, a really good chiro will have a short list of fine surgeons to refer you to if you have an injury beyond their capability. It helps to have one that has actually had back surgery... :).

    Hope this helps. Don't believe the hype by any means, but for the kind of (very real) back pain I have occasionally, a $60 visit couple of times a year to the chiro is cheap relief.

  130. Re: stainless steel by MacAndrew · · Score: 1

    Whichever it is, seems like an awful long time to wait before leaving the bathroom.

  131. Your argument falls apart on one key fact by Anonymous Coward · · Score: 0

    Meat tastes good.

    I've survived for a year on a vegan diet. It sucks. People say you need spices. I had spices out the yin yan.

    Vegan diets are nothing to get excited over.

    I've found the most pleasant and healthy diets to include very little red meat. Some chicken. Lots of fruits.

    Stay away from the weird vegetables tha kooky religious vegans keep pushing they taste bad.

    See, the problem is a vegan diet isn't satisfying. The texture and taste of meat is great. Our bodies have evolved to *like* those things.

    There's nothing wrong with eating meat. Its good, good for you, and like anything else, you need to pay attention to the overall quantity of calories you get. The way you get it less important than self-proclaimed experts want us to think.

    1. Re:Your argument falls apart on one key fact by dan+the+person · · Score: 2

      Thanks for your comments. They have made quite an impression on me.

      I now realise my argument that a vegetarian diet requires less plant production to be false. Your point about the taste of meat clearly refutes this.

      Have you considered a career as a science teacher? I wish more of todays youth had your clear grasp of critial reasoning.

  132. Re:Another reason why GMO antibiores markers is ba by jeff4747 · · Score: 1

    Um...Antibiotic resistance in Corn wouldn't work...
    Antibiotics don't work on Eukaryotes (like Humands and Corn). The way you do it with bacteria is modify the bacteria, then use the antibiotic to kill all the ones that didn't get the genes you wanted. Btw, usually they use penicillin variants when doing this kind of experiment because most wild bacteria are already resistant to it.

    Since antibiotics can't kill corn, you can't use it to wipe out the unmodified corn. And while you cood look for the antibiotic resistance gene in the corn's DNA but you might as well look for the gene you're trying to splice in.

  133. spreading???? by shdragon · · Score: 2, Informative

    Okay, after seeing the article, right about the time this came on the news.

    For the patience-impaired, a local (err, Houston area) high school has had a rash of staph infections break out and the infections are apparentaly resistant to antibiotics. Now I understand that we over-medicate everyone but what's next when things such as this pop up in more than just an "isolated" area?

    --
    "...we dont care about the economics; we just want to be able to hack great stuff."
  134. Who needs privatization to save social security? by raehl · · Score: 2

    "It won't be the young, fit and healthy as much as the very young and the very old."

    Drug resistent bacteria have the social security and medicare problems licked!

  135. dirty needles by rsax · · Score: 1
    That was especially true in the Detroit area, where many intravenous drug users in the 1970s began mixing antibiotics, including methicillin, with heroin.

    Does that sound odd to anyone else? Someone's willing to inject heroin into their blood stream but damn, you gotta watch out for those dirty needles. You wouldn't want to get an infection or something or oh I dunno.. die of a fucking heroin overdose maybe?!

    1. Re:dirty needles by perlyking · · Score: 2

      I would assume that someone who will go to that length will also try to ensure they get the correct dose.

      --
      no sig.
  136. Another side effect... lesser known by The+Tyro · · Score: 2, Informative

    I never take antibiotics unless clearly, unequivocaly indicated... period. I was sick the entire month of September with Mycoplasma (an "atypical" pneumonia), and took no antibiotics. IAAD, BTW, so I have access to any and all antibiotics... I took nothing. Want to know why?

    Whenever you take antibiotics you are messing with your normal bacterial flora; those bugs that live in/on you all day, every day. These communal bugs will almost never make you sick. Taking antibiotics wipes out your normal flora, along with the bug making you sick. No problem, right? Wrong... think of it in terms of population dynamics. You are opening up lots and lots of living space for any organism that wants to set up shop. Since it's now an antibiotic-rich environment, what bugs could survive there? That's right... the resistant ones.

    Most antibiotics are broad spectrum (some more than others), within their class... ie. gram positive or gram negative. Since I work in a hospital, I am around a bad group of microorganisms, often multiply-resistant. Hospital-acquired pneumonias/other infections are problematic, precisely because that's where wide antibiotic use has bred resistance. If you have a live-in older disabled relative you take care of, or work in a nursing home, or work with end-stage AIDS patients, etc, you might want to be extra careful taking antibiotics. Those normal flora organisms may be doing you more good than you think.

    This phenomenon is evident in conditions like Clostridia difficile colitis, where antibiotics wipe out normal bugs and allow the Clostridia to overgrow.

    My personal (not necessarily professional) advice is to suck it up. If you have a cold and/or mild/moderate sinusitis, deal with it... the overwhelming majority are viral. If you have coexistant medical conditions, you may need antibiotics earlier than a young, healthy person. If you are young and healthy, be thankful, and avoid antibiotics unless clearly indicated.

    Also, this may sound self-serving, but listen to your doctor when he says antibiotics aren't needed... that's why he went to school. The "I know my body" and the "I always get antibiotics for this" and the "my body has a resistance to drug X, I need drug Y" (usually a much more expensive/worse choice) crowd are the bane of every physician's existance. It sounds patronizing (and somebody is going to take me to task for this, I can feel it) but listen to your doctor, and don't throw a fit.

    --
    Even if a man chops off your hand with a sword, you still have two nice, sharp bones to stick in his eyes.
  137. Re:Grapefruit Seed Extract - the natural alternati by FireHorse · · Score: 2, Informative

    >However, you might look into apple seeds.

    They are high in what is being called Vitamin B17, or Laetril. Quite controversial in its application; and depending on who you believe, it either cures cancer or kills you. It is also found in Apricot seeds, and Linseed (flax).

    The FDA never seems to like anything that can't be patented and make their business friends lots of money...so it's best to study the heck out of this yourself.

    A good site

    Here's the short answer:

    What Does Vitamin B-17 Do?

    Dr. Krebs discovered the Vitamin B-17 compound reacts to the enzyme beta-glucosidase, primarily located in huge quantities at the site of cancerous tumours. In this reaction, two potent poisons are manufactured by beta-glucosidase at the cancer cell site; hydrogen cyanide and benzaldehyde. Therefore, Vitamin B-17's toxic reaction destroys the cancer cell.

    What Happens To The Excess Vitamin B-17 Not Consumed In The Killing Of Malignant Cancer Cells?

    Dr. Krebs found that healthy cells contain an enzyme called rhodanese, that acts as a control agent. Rhodanese is common throughout the body yet not at cancerous locations. If Vitamin B-17 comes into contact with healthy cells, rhodanese detoxifies the cyanide and oxidizes the benzaldehyde, and accurately targets Vitamin B-17 at cancerous locations and not at healthy tissue. Any excess by-products produced by the reaction are expelled in normal fashion through the urine.

  138. Mod parent up, please? by RobertB-DC · · Score: 1

    (My mama told me to always ask politely and NOT TO YELL.)

    The parent of this message is written evenhandedly and fairly, despite being a reply to a post full of (IMHO) ludicrous claims and half-told stories.

    That said, the grandparent's author replied, and isn't AC, so perhaps this message's sibling :) should be considered for a mod-up as well, even if it's a bit... detached from reality.

    (Now, it'll be interesting to see if my first "MOD PARENT UP" request tanks my karma!)

    --
    Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
  139. Re:Grapefruit Seed Extract - the natural alternati by Zoop · · Score: 3, Insightful

    I discovered it when it was recommended to me for a nasty GI virus that wouldn't go away by normal starvation. Killed the sucker right off. As a nursing student I will be trying to bring this into any hospital I eventually work for.

    Please don't. I'm serious.

    As someone with medical training, you should KNOW that most diseases go away by themselves and there's no substitute for double-blind, placebo controlled studies to ascertain the efficacy of a given treatment. Please don't rip off poor people in their time of need by sending them to GNC to pay lots of money for various things that just don't work, and in some cases kill.

    Note that no links to peer-reviewed articles exist on the link you provide. Just assertions who all curiously use the commercial name of the product. Look at the broad range of things it claims to cure...missing only "the vapors" and "consumption" to be pure snake oil.

    A quick check of the FDA, however, reveals that these makers haven't bothered to put it to the test of actually trying to show it cures people instead of making outrageous claims:

    first letter

    a href="http://www.fda.gov/cder/warn/cyber/cyber2002 .htm"> second letter

    And since the stuff you'll be foisting off on suffering, desperate people is unregulated, you won't even know that the brand they buy actually contains the advertised product, nor that it's safe.

    Hell, I don't know exactly why switching everyone in the middle east to purple robes wouldn't bring peace, except that nobody's shown even a correlation between purple-robe-wearing and sudden elimination of religious fanaticism (though it'd be fun to try on Pat Robertson in a study). Similarly, since no one has actually shown that the concoction you ingested (if it actually contained what its maker claims it did) had anything to do with your improvement. It's not as if all your white blood cells up and died, leaving it as the only thing between you and death.

    Please, go to pharmacy school if not getting a full MD before prescribing drugs, because that's exactly what you'll be doing if you recommend it to anyone.

    And that's just plain wrong.

  140. For all you nanotech fans by Anonymous Coward · · Score: 0

    Nanotech depends on self-reproduction to be effective. Bugs making bugs.
    No manufacturing process is perfect, which means broken bugs and mutated bugs. What happens when the reproducing bugs cause errors in portions of them devoted to limiting reproduction and/or area of attack?

    You'll have duplicated natural plagues, only made them harder to kill.

  141. No, isn't that supposed to be *colonic* silver??? by myowntrueself · · Score: 2

    thats going to worry a few people I bet.

    --
    In the free world the media isn't government run; the government is media run.
  142. Antiviral drugs by rjh · · Score: 2

    Antiviral drugs do exist--look into Amantadine, which is commonly prescribed nowadays for influenza.

  143. It Sucks by Anonymous Coward · · Score: 0
    It Sucks to live in a world where natural selection won't take the weakest and most stupid first but on the contrary: we spend resources, time and harm ourselves in the process of taking care of weak and stupid.

    Weak I can live with, it's the stupid people that makes me and everybody sick, literally.

  144. Can this be accelerated deliberately? by Dr.+Spork · · Score: 2
    What I'm wondering now is whether this process could be accelerated artificially. I mean, bacterial life cycles are so short, one can imagine growing them in a petrie dish and putting in small doses of antibiotics, not enough to kill the colony but to privilidge the more resistant ones. Then, slowly increase the antibiotic concentration... until you have resistance. Repeat the same procedure on the resulting colony using all the other available antibiotics, and you get a perfectly resistant strain of bacteria.

    Now, all that's left is for you to culture them, bottle them and distribute them to pimply hamburger-flipping terrorists who pour a vial into the secret sauce that goes into every McDonalds hamburger. Because strep is contageous, this would infect not only McD customers but their families and coworkers. Since the bacterium would be basically untreatable, it would get a lot more chances to infect others than ordinary strep, basically because you are infectious for much longer (however long it takes to die).

    I can't think of a better way to terrorize American society than this. Parents would refuse to send kids to school, we would shun each other and view every sneeze with grave suspicion... in general, there would be great fear and a much lower quality of life.

    Anyway, I hope the CDC is working on a way to prevent this nightmare scenario. If this were to happen, could we make a vaccine to prevent infection? Anyway, I would hope we'd have some line of defense, though it seems to me that if the bacterium breeders did their job well, they could design the bacteria to be resistant to whatever they want.

  145. Re:Another side effect... lesser known by Graspee_Leemoor · · Score: 1

    "If you have a cold and/or mild/moderate sinusitis, deal with it..."

    Fuck me, Americans take antibiotics for a cold ? You learn something every day, I guess... What is the world coming to ? It's like the way patients have gas before the injections at a dentist- I can't understand it. What a wuss culture !

    graspee

  146. Well... it does. by c.emmertfoster · · Score: 2

    The evolution of antibiotic-resistant bacteria proves that all life evolved from a single cell.

    Or in other words: "From a drop of water, a logician could infer the possibility of an Atlantic or a Niagra without having seen or heard of one or the other."

    The distinction between microevolution and macroevolution is one of semantics.

    --
    We can neither love nor pity nor forgive. If you make a slip in handling us you die!
  147. $50 is cheap? by Rob+Simpson · · Score: 1
    "The only bummer is, it's very inexpensive. You can make it yourself easily or buy it cheaply pre-made, variety of places."

    Yeah, right: http://www.robeysilver.com/silveraid/bottled.htm

    $50 for a bottle of colloidal silver, $2 for a bottle of penicillin-VK, hmm...

    1. Re:$50 is cheap? by zogger · · Score: 2

      --make it yourself or shop around better. to make it your self you need 3 or 4 nine volt batteries, a couple of pieces of wire, some .999 pure etc silver wire, and some alligator clips. It's just not that hard to do, or get a kit, many out there. I agree, 50$ for a bottle of cs is outrageous, like I said in my original post, a lot of people are just not conviced anything might *even* work unless they drop large sums of cash on it. That's a human condition beyond my understanding, but there ya go, a lot of people are afraid to learn to do new things. I honestly don't know why this is.

      And I'll repeat, I am against quackery myself, but I don't limit myself to this "either/or" argument. I'd say there's just as much or more quackery in the high priced "official" medical field as any place outside that field. It's human nature in business, yep! Humans will lie to make a buck! One guy working out of his garage might lie (make millions from your computer by enlarging the size of your mortgage's penis from nigeria, etc), and maybe a multi billion dollar corporation might lie(please buy globalworldron's stock, it's the path to riches!), it just happens. Best you can do is accumulate your own knowledge, take the high extreme ends off the argument, then average it out, go from there. IMO

      Oh,picky point, the 2$ penicillin price, add in doc office visit for the prescription,plus lost work time for the visit, brings it right back up to that 50 buck figure or a lot more.

  148. A variety of reasons... by Rob+Simpson · · Score: 1
    1) Making things more complicated than they have to be is generally just a bad idea.

    2) In some cases this is done - "cotrimoxazole" (aka Septra, Bacrim) is a common combination of sulphamethoxazole and trimethoprim, which block two different parts of folic acid synthesis (needed to make nucleic acids). Theoretically, this should reduce the risk of resistance.

    Most importantly, 3) combinations of antibiotics can have reduced effects. B-lactams (penicillins, cephalosporins) are most lethal to rapidly growing cells, since they block effective cell wall synthesis. Drugs like tetracyclines and macrolides (erythromycin) block protein synthesis and slow cell growth to a crawl (so that the patient's immune system can mop it up easily, assuming the patient has one). Combining the two is just dumb.

    However, aminoglycosides (gentamicin, etc.) are often used synergisically with B-lactams, since the latter damage the cell walls and help produce leaks in the membranes of gram+ve bacteria, making it easier for the aminoglycoside to get through the thick cell wall into the nucleus.

  149. GM Frankenfoods by Anonymous Coward · · Score: 0

    Eat GM Genetically modified foods, and a resistant bug, and bingo, super bugs.
    The GM kitchen scraps, serve to breed triffids in the garden

  150. drug companies by Anonymous Coward · · Score: 0

    There has been a very good antibiotic available for 90 years that kills all bacteria, and they can not develop a resistance to it. It's called Colloidal Silver. In the USA, the drug companies have put pressure on the government to stop websites promoting it. I have used it myself to heal myself of a serious, re-occuring bronchial infection, conventional antibiotics were having no effect on it, but within a week of taking collodial silver, i could breathe normally! Check out http://educate-yourself.org and www.hwize.com

  151. Prophylactic prescription of antibiotics by Anonymous Coward · · Score: 0

    I wonder what impact the widespread prophylactic prescription of tetracyclines (Doxycycline in particular) for malaria is having on other bacteria. I (and many others on my team here) have been on Doxycycline for months to avoid malaria. This could be construed as socially irresponsible, but I prefer that to the side-effects of other common malaria prophylactics, such as mefloquine, chloroquine, and hydroxychloroquine sulfate.

  152. Re:Another reason why GMO antibiores markers is ba by Anonymous Coward · · Score: 0

    I do not buy this:
    antibiotics in GMOs are always ones which are not really used in medicine anymore, and certainly not related to vancomycine or methilicine.
    Most used for GMOs (in plants) are tertracycline and sometimes hygromicine.
    And recently other things are used as well (BASTA resistance for instance).

  153. Golden Staph by Azahar · · Score: 1

    Having lost two relatives to golden staph in the last twelve months, both of whom went into hospital with terminal conditions and both of whom died of staph instead. This particular Geek chooses to die with his pocket protectors on.

    --
    Cuiusvis hominis est errare; nullius nisi insipientis in errore perseverare.
  154. Oh grow up... by Anonymous Coward · · Score: 0

    (S)He's pointing out that there's no point in trying to force everyone to be a vegitarian because other than narrow social agendas it serves no purpose.

    It appears a pet ox of yours has been gored (but now that it has, we can make a great bar-b-q from it!).

  155. Yes, I am by Anonymous Coward · · Score: 0

    "Please tell me you're ten years old"

    I'm 11. But my point is still valid. I'm sorry you can't refute it. Please tell me you're 12 years old.

  156. Maggots! by Colin+Smith · · Score: 3, Informative

    Not kidding...

    http://news.bbc.co.uk/2/hi/health/1907065.stm

    --
    Deleted
  157. A really silly question from a non-medical person. by wwwssabbsdotcom · · Score: 1

    I have been taking Cipro for a under the skin infection which was caused by a hit to the shin (sparring accident with someone's knee in martial arts) and it got infected after a few weeks. No breaking of the skin was apparent, just the pain which slowly went away. My doctor put me on 10 days of Cipro since the infection looked quite serious. I know the requirement to take all 10 days, and intend to (2 days away) and the infection is going down and clearing up in color and size, but I have a question. To those people who use antibiotics as prescribed and complete there use, does using antibiotics throughout your lifetime make you more prone to resistant bacteria in your old age, or is it more a combination of the environment, hospital workers, clean environments (or not), and just the normal progression and evolution of these bacteria? Thanks, not in the medical field, and I know there are many books out there on this topic which I intend to read, Im sure those books would answer that question, but was curious.

    --
    Relive the BBS Past - One Byte at a Time! www.ssabbs.com
  158. Cow farts by Cro+Magnon · · Score: 2

    Nah! Everyone knows the average politician produces 3 times the methane of the average cow. And the politician produces it from the FRONT end!

    --
    Slow down, cowboy! It has been 4 hours since you last posted. You must wait another few hours.
  159. Re:Grapefruit Seed Extract - the natural alternati by Reziac · · Score: 2

    Thanks, that pretty much answers my question as to why apple seeds cure canker sores. As noted I did wonder if it was a cyanide-family compound, given that the smell is similar to apricot and other pit-type seeds, and that there was also a fairly reliable tissue-numbing effect. Probably not the best thing to ingest in large quantities. :)

    Flaxseed meal is now sometimes used in dog food. There is some question in my mind (as a longtime professional breeder/trainer) that some ingredient relatively new to dog food may be causing infertility, tho my first thought had been the high hormone levels that come with chicken from certain sources. Any idea whether this B-17/laetril has a negative impact on fertility?

    --
    ~REZ~ #43301. Who'd fake being me anyway?
  160. Re:Another reason why GMO antibiores markers is ba by SysKoll · · Score: 1

    The benefit of using an antibioresistant gene as a marker is that you can use standard reagents to look for it even in non-bacteria, or so I have been told. It's a matter of tooling.

    --

    --
    Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/

  161. Re:Another reason why GMO antibiores markers is ba by SysKoll · · Score: 2

    Thanks for your reply. Very interesting point. If you have points, please mod up the parent.

    However, my concern is that by swamping the environment with resistance genes for even "obsolete" antibiotics, we are making sure that these antibiotics will never be effective against anything anymore. That's one less weapon in a tough fight.

    After all, the number of new antibiotics marketed in the last 20 years is quite low. Are we really sure we can afford to write off an antibiotic?

    There are publications saying that if you stop using a selecting agent such as an antibiotic for a long periond of time, the corresponding ABR gene will probably mutate and degrade in most strains, making the antibiotic effective again, at least for a few years. But if you have copies of this ABR gene all over our crops, it will probably never disappear from bacterias in the wild.

    Also, an AC below is making a point about BASTA resistance about which I know nothing. Care to elaborate?

    Again, thanks for your reply.

    -- SysKoll
    --

    --
    Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/

  162. "slippery" soap by Oo.et.oO · · Score: 1

    i'm not sure if soap lowers the surface tension. or if that's the same as what i think it does.

    what i thought, was that soap works as an emulsifier , allowing oil to dissolve in water. most of the dirt is stuck to oil and grease. so the grease is dissolved, and the water carries it and the dirt away.

    i guess both these things are simplifications.

    "What are we doing tonight?"
    "Tonight we make soap. In order to make soap, first we must render fat."

  163. Moderators on drugs and ignorant. by jotaeleemeese · · Score: 1

    Nice to see you modding up Hitlerian propaganda.

    --
    IANAL but write like a drunk one.
  164. Seals. by jotaeleemeese · · Score: 1

    They are surely no friggin transitional forms between a fscking mammal that used to live on dry land and a mammal that eventualy may live on water only. No they are not. They were created like that. Thank the Lord for that.

    In a sense any form of life is a transitional form. We could be evolving into something completely different and of course we are not aware of it and consider ourselves (or any other species whith which we are familiar) "non transitional" which of course is a load of rubish.

    --
    IANAL but write like a drunk one.
  165. In some cases it does work... by Lynx0 · · Score: 1

    I remember someone from the medical field mention what they often do when there are bacteria in an operating room that are resistant to one or many desinfectants: They open the window for some time. The competition kills most oft the resistant bacteria. This is competition with many different species of bacteria though, not just one. The resistant species/strain is only successful in the very special niche of an enviroment of desinfectants, if you open it for all kinds of species it's likely die out.

    Hence, it's probably not a good approach for a treatment, you could never *completely* (to the last cell) outcompetition one strain with another of the same virulent species.

  166. Wow! by Anonymous Coward · · Score: 0

    Can you imagine a beowulf cluster of these?

  167. Re: stainless steel by ichimunki · · Score: 1

    Hmmm. Wonder if this is a convincing enough reason to start telecommuting... "boss, I can't possibly come in to the office. It takes four hours to four days for bacteria to die after someone touches the mens' room door. Do you really want me waiting in there that long, just to be on the safe side?"

    --
    I do not have a signature
  168. Competition among bacteria . . . by dhakk · · Score: 1

    The theory is sound only if the resistance causes a notable decrease in survivability. The problem is that the amount of time that it will take to outcompete the other bacteria would mean that much more time the patient has to live with the dissease (and generally we're not worried about a dissease becoming resistant unless it affects humans badly enough to really want to get rid of it quickly). In support of this theory we can look to the non-bacterial case of the Hepatitis B virus- which sometimes has in its capsid a viriod (only animal viroid actually) called Hepatitis D which competes with B and has the effect that if a person is coinfected with both, the two more or less cancel each other out and the disease does not turn into the nasty chronic form of Hepatitis B . . . however D can also make things worse if B has been in the body for awhile . . . A more promising way to use some third party help would be to try to find bacteriophages (viruses that attack bacteria) that attack the specific virus in question. The chance that a bacteriophage would switch targets to a higher organism (such as human) is very small, and definitely a lot smaller than the chances the person would be irreversibly damaged by letting competitive bacteria grow. Only problems are finding a suitible bacteriophage that doesn't produce any nasty toxins while its killing the bacteria and finding a bacteriophage that our immune system doesn't immediately destroy - so maybe in a few decades : )

  169. Re:Another reason why GMO antibiores markers is ba by Anonymous Coward · · Score: 0

    ofcource you can use it on eukaryotes! It just depends on which kind of organism you try to kill (remember, a fungus is also an eukaryote, and they are hard to kill because you need an euk. specific antibioticum, which does not kill you).

    kanamicine and hygromicine we often use to kill plants which do not have the resistance gene, so it definately works.

    AFAIK some of these antibiotics attack cell walls, and since plants, and bacteria have cell walls (although there are differences) they can be used.

  170. Re:Grapefruit Seed Extract - the natural alternati by Zurk · · Score: 1

    hmm..doesnt seem to but it might. delaware allows it to be used freely with not restrictions .. dont know about other states. http://www.delcode.state.de.us/title16/chapter049. htm

  171. My experience with MDA/MRSA by Anonymous Coward · · Score: 0

    In 1997 I had a Bank Cartlidge repair at a very large hospital. I was discharged after 3 days.

    Now I was going to the Orthopaedic Outpatients clinic every week, and was getting very worried that the wound wasnt healing. The Hospital Staff took a swab and next week said "Just a common infection, nothing to worry about" and gave me some antibiotics.

    The wound and infection got worse and worse. My GP was changing the dressing daily, being extremely paranoid about infection etc, until he decided "To hell with this, lets take a swab".

    3 days later I got a letter from the Pathology Lab . It was in red print, all caps, and said "See your Doctor immediately as you have a potentially lethal infection.

    I raced to my GP, he'd just got the report the same day. Out of the 30 antibiotics theyd tested my swab against there were TWO that my Staph responded to, Vancomycin and another whose name I dont recall (I was VERY sick by this stage). I went on a course of this second pill. I took it for 10 days, if you take it for 14 you die of liver failure. Fortunatly it did knock the infection.

    Now I have a rather dodgy right shoulder. I am in constant, chronic visceral pain. MRI of my shoulder shows that it's a bit of a mess in there, there are tendons eaten out, bone eaten out, wierd bone processes grown that impinge on the big nerve in there.

    I attend a chronic pain clinic every few months, and it used to give me about 2 weeks of relief (spinal nerve blocks). The last set of injections gave me 4 days relief.

    My kids dont like me anymore, as I dont do much, and am a cranky bastard thanks to my pain. I can get prescriptions for morphine, but that doesnt help me function at day to day stuff like being a Dad. I dont sleep much, cant eat much and am chronically depressed.

    I find myself wondering if jumping in front of a train would be easier.

    Why dont you sue I hear you ask? Because according to the lawyers I can afford I won't win - the Medical Defender will turn it into a case about where I got the infection and it can't be proven to have been the Hospital. The case should be about that swab they took, as I have seen a Hospital document that shows that they kew it was MRSA but still prescribed Methicillin for it.

    MDA/MRSA sucks. Anyone else who has sufered it has my pity, as (based on my experience) you are never the same, and it affects the people around you in a huge way, even when you do beat the infection.

  172. Alcohol! by Anonymous Coward · · Score: 0

    I have often avoided having to go ask for 'serious' medical treatment (anti-biotics or otherwise) of infected wounds through a simple and cheap do-it-yourself medical procedure. Soak the infected part(s) in alcohol. Bacteria cannot 'adapt' to it. Maybe you have seen the recent stories about hospitals switching to alcohol gels beause they are more effective than soap (even 'anti-bacterial soap') and water. It works out in the realw orld, too. Obviously, if you've got an infection running rampant through your entire body it's a bit late in the process for a 'simple' intervention. But, if you caught it early and placed your infected limb in alcohol or put gauze soaked in alcohol on a body wound you'd kill the vast majority of the bacteria in the wound site and your body would have a much better chance to completely stop the infection.

  173. Add it to the list... by nowt · · Score: 2

    e(x) population growth. How long can it continue?

    --
    A strange game. The only winning move is not to play. How about a nice game of chess? - Joshua (Wargames)
  174. well, yes by freejung · · Score: 1

    It is. But you can deal with it. I think staph is mostly dangerous to people with compromised immune systems.

  175. Re:Maggots! (mod parent up!) by freejung · · Score: 1
    Wow, thanks for the link! That's truly amazing!

    This would totally work. The maggots would remove the dead flesh easily and painlessly. With the wound clean it is easy to cure! That's awesome, thanks very much!

  176. Re:Grapefruit Seed Extract - the natural alternati by Salamander · · Score: 2
    As a nursing student I will be trying to bring this into any hospital I eventually work for.

    Doing your part to increase antibiotic resistance in the hospitals, eh? You do realize that some organisms will resist the GSE's effects, and then transfer that resistance to nastier bugs, right? Right? IMO doing what you suggest should be a firing offense.

    Please take a couple more microbiology and public-health classes before you leave nursing school...and before you start killing people.

    --
    Slashdot - News for Herds. Stuff that Splatters.
  177. Re:Another reason why GMO antibiores markers is ba by jeff4747 · · Score: 1

    The standard reagent used is the antibiotic.

    You put ampicillin resistance in the plasmid you're putting in the bacteria, then you grow the bacteria in a solution containing ampicillin. Thus, you kill all the non-modified bacteria. It's a selection method.

    Since antibiotics can't kill the corn, how would you use it to eliminate the non-modified corn?

  178. Re:Another reason why GMO antibiores markers is ba by jeff4747 · · Score: 1

    Antibiotics only kill bacteria.

    Antifungal products kill fungi.

    Anti products kill plants.

    The same drug can't kill fungi, plants and bacteria via cell walls because all of their cell walls are quite different. Plants use cellulose, Fungi use chitin, bacteria use a variety of other chemicals. Chemicals that break down one won't break down the others, so for example you can digest an insect (used chitin) but not the fiber in a leaf. (Technically, a chemical that breaks down chitin could be used on some species of bacteria that have chitin in their cell walls, but AFAIK most bacteria don't use chitin).

    Antibiotics operate in a variety of ways on bacteria, which is good since not all bacteria have cell walls to attack. They attack proteins within the bacteria that are critical for growth, such as the proteins that build or maintain the cell wall. There are others that block various metabolic pathways. So resistance to ampicillin (attacks cell-wall mataining protein, I think) does not confer resistance to Tetracyclin (don't remember what this attacks, but it's not related to cell walls).

  179. Re:Another reason why GMO antibiores markers is ba by SysKoll · · Score: 1

    You sure about the standard reagent? I have read about something more elaborate such as immunokit-based indicators. Then again, corn is a bad example. Stick to bacterias.

    --

    --
    Mad science! Robots! Underwear! Cute girls! Full comic online! http://www.girlgeniusonline.com/