Life Made to Order

Roland Piquepaille writes "When he was president of Celera Genomics, Craig Venter was the leader of the private project which deciphered the human genome. Now, he has another goal: create custom-made organisms -- one DNA letter at a time. 'Venter's objective is not merely to tweak existing life forms by inserting genes that confer specific traits -- the main tactic in conventional genetic engineering. Instead he wants to assemble an entire genome, DNA letter by DNA letter, putting together only the genes he wants: those necessary for an organism's survival and those that will allow it to carry out a desired task.' If successful, maybe in a decade, this could yield new sources of energy or novel drugs. Venter is not alone in this quest. Other institutions, private companies or universities, have similar efforts under development. Check this column for a summary of this eye-opening -- but quite long -- Technology Review article."

Comments

Here it is

[Henry V .009]

This is the real nano-technology. First we bio-engineer the tools we need to create whole genomes quickly. At that point, we can make designer bacteria or other organisms. The potential of that sort of technology is nearly unlimited.

Re:Here it is

[The Only Druid]

Actually, the irony of your statement is that we're going to need better nano-technology to complete the task. As enthusiastic as these companies are, the problems in intentionally constructing a DNA molecule letter by letter are huge: notably, if you screw up in one spot, you can have tremendous problems.

Further, there's no "spell check" for them, using current methods. They wouldn't know they had a problem until they start letting it reproduce, only to find that they have an [apparently] inexplicably error, possibly making the organism unviable.

Whats needed is sophisticated enough nanobots that will be able to not only perform the construction of the DNA, but to "spell check" it by running up and down its length continually, comparing it against the desired pattern.

Re:Here it is

[huntz0r]

and then CleverNickName accidentally lets them loose and they take over the ship. Oy vey!

Re:Here it is

[eenglish_ca]

Nano technology is the future, look at a sci-fi example, borg nanoprobes can take over your body in a matter of seconds. Imagine what someone could do with such technology. We could design bacteria that would repair ourcells so that we could live forever, build muscle tissue, regenerate tissue in wounds to prevent and eliminate scarring. Isn't bacteria already genetically engineered for tasks such as these? The production of insulin...

Re:Here it is

[Henry V .009]

You've pointed out the main problems. We need to create the tools to be able to do this. But like I said, I imagine that those tools we create or modify will be organic (DNA based). Organisms already do so much of those error checking and construction tasks that I think it will be easiest that way.

Re:Here it is

[whovian]

Looks like you're designing DNA!

Genome Assistant can help
you compose your artificial sequence.
First, tell us how you plan to design it....
-- Clippy

Re:Here it is

[jmt9581]

I don't really think that nanorobots are necessarily the answer in this case. Spell checking could be done by DNA sequencing, which is currently expensive but there are efforts to develop new techniques that would make sequencing cheaper. I think that a new, cheaper sequencing technology will will be released long before DNA-synthesizing nanobots.

However, I must admit that nanobots constructing DNA would be really frickin' cool. :)

Re:Here it is

[Anonymous Coward]

> Nano technology is the future, look at a sci-fi example

Whoa there, camper. The Borg are fiction not reality. Come over and play the next time you have real world allegories and anecdotes.

Re:Here it is

[ShadowDrake]

> Actually, the irony of your statement is that >we're going to need better nano-technology to >complete the task.

I could see sort of a "bootstrapping" thing. If a small bacteria is producible, perhaps you can create such a bacteria whose purpose is to assemble a component for a larger bacteria (five different classes make DNA sequences A, B, C, D, E, and five more bind A->B, B->C, C->D, D->E, E->A, or even to "infect" and modify another cell to serve the true purpose of the project.

Re:Here it is

[Sgt York]

Whats needed is sophisticated enough nanobots that will be able to not only perform the construction of the DNA, but to "spell check" it by running up and down its length continually, comparing it against the desired pattern.

These exsist, in the form of enzymes. These organisms would have their genome checked in the same manner as you and I; cellular repair enzymes would monitor for problems. They would start with microbes, simple bacteria. Ther would be maintained like a multicellular organism,. though; large errors would trigger a death response.

There are "spell checkers" of a sort. Each gene would be assembled individually and checked. Most errors in the coding sequence would result in glaring problems with the resultant enzyme. The big problem would be in the regulatory regions; all permutations would have to be checked individually and together.

I would imagine starting with a normal organism similar to what you want; you would then knockout genes and resupply them with engineered ones as you went along. This is a common technology, people have been doing it for years to test function of genes.

I wish I had more time to go on, but I have a timer going off in a few seconds...I gotta go

Re:Here it is

[Gumshoe]

Not important but the letters used to describe DNA sequences are G, A, T and C. It's easy to remember: think Gattaca.

Re:Here it is

[Asparfame]

That's a major problem, which I think will take several years to solve (not with nanobots, but with better hijacking of biological systems). But it is dwarfed by the problem of identifying the right cocktail of proteins necessary to get the DNA to work in a living cell.

Venter is known in the public genomics community as an ambitions, ruthless, and unprincipled egotist. Example: At the end of Celera's (Venter's company) much publicised private human genome project it was revealed that the genome they had sequenced came in secret from none other than - you guessed it - Craig Venter. If that isn't vanity...

Re:Here it is

[tfoss]

Oh come on. This is wrong on so many levels.

ctually, the irony of your statement is that we're going to need better nano-technology to complete the task.

No. Nanotechnology is completely uninvolved in this. These guys are chemists, biochemists & geneticists not engineers.

As enthusiastic as these companies are, the problems in intentionally constructing a DNA molecule letter by letter are huge: notably, if you screw up in one spot, you can have tremendous problems.

No. Making DNA base by base is not difficult at all, and has not been for many years. DNA synthesizers can churn out oligos of good purity of lengths into the 100s of bases. Need longer? Make ligatable overhangs and have an enzyme put them together, ligation techniques are trivial molecular biology. As for mistakes, of course they happen, but any scientist worth her salt would sequence it along the way. Remember that Human genome project thing? That was just a lot of DNA sequencing. The machine mentioned in the long article as a long seqeunce synthesizer is just a robotic version of a bench biochemist doing what i described.

Further, there's no "spell check" for them, using current methods. They wouldn't know they had a problem until they start letting it reproduce, only to find that they have an [apparently] inexplicably error, possibly making the organism unviable.

No spell check of making sequences? True, sort of. During the synthesis there isn't, but sequencing it post symthesis is absolutely trivial.

Whats needed is sophisticated enough nanobots that will be able to not only perform the construction of the DNA, but to "spell check" it by running up and down its length continually, comparing it against the desired pattern

Ugh!These are called enzymes. Nanobots as normally pictured (a little robot with arms and pincers etc etc) are just pure science fiction. This is one of the worst areas of pop science literature.

This project is simply a lot of molecular biology, nothing novel in the techniques. What's new is trying to design a genome by hand as opposed to letting nature do it. I am skeptical that 1. it will work (beyond copying known genes), and moreover, 2. it will be even close to what evolution can/has accomplished.

What got kind of mushed together in the articles is a totally different aspect, that of non-natural amino acids. Peter Schultz;s lab (which is just down the hall from me) has created a system where a bacteria can incorporate an amino acid that is not one of the twenty used in natural proteins. You can add amino acids with all kinds of novel chemical groups and see if you can evolve proteins/organisms to work better with this expanded toolkit. Pretty cool.

-Ted

Re:Here it is

[usotsuki]

I think the Borg are pretty real - Billy boy's one of them! LMAO

-uso.

We are here to help.

[Anonymous Coward]

Ripley, we are here to HELP you...

sounds like..

[Reikk]

Sounds like something out of a really bad comic book.

I can see it already...

[mistermund]

Instead he wants to assemble an entire genome, DNA letter by DNA letter, putting together only the genes he wants:

Neck bolt by neck bolt, green skin, flat head with scar on forehead, demeanor not unlike a geek without caffeine, and bring it all to life with a strategic bolt of lightning that hits the castle on top of the old hill....

...Yeah, that's the type of stuff we should be tinkering with!

Re:I can see it already...

[wideBlueSkies]

>>Neck bolt by neck bolt, green skin, flat head with scar on forehead,


You mean like this guy?

This is news? Dr Franekenstein has been fscking with DNA for years.

Get with the times folks.

Re:I can see it already...

[Anonymous Coward]

Why would you want to re-invent Bill Gates? Besides, you can do better.
When do we get to the part where two junior
high school kids put bras on their heads and
fire up their Commodore VIC-20's and custom
engineer a naked Kelley LeBrock in their bedroom
shower........the movie 'Weird Science'?
Or do they just unknowingly invent the
Andromeda Strain and turn it loose?

ingenious

[Anonymous Coward]

Once this works, Microsoft can create programmers from the start and doesn't even have to pay them much! Perfect!

But should we?

[john82]

The potential capability of being able to engineer DNA sequences makes a myriad of SF nightmares seem like fanciful daydreams. Consider a DNA equivalent of the "Island of Dr Moreau". What would the biological landscape look like populated by viable hazardous failures that aren't what such a new age alchemist intended? The possibility for creating the butterfly that ends civilization is far too frightening to launch ourselves into this blindly. We've been lucky with a few "accidents" that have benefitted mankind (like lexan). How do we explain to the rest of the world, "Oops, we just created an organism that will make you defenseless against the common cold. So sorry." I'm not often in favor of government interference, but someone has got to put the brakes on this idea before it even gets off the ground.

Re:But should we?

[DaLiNKz]

...that is a bit scary. I can see it now, a butterfly lands on a guys arm, everyone around him screams and runs..

Re:But should we?

[Anonymous Coward]

Ever see the recent Island of Dr. Moreau movie? Guess what technology they use instead of vivisection?

Re:But should we?

[Kierthos]

Shit, if we're going to have scientists mucking about trying to create new lifeforms, let's bloody well do it in an orbital station, or on a moon-base so if something goes wrong (according to the movies, the chance of something going wrong approaches 100%), it's not like the damn killer microbe can get back to Earth.

Kierthos

Re:But should we?

[littleRedFriend]

Sjeesh, the government should interfere with you, so that at least
you would take some time to form a real opinion.
You don't even know what you're talking about. Brr, it looks scary.
I don't understand it. It must be stopped.

Time will tell that this is for the benefit of mankind, and your opinion
will be in history books. Alongside ideas that the earth is flat, and
that steam engines hurt the economy.
And then there is always: you can use a knife to cut bread or to kill someone.

Please spare us this nonsense panick reaction.

Re:But should we?

[john82]

Okay let me make it clearer for you:

1. Venter has helped lay out the building blocks, but he doesn't have a real idea how all the parts interact. That's why he wants to put some of the parts together: to see what happens.

2. For years we've been giving kids anti-biotics. Guess what? Now we've got mutated bacteria that don't respond to the current course of meds.

3. Ask the folks in Europe if they want any of America's genetically engineered crops or the beef we've fed it too. No?

There are TOO many unknowns about f*cking around with DNA you stupid twit. This isn't Legos we're talking about. It's creating organisms that don't occur in nature. They didn't have to fight through natural selection, don't have any counter balances in nature. It's the possibility (and a good one at that) of creating one that, oops, CRAIG DIDN'T anticipate.

I do understand the problem. THAT's why I'm concerned. It doesn't have a damn thing to do with what you cited. The problem here is thinking it's okay to play GOD without understanding the ramifications.

Btw, are you glad that Oppenheimer and company figured out how to make an atomic bomb? Or do you dismiss that with a wave of your hand too?

Re:But should we?

[littleRedFriend]

All I'm saying is that society will need to decide in a rational way. Not in an emotional one.

You might be right about some of your concerns. Just like you are right about Oppenheimer, it was the people who decided this was for the benefit of mankind (it was the military, mostly). And it has it good and bad sides. In this case the good sides (including using it as a weapon) were decided to be more important than the bad ones (can't think of any right now).

"We should not play God" is a completely wrong, misplaced, argument. First, I don't believe in God, other than it being an instrument that is used by smart people to repress the more gullible ones. Any argument involving God is not taken seriously by me. That does not mean I don't respect people who want to believe. IOW, I respect people, but not their believes.

Second, mankind will have to learn how to deal with powerful technologies like this anyway. Denying their existence is not the solution. Banning technology because of its potential dangers is not going to work. Not now not ever. I will do everything to convince anyone of the truth of this very important observation.

Sorry about the (not intended) flaming. I just a have a strong opinion. I fully understand the technological stuff behind all this, since I am a scientists in this field.

Mmmm

[DaLiNKz]

I would like a side of genetically created fries without the use of a patato with that.

Re:Mmmm

[wkitchen]

Why without potato? Just grow long thin skinless potatoes to eliminate the peeling and slicing steps.

Cold Cure V1.0 Product Recall

[nagora]

Version 1.0 of our anti-cold virus virus has developed an error whereby it instead shuts down the customer's nerve system. The company acknowledges that more debugging of the genetic code should have been done and assures any surviving members of the human race that these issues have been addressed in version 1.1. This is a pre-recorded message as I'm afraid we're all dead at the moment.

TWW

Re:Cold Cure V1.0 Product Recall

[shfted!]

That post reminded me of the late Douglas Adams....

Re:Cold Cure V1.0 Product Recall

[nagora]

That post reminded me of the late Douglas Adams....

That'll be the Magrathea (sp?) reference at the end.

TWW

Pets..

[altek]

Imagine the new market for customized pets.. It wouldn't be too cool when your pet Balrog-look-alike turns on you though and tears your limbs off.

I would get a pet ostrich with the head of an antelope.

Re:Pets..

[Anonymous Coward]

I want a six-inch tall elephant.

IF it can be housetrained.

Starcraft ...

[Alapan]

If he has played Starcraft, he will know what genes to avoid absolutely. The Zerg and the Protoss were afterall created the same way ...

How scary is this?

[Montgomery Burns III]

Consider this: How well have we done writing software to perfection?
How well have we done predicting all outcomes of chaos?
I submit not very well. Lets not multiply our error in living creatures.

Re:How scary is this?

[arvindn]

Hmmm.... the article addresses questions similar to yours:

Not only does designing genomes from scratch allow researchers to engineer new organisms with extreme precision, Venter says, it also allows them to strip the cells of a host of natural functions needed to survive and reproduce in the wild. As a result, synthetic organisms would function only under tightly controlled or rarified conditions such as those inside a biological pollution filter on the smokestack of a fossil-fuel-burning power plant.

A lot like what they tried to do in jurassic park but failed. Yeah, sorta scary. What if the "bad guys" got hold of some of the organisms and enabled them to reproduce in the wild?

Re:How scary is this?

[The Only Druid]

This is one of the things annoying about Jurassic Park, actually: if they hadn't made predators (i.e. they'd stuck to herbivores), they'd still have some of the largest and most impressive animals in the history of the world, without any of the risks we saw in the books and movies. Basically, the park would have worked with herbivores...

Re:How scary is this?

[jmt9581]

Even more frightening is the fact that we understand the fundamental axioms of biology way less than computer science.

A good example is protein folding: given the sequence of amino acids in a polypeptide chain, scientists don't currently have a reliable way of determining how the protein will fold in 3-dimensions.

An analogy with computer science would be scientists posessing source code to a C program, knowing that a compiler somehow turns it into a binary, but having no understanding of how the compiler works and also having very little idea of the purpose of the program.

Re:How scary is this?

[Martin Blank]

Even more frightening is the fact that we understand the fundamental axioms of biology way less than computer science.

This is because with computers, we've started big and worked our way down, understanding each step as we went. Here, though, we're starting at the most basic level that we know -- self-replicating molecules -- and working up. I submit to you that this would be more analogous to coding in binary, testing the results as a few more bits were added each time to see what the result was. Sometimes you might get a working effect out of it (good or bad); more often, you'd get either no function or an error. Eventually, you might get a viable BIOS -- or you might get a virulent worm. It all depends on how quickly you move.

Re:How scary is this?

[DoraLives]

Yeah, nice safe herbivores. Kinda makes you wonder what a bunch of these guys could do if a notion was to strike them.

Re:How scary is this?

[error0x100]

How well have we done writing software to perfection?

Actually, pretty well, if you consider the world outside Microsoft. People generally make software as good as it needs to be. Airbus and Boeing planes with hundreds of critical built-in software systems routinely make flights thousands of times each day around the world - when was the last time one of these had an accident caused by a software failure? Air traffic control at airports all over the world, handling at each airport anything from hundreds to thousands of flights per day, rely on software systems. When last did you hear of an airplane accident caused by software failure on the ATC systems? Thousands of modern cars on our roads make use of embedded software control systems; when last did you hear of any of these failing? Millions of people use cellphones every day, and I have never heard of a case where the software on a cellphone failed. From telephone switching equipment to nuclear power stations to subway train management systems to fighter jet control systems to oil tanker guidance systems to alarm clocks, pocket calculators, washing machines, microwaves, hi-fis, DVD players, video recorders, digital cameras, to the hundreds of satellites orbiting our planet, the other spacecraft we've sent into space (e.g. Mars rover, SOHO etc), to the systems used by banks, I'd say we've done a pretty good job of making software reliable.

PCs, and in particular those running Microsoft software, stand out BY FAR as being absolutely the most failure-prone software humans have ever created. But Windows represents only a tiny portion of software in general. Software gets a bad rap because most people are exposed mostly to Windows, but software has become such a ubiquitous part of our society that we don't even notice the hundreds of working systems that we rely on every day.

When you look at society as a whole, and how much DOES work every day, and how much we truly have mastered technology, and how much we have built, I'd say we have done an excellent job of predicting and managing all reasonable outcomes of chaos.

Software is made as reliable as it *needs* to be. You might see the software crash on the arrivals/departures TV display in an airport, since that can just be restarted, but you won't see such high levels of failure in the airplanes flight control software, that would be a disaster.

I guess a problem with "genetic design" is that even one mistake could possibly create a VERY serious disaster. But mankind will push forward with these technologies, it is inevitable. Lets hope the genetic designers realise the seriousness of their business, and hold themselves to at least as high standards as the software programmers for Airbus flight control systems.

Re:How scary is this?

[spotted_dolphin]

With just herbivores around you'd have a lot of dead dinosaurs after they've eaten all the foliage available. Ecosystems are in a delicate balance between number of prey and predators; numbers increase and decrease in cycles.
A lot of predators kill off their prey; the number of predators decrease (due to lack of food) and the number of prey will naturally increase as well as predators and then it starts all over again.

Re:How scary is this?

[The Only Druid]

Its a theme park, i.e. a zoo. We dont try and reach environmental equilibrium in our zoos: we bring outside food in, and feed the tigers, the wallabies and the zebras. Why wouldn't we just bring in outside food from Jurassic park to feed them?

Re:How scary is this?

[mike3411]

This assumes you can stand the irony of bringing an animal back to life just so that you can kill it....

Life made of

[Anonymous Coward]

Life is made of Evangelion.
Now go vote: http://www.anime-xtreme.com/polls/index.php

new possibilities

[heitikender]

along the usual stuff like creating organisms from scratch and superhumans, we can also have smaller cell phones (!). Maybe this time a real one-cell phone?

Re:new possibilities

[Martin Blank]

Where would I put my new device that gives me the equivalent of a 60-foot antenna? I paid $19.95 + S/H for this sticker-- I mean, for this incredible innovation!

Re:new possibilities

[Dave2 Wickham]

A Real One mobile phone??? No thanks!

all i want to know is....

[Anonymous Coward]

how long till monster.com
starts having opportunities for "genetic designers" or "dna engineers"?

Re:all i want to know is....

[Anonymous Coward]

Soon actually.
E.g., MIT ran a lab course on this stuff in January

http://web.mit.edu/synbio/www/iap/

Re:I have a great Idea!

[robbo]

Reminds me of a cartoon that somebody pasted on the door to our lab several years ago:

Journalist: Dr, how do you respond to your critics that say you're playing god?
Dr: I strike them dead with a bolt of lightning.

Scary

[Musashi Miyamoto]

I heard about scientists trying to create a new type of organism a little while ago... It scared me then and it scares me now.

However, I would think that it would be totally possible to generate TONS of energy and other useful things from something like this. It might be possible to generate oil from sunlight. Huge tanks of stuff making food, energy, whatever.

The ethical complications are interesting.
If you create a new life form, do you have the right to destroy it? Maybe. If you can re-create it at a whim, why not? But then, what about existing life forms? Eventually scientists might be able to re-create just about any species in a petri dish. Can they then justifiably destroy a species, since they can re-create it at any time?

Cool sci-fi... or more accurately, cool sci-soon-to-be-not-fi.

Re:Scary

[schmink182]

If you create a new life form, do you have the right to destroy it?

I can see it now...

Critic: "You can't kill this creature, it has feelings just like the rest of us."
Doctor: "Nonsense. I made this creature's DNA, and I don't remember giving any feelings."

Re:Scary

[Steeltoe]

If you create a new life form, do you have the right to destroy it? Maybe. If you can re-create it at a whim, why not?

"Right" is a nonsensical word. There's noone out there granting or revocing rights, really, it's all a big con...... *ZAP!*

Re:Scary

[m3573]

If you create a new life form, do you have the right to destroy it?

Generating a new life form out of DNA is not the same as creating something completely new, so the answer to the above question depends on a more general one, which is:

Is The Universe GPLed?

Re:Scary

[HeyLaughingBoy]

The ethical complications are interesting.
If you create a new life form, do you have the right to destroy it?

I dunno. Do you have the right to step on a cockroach?

Re:Scary

[Anonymous Coward]

"The ethical complications are interesting.
If you create a new life form, do you have the right to destroy it?"

No; women who are 8 months pregnant can have their babies brains sucked out, but you will not be allowed to kill single celled organisms.

Re:Scary

[Aetrix]

If you create a new life form, do you have the right to destroy it?

Well, as long as that new life form is considered "simple" there's no problem killing it.
Create New Bacterium - Kill off new bacterium - OK!
Create new euglenoid - kill off new euglenoid - OK!
Create new flatworm - Kill off new flatworm - OK!
Create new sea-sponge - Kill off new sea-sponge - OK!
Create new fish - kill off new fish - OK?
Create new cute-fuzzy warm and fluffy mutant kitten - Kill off new cute, fuzzy, warm and fluffy mutant kitten - NO!

Where should we draw the line?

Fascinating - Maybe The Truth

[N8F8]

Before I become a programmer the most fun I hadwas with woodworking. I'd been through several jobs/ job fields, but didn't enjoy the work. I think this editorial is really onto somthign that should be examined more closely.

From personal experince, the average programmer spends 2-3 years at any job. The most common excuses for leaving: lack of challange, lack of requirements flexability, inflexible or unresponsive managment, and red tape(configuartion managment going out of control and issues such as having no-control over or insight into released project environment).

Re:Fascinating - Maybe The Truth

[error0x100]

I suspect you intended to post to the thread about psychology of programmers. Anyway, one thing struck a chord with me in that: being interrupted. The thing hassling me most at my current job is that people interrupt me very often, and its true, it can easily take an hour to get ones concentration / "train of thought" back on its tracks.

So

[Eudial]

He sounds like one of us who enjoys writing machinecode by hand. (Or atleast the kind who would potentially enjoy doing it)

Re:I have a great Idea!

[Daniel Dvorkin]

Let's play God!

I have a better idea: let's stop using that silly phrase "play God" with respect to biotech. We've been "playing God" for thousands of years, ever since farmers first started selective breeding and hybridization of crops and livestock. Every tool of medical diagnosis and treatment in history, from traditional herbal remedies to antibiotics to MRI machines, has been "playing God," in that they interfere with the "natural" progression of disease and death. Indeed, all technology is "playing God" -- God didn't give us sharp teeth and claws, so we learned to chip spearheads out of flint; God didn't give us hooves, so we learned to ride horses and invented saddles; God didn't give us gills, so we built ships; et fucking cetera.

There will always be fanatics whose fear of divine wrath keeps them back in the muck and mire. That's their right, and their business. But when they stand in the way of progress that will immeasurable improve my life and the lives of my children ... well, they'd better get the hell out the way.

Ill take a Tribble please

[nurb432]

Hey, they are clean, dont bite and arent noisy..

Hell ill take a dozen!

Re:Ill take a Tribble please

[Anonymous Coward]

Just keep them away from the quadrotriticale!

"Free to good home: 1,200,000 Tribbles, suit quiet Klingon family..."

Custom Weapon of Mass Destruction

[saden1]

If you have watched 12 Monkeys then you know the world will be destroyed by scientist. In conclusion, scientists are evil, engineers are good.

The real story is tech progress, not Venter...

[LinuxParanoid]

I read the full Technology Review article.

Craig Venter is propounding the vision. But the real science/engineering described in that article seems to be the following:

In mid-2002, researchers at SUNY-Stony Brook synthesized a 7,500-letter long Polio DNA sequence, converted it to RNA, then "combined that RNA with enzymes and other molecules in a test tube, and watched as whole polio viruses assembled spontaneously."

The complicated chemical steps used to synthesize the DNA are error-prone; errors grow linearly with the number of steps "so researchers typically limit fragments to fewer than 80 letters."

The Stony-brook researchers thus took two years.

A company called Egea Biosciences has a prototype machine, the device makes a mistake only once for every 10,000 DNA letters, or bases, a 100-fold improvement over conventional techniques that typically have an error rate of one in 100.

The CEO of that company "says the technology could be extended to yield in a matter of weeks highly accurate strands 100,000 bases in length--long enough to make a very simple bacterial genome."

That's what I got out of the article. And a recognition that there is a loose analogy to semiconductor manufacturing in there. The Venter name is useful mostly for hype as far as I can tell. Actually, setting a vision is really important so I should cut him some slack, but I more appreciated the tech details above which were buried in the middle of the article.

--LP

Re:The real story is tech progress, not Venter...

[young-earth]

That is really cool stuff. The amount of ingenuity and excellence of design involved in making machinery that can generate DNA from a given sequence with an error rate of .01 percent is quite remarkable.

So (this is a genuine question) please explain why it is that the cellular level machinery which does this same task (assembly of DNA) but with more inherent complexity (built in error correction for example) is not viewed as a result of design but of stochastic processes?

Re:The real story is tech progress, not Venter...

[Anonymous Coward]

Venter isn't even that good for PR - this is the guy who subverted the bioethics panel at Celera and sequenced himself. He's gone from Celera for a reason. Any enterprise who will still have him at this point is pretty shady, and not something a dilligent VC would invest in. The public genome is far more useful, as they took a more systematic method to sequence. Celera would never have gotten a publishable sequence without HGP, but HGP's sequence is still equal or superior to Celera's licensed, proprietary, and derivative sequence - which makes it useless to most scientists as they need to publish their work and all source material in order to get public funding.

Several persons interviewed in the first article discussed dissection, experimentation, and preservation of Venter's body, which would probably be more useful than his previous contributions.

Re:The real story is tech progress, not Venter...

[LinuxParanoid]

Because "inherent complexity" (your term) is not necessarily a sign of design. Maybe, maybe not. Snowflakes are not designed by hand, they are designed by stochastic processes.

That said, a broader answer to your question would be that physicists have found that there are plenty of explanations that one can discover if one avoids presuming a designer is involved in particular phenomena. One day this success may fail, but it seems a little early in our understanding of DNA to conclude it must have been a designer behind. You know, Occam's Razor, named after the theologian whose point was "never multiply the number of miracles required in an explanation beyond what is required." Still, nature is pretty marvelous, snowflakes or DNA, isn't it?

--LP

Re:The real story is tech progress, not Venter...

[Anonymous Coward]

ouch.

Re:The real story is tech progress, not Venter...

[young-earth]

Snowflakes are indeed complex, but they aren't designed, they are just random repetitions of crystalline formations. It appears you may be confusing "order" with "complexity". Order can be created simply by repeating patterns, as in many minerals. Specified complexity is required to produce the mechanisms of DNA replications.

Order (like XYXYXYXYXY) is different than complexity. This is how snowflakes and crystalline minerals are produced.

DNA (and the proteins encoded by the genes in the DNA) are non-random aperiodic sequences which are not caused by the quantum, physical and chemical properties of the constituent molecules (nucleotides and amino acids). This is immensely different that crystalline structures, which are caused by the inherent physical and chemical properties of the constituent atoms. DNA and protein structure and sequence must be imposed from outside by some intelligent process as they are nonrandom.

To quote the evolutionist Leslie Orgel,

Living things are distinguished by their specified complexity. Crystals such as granite fail to qualify as living because they lack complexity; mixtures of random polymers fail to qualify because they lack specificity. [L. Orgel, The Origins of Life, John Wiley, NY, 1973, p. 189]

Re:I have a great Idea!

[spanky1]

I couldn't have said it better myself...

*phew*

[Willow_mt]

Methinks, that if this concept is worked out properly and people can "build" their favourite organisms, I'll be either old enough to have Alzheimer or dead already.
So thank heaven I don't have to live through the consequences of it...

ST:TNG

[_PimpDaddy7_]

WESLEY!

Upsides Only

[Aknaton]

"If successful, maybe in a decade, this could yield new sources of energy or novel drugs."

Or perhaps biological weapons or a killer virus? It's amazing to me how people only discuss the upside of things like this without mentioning the bad that can come of it as well.

Re:Upsides Only

[Daniel Dvorkin]

The bad has been so thoroughly discussed by hysterical scaremongers that there's really no point. Even on Slashdot, where you'd expect a fairly scientifically (or at least technologically) literate audience, there are ten "don't these foolish scientists realize that There Are Things Man Was Not Meant To Know?!?!?" posts for every "wow, this is really cool" post.

It's amazing to me how people only discuss the upside of things like this without mentioning the bad that can come of it as well.

Reminds me of how American fundamentalist Christians like to talk about Christians as though they were a persecuted minority ...

Re:Upsides Only

[mkcmkc]

The bad has been so thoroughly discussed by hysterical scaremongers that there's really no point.

If the possibilities don't scare you, I don't think you're paying attention. There are a lot of fundamentalists (of whatever ilk) out there that would like to kill large groups of people (if not all of us), and if this becomes technically and economically feasible, we're going to be in real trouble.

--Mike

Re:Upsides Only

[Efreet]

Given that these organisms will be hand made by scientists using existing genes I would say that, no, there isn't any danger.

For a very, very long time organisms have been thinking of ways to kill, parisitize, and otherwise screw their competition. Even the simpleist disease virus or bacteria is a master peice of inconcievable sybtlety by the standards of what we can cerate in test tubes this way.

The organisms in the article, on the other hand will be very, very simple. They won't even have unexpressed genes that could turn on and cause problems. Before we worry about these things turning into weapons, I'd like to see one capable of surviving outside a peti dish or growth tank.

The real danger from genetic engineering comes from the alteration of existing masterpieces like influenza, AIDS, Ebola, etc. A recent accident in Australia shows that it is possible to make diseases more deatly by simple alterations (in the example cuasing death in rabits rather than sterility).

Nanotechnology also presents dangers, since it allows us to make organisms out of things more robust than sugar, protien, and lipids; but that still seems to be decades in the future.

Re:Upsides Only

[juhaz]

AIDS and Ebola are not masterpieces, they are failures, temporary mistakes that would probably evolve to something more benign with time.

Disease or any other parasite that diminishes its host population is suicidal, nothing evolves with an insintric goal of "screwing up others" but survival, if every host is gone, the pathogen has nowhere else to live and dies out as an evolutionary dead-end.

Influenza may be a masterpiece, if it would have that strange "kill 'em all" -mentality, every influenza wave could be spanish flu class killer, but that's a very rare blunder and most of the time it's not very fatal to healthy people... ensures the availability of hosts.

Re:Upsides Only

[Efreet]

I guess I should have been more clear. I meant they were masterpieces from the perspective of a deranged terrorist, not from the perspective of evolution, since, as you say, its better for a parasite to keep its host alive.

Re:Upsides Only

[Anonymous Coward]

I think you may be neglecting current affairs.
We want to disarm Iraq because they have chemical weapons. Chemical agents, mind you, that were on the cutting edge of technology, when we sold it to them.

http://www.guardian.co.uk/worldlatest/story/0,12 80 ,-2489962,00.html
http://www.observer.co.uk/iraq/ story/0,12239,92566 6,00.html

Unfortunately, money and power are often reasons for advancements.

i could login and find more detailed articles,
but i think my point's made.

Re:Upsides Only

[Anonymous Coward]

The problem with enigineering biological weapons it that they attack classes of organisms, religion or political bias plays no part in selecting victims.

That is, anyone who engineers a micro-organism deadly enough to obliterate an enemy will most likely obliterate themselves if they are stupid enough to use it.

Let's just hope...

[ConceptJunkie]

Let's just hope that this doesn't end in a closed-casket funeral and laments of "He tampered in God's domain."

Re:Let's just hope...

[Anonymous Coward]

Let's just hope that this doesn't end in a closed-casket funeral and laments of "He tampered in God's domain."

I wish I had some mod points. For some reason, I found that comment hysterically funny.

ah, The Simpsons

[Johnso]

Bart: "How would I go about creating a half-man, half-monkey-type creature?"
Mrs. Krebopple: "I'm sorry, that would be playing God."
Bart: "God shmod! I want my monkey-man!"

Re:ah, The Simpsons

[Anonymous Coward]

Bart: "God shmod! I want my monkey-man!"

Anyone else read that as "god chmod..."?

Re:ah, The Simpsons

[Tablizer]

[Bart: "God shmod!]...Anyone else read that as "god chmod..."?

I think its time to use some of your vacation days now :-)

Accidents will happen

[Mossfoot]

What happens if a genetically engineered life form has an unforseen effect on the real world? Or a mutation?

Re:Accidents will happen

[sketerpot]

That's why you keep organisms that you make carefully contained. You observe them very carefully before even considering taking them out of quarentine. And as for mutations, perhaps you've been watching too many movies that use "mutation" as the convenient ominous and ill-defined bad thing.

Re:Accidents will happen

[Efreet]

Terrestrial life has evolved to be able to take advantage of mutations; to the point that some bacteria generate their own mutagens. These guys won't be able to unless we program it in (and we certainly aren't good enough to do that yet!).

Not energy or drugs...

[x136]

If successful, maybe in a decade, this could yield new sources of energy or novel drugs.

Or... Pokémon.

sorry,

[m1chael]

but in order to do this you must have tentacles and communicate in colours.

Re:sorry,

[TheKuz]

and be stupid enough to relocate into a huge space-bourne cylindar

Okay, here's my request list...

[Fritz Benwalla]

I would like:

1. A turkey that grows with a stomach full of stuffing.
2. A small monkey-like creature that keeps the shower water at a constant temperature.
3. A virus that makes just one of my "enlarge your penis" spams true, but then then another one that brings it back down for easy storage.
4. A tiny giraffe. All the convenience of a small dog but you wouldn't have to bend all the way down to pet it.

Please let me know when I can pick these up. Thank you.

---------

Re:Okay, here's my request list...

[lpontiac]

You forgot the 4 assed monkey!

Re: Okay, here's my request list...

[Black Parrot]

> 1. A turkey that grows with a stomach full of stuffing.

Natural turkeys already do that ... it's just not the kind of stuffing you'd want to eat.

Re:Okay, here's my request list...

[Tablizer]

4. A tiny giraffe. All the convenience of a small dog but you wouldn't have to bend all the way down to pet it.

Perhaps you should add "5. A safe weight-loss virus." :-)

A small monkey-like creature that keeps the shower water at a constant temperature.

I am surprised this issue has not been easily solved. I hate fiddling with the water everytime somebody flushes the crapper or rinses a dish. Any laptop-driven solutions out there?

Re:Okay, here's my request list...

[TheDanish]

1. A turkey that grows with a stomach full of stuffing.

1) Are you referring to this, by any chance? Oh, wait, that's a chicken. Nevermind.

Re:Okay, here's my request list...

[GigsVT]

Get a catalog from someone who sells those kinds of fixtures, for a few hundred bucks you can get a temperature controlled system. A computer is insane overkill, mechnical solutions have been around for decades.

Or, for 50 bucks or so and some work, you can reroute your water pipes so that the shower comes off the main directly, instead of sharing the line with the rest of the bathroom.

Re:Okay, here's my request list...

[Snover]

I dunno if I'd want that, there would be an awful lot of shit to clean up...

Dangerous

[Anonymous Coward]

What are the simplest lifeforms? Viruses.

What would be the first lifeforms man could create?

_______.

Most all natural viruses are in a stalemate with higer lifeforms. Have co-oexisted for a long time and the higher lifeforms have internal memories for defense against these familiar enemies. A fabricated virus would be a novel thing to immune systems used to dealing with very specific attackers.

What does this mean:

Bad.

Now you're doing whatever cost/benefit analysis. Short term: Yeah, maybe a few beneficial outcomes.

Long term: Another pandora's box to placed with the others. Each box containing the potential for extinction. Hey kids, collect them all!

Re:Dangerous

[praksys]

Most all natural viruses are in a stalemate with higer lifeforms. Have co-oexisted for a long time and the higher lifeforms have internal memories for defense against these familiar enemies. A fabricated virus would be a novel thing to immune systems used to dealing with very specific attackers.

On the other hand most naturally occuring viruses already have a complete bag of tricks for dealing with immune systems. If you start from scratch you can be sure to leave all of that stuff out. After all the down side of tweaking an existing virus is that you never really know what you are going to get - you don't know what all that extra genetic code actually does now, let alone what it will do after you mess around with it.

Sci Fi Horror!

[TekReggard]

This reminds me of those Sci Fi flicks where scientists really want to create creatures from scratch. So they come up with a bunch of "super creatures" which they'll use to perform tasks better than their human counter parts. Of course, said "super creatures" turn on them and start killing them or rebelling against mankind. You know what I mean, think... Resident Evil? [the movie for example]

I copyrigth this creature!!!

[Anonymous Coward]

gtacggtcagtcgtagtcagtcatgcagttgcagtctgagtcatgcagtg ttgtgacgttacgtagctagctagcatagcatgactaacgtagcatcgta ctactgacgatgcatcgactgactacgtacgtacctgaacgatgctacgc gtaattacgcggcatcagatccgttgacgtactgtcatgtgtgatgcgtt gactgacaccatgatttatatcggcgattacgcggctgatgatgcatcgt cagtaccga

Reminds me of dune

[Anonymous Coward]

It reminds me of the ghola thing...

Dinosaurs

[Unregistered]

I just wonder when they're gonna bring back dinosaurs.

cues jurassic park music

Sounds pretty safe except for prions

[Anonymous Coward]

The engineered life seems like it would be rather safe as they're talking about knocking out most of the genes. The life would have a limited runtime environment. No cell division would be allowed.

There was also some cool stuff in the article on an artificial DNA bases that could code for entirely new amino acids, yielding useful protein structures that don't exist in nature. Let's just hope these new proteins can't conform naturally occurring proteins to create new form of prion diseases.

Craig Venter.

[zymano]

Isn't he the clown that wanted patents on all the genes he found for his genome project.

What absolute bull.

The gov was going to decipher the whole genome anyways. I also heard that some of the data used by his system may be corrupt by the system he used . My source was an article in time magazine.

His contributions to science is nothing. Just another raider.

Re:Craig Venter.

[praksys]

The gov was going to decipher the whole genome anyways.

I am no fan of gene patents, but this story was something of a vindication of the arguments for gene patents (and intellectual property in general). When there was no competition the government funded program was talking about the completion date in terms of decades. When the privately funded project took off, and started racing through the genome at lighning speed, suddenly the government guys pulled finger and got going as well. "A few decades" became "a few years".

We would still be waiting for the genome map if it were not for the incentives offered by gene patents.

Re:Craig Venter.

[Waffle Iron]

I am no fan of gene patents, but this story was something of a vindication of the arguments for gene patents (and intellectual property in general).

Gene patents could be very lucrative in this field. Imagine an informational video at the end of a future assembly line:

Welcome to Earth. I am your creator, Dr. Smith. You are a newly minted member of a custom designed super-human master race. I have good news for you: you have intellect and physical powers that dwarf those of the puny inhabitants of this planet. We have created you fully formed and preprogrammed with all of the knowledge known to mankind. You will walk amongst the population of this world as a god.

However, you should be aware of the following information: My company holds key patents on your being. In order to exist, you must license those patents. In order to cover your royalties, we will garner everything that you produce during your lifespan other than a small stipend. These same licensing terms apply to any offspring you may produce. In order to help keep you honest, your brain includes our DRM technology. We may also remotely monitor your thoughts, and we may share this information from time to time with our subsidiaries, contractors and marketing partners. We may change the terms of this agreement at any time by notifying you through a voice in your head. If you violate the terms of our licensing agreement, you may be remotely terminated without notice, so keep your nose clean.

YOU COME WITH ABSOLUTELY NO WARRANTY. WE WILL NOT BE HELD LIABLE FOR ANY OF YOUR ACTIONS; EVERYTHING YOU DO IS AT YOUR OWN RISK. WE MAKE NO CLAIMS THAT YOU ARE FIT FOR ANY PURPOSE, OR THAT YOU ARE SANE.

Go forth and prosper.

Re:Craig Venter.

[the gnat]

We would still be waiting for the genome map if it were not for the incentives offered by gene patents.

Wrong! The way I heard it, Celera's business plan was to patent a few key genes that were of interest, but to make most of their money from very expensive subscriptions to their database. Most of the companies with large gene patent portfolios haven't done much sequencing, and they haven't actually done much "science" either. In terms of practical benefits to society, gene patents haven't done shit (whereas drug patents have been generally beneficial).

Also, you need to keep in mind that much of the motivation for Celera was based on Venter's ego and the need to prove new technology. Venter teamed up with AB both to prove that Venter's sequencing strategy worked for massive genomes (previously it had only been used on bacteria) and to show how badass AB's new sequencers were. I don't think Venter and his backers went into this thinking that they'd gain complete control over the next 20 years of human genetic research.

Also remember that part of the reason Celera was able to go so quickly is that they started from the beginning with the latest techniques and technology, and also a shitload of money to spend on supercomputers and sequencers. Once the public effort modernized it started going at the same speed.

Re:Craig Venter.

[praksys]

I agree with everything you said except this bit:

Wrong!

As far as I can tell nothing you said contradicted anything that I said - although you did point out some other incentives that Celera had (some other types of intellectual property besides gene patents).

Re:Craig Venter.

[the gnat]

As far as I can tell nothing you said contradicted anything that I said - although you did point out some other incentives that Celera had (some other types of intellectual property besides gene patents).

No, my point is that there was sufficient incentive for Celera without gene patents, and that gene patents were never a large part of the strategy - nowhere near to the extent of HGS, Incyte, or Millennium. Venter saw a new market opportunity and went for it. I believe this would have happened without gene patents.

Which brings another point: the human genome project was truly visionary and was started years before even the majority of the scientific community saw a use for it. This is why it was a very long-term project. When Celera started, the need had finally been recognized, but the public effort was still thinking on a much longer time scale. Many groups were willing to pay for immediate access to the data.

One final remark: I'm almost certain that you can't just run BLAST and Genscan on a genome, pick out any interesting hits, and patent them. If you actually read the text of a gene patent, they involve full isolation and characterization *experimentally*. Which means that Celera would still have had to do the more mundane work which was already being done by other companies. The genome would be a shortcut to identifying interesting genes to investigate, but not a sure-fire source of new IP.

Energy?

[Cyno01]

this could yield new sources of energy

Are they going to engineer hampster like creatures that will never tire to run on little wheels or what?

Re:Energy?

[pHsHsTK]

And dinosaurs that work in rock quarries...
yabba dabba do!

O.o

[Superfarstucker]

well lets hope nobody spits in your life while they were making it.. just be sure not to put down your occupation as 'cop'

There is more than nucleic acids...

[ubiquitin]

...involved in the creation of a living thing. An astonishing array of proteins, complex sugars, and lipids are all necessary for even a unicellular organisms to be viable. These aren't as easily assembled as nucleic acids, but they are just as requisite. The public focus inevitably tends toward DNA and RNA, especially by marketers such as Craig Venter, and especially when the story is being told to a non-scientific readership. The real story in biology is always more complex than the headlines would have us believe. Why can't these people make a real contribution to the world of medicine and figure out how SARS works.

Imagine a Beowulf cluster of these...

[aaribaud]

Doubling every five hours or so. :)

Re:I have a great Idea!

[greenjinjo]

If people are developing technology that will make life better for all of us: I am all for it. However, that does not mean scientists should be left alone until they have finished their greatest invention. I suggest we check up on them once in a while just to see where they are heading. Because it is possible to use technology for right or for wrong.

Re:I have a great Idea!

[sketerpot]

Speaking of "playing God", why shouldn't we?

The USA military has already done it

[Anonymous Coward]

Its called AIDS

heh and you thought that it came from monkeys in Africa

Re:The USA military has already done it

[Dielectric]

No, you're thinking CIA, not the military.

Re:Mrs. Crabapple(n/t)

[Anonymous Coward]

fgh

Can he beat the evolution ?

[Anonymous Coward]

Let's see if he can make it faster that the evolution did ?

actually...

[Anonymous Coward]

venter is not trying to build a new organism from scratch, base by base (at least not when I first heard about the project). This doesn't work because atm we have no way to predict how a protein with a certain amino acid sequence is going to fold into its 3d structure. Thus, we can't just write the DNA sequence for a new protein like we would write a program. Instead, Venter is planning to take an existing species and strip away all non-essential genetic information (and then some more so it can't survive in the wild should it escape from the lab). This gives the "least common denominator" of all living things. To that we can than add certain genes to make it do something useful (e.g. produce insulin) other than "live". Also, one error in 10000 bases is probably good enough for that purpose. There are organisms that are actually worse than this.

Human Genetic Engineering is a Good Thing

[Tuxinatorium]

There was a recent slashdot story about a controversy over using genetic screening in conjunction with IVF[/URL], which got me thinking. They are going to raise a new perfectly healthy baby, for the purpose of donating the umbilical cord blood to their sick child in order to save his life. So what if they're using IVF to screen out genetically defective embryos? The sole effect of this treatment, when allowed to go ahead, is a benefit to all parties concerned and does harm to no one. (For those of you who believe that the destruction of embryos is immoral because the embryos are people, all I have to say is that one mindless ball of flesh is not any closer to personhood than any other, because the sole characteristic that makes one a person or makes one capable of having a "soul" (if such things exist) is having a mind capable of thought and emotion, which is obviously not a characteristic of anything that has not yet developed any sort of nervous system) But I digress. The whole slippery slope argument about "Designer Babies" is completely bunk because sliding "down" that slope would be nothing but benefit to mankind. The world would, unquestionably, be a better place if genetically-based diseases were eradicated and people had more of a genetic predisposition to be healthy, fit, and intelligent. So what if the benefit only applies to those who can afford it; the same can be said of ALL expensive medical treatments, and yet we don't see anyone advocating banning chemotherapy for that reason. One of the other arguments against so-called "Designer Babies" is that genetic screening will, in many cases, be applied very narrowly (for example, to enhance physical attractiveness) neglecting more important things and actually making the person-to-be less healthy overall. So, hypothetically, the technology could be misused in harmful ways. Big deal. Antibiotics have been and are still being misused resulting in the creation of dangerous antibiotic-resistant diseases that are taking a great toll in some areas, such as Russia's problem with MDR Tuberculosis. Nevertheless, that has never been a good reason to ban antibiotics altogether, and this situation is hardly any different. The industry could be regulated to avoid abuses and malpractice, the same way other medical procedures and prescription drugs are handled today. The difference between this and other medical resources that are legal but regulated is grossly insufficient to warrant the double standard of banning genetic screening/improvement altogether. The third objection to so-called "Designer Babies" is an (IMO irrational) fear, spawned from science fiction, of creating a "super race" of genetically engineered humans, raising the standards for everyone and harming those whose parents couldn't afford the genetic improvement technology. Let me ask you, how is that sort of economic divide any different from the current situation? Rich people can afford to send their students to better schools, and provide them with a more advantageous upbringing in general. This results in a situation where the children of middle class and rich parents have more of a chance to succeed than the children of poor parents, regardless of their innate potential. Does this mean that all private/rich-public schools should be disbanded, and everyone, should be condemned to a crappy education and a disadvantaged upbringing? Heck no. That would certainly satisfy the resentment of the poor, without really helping them, but it would harm everyone else. That is analogous to the issue at hand: Banning genetic screening/improvement would simply hold back part of society from improving themselves, without providing any concrete benefit except satisfying paranoia and class envy. Such a ban would do nothing to serve the common good. Sure, there may be bugs to be worked out, as with all experimental medical treatments. So federal regulation, similar to the function of the FDA for drugs, is probably a goo

Re:Human Genetic Engineering is a Good Thing

[Anonymous Coward]

Apparently, you were one of those poor ones who went to a crappy school, since you haven't learned the concept of paragraphs.

Re:Human Genetic Engineering is a Good Thing

[lidocaineus]

First off, use paragraphs. Secondly, go see Gattaca; it's a very simplistic but effective commentary on this exact subject. Thirdly, learn some basic tenets of humanistic behaviour/patterns (Gattaca will give you some of that). It all boils down to the simple fact that while plenty of good will come from this, only the delusional will think it stops there.

Re:Human Genetic Engineering is a Good Thing

[Tablizer]

since you haven't learned the concept of paragraphs.

He has been genetically enhanced to no longer need paragraphs in order to understand text. Paragraphs are for the mentally coddled old-style humans like you. In the next model of human, a statistical context parser will be engineered in so that punctuation will not be needed either.

And you thought offshore outsourcing was scary....

Re:Human Genetic Engineering is a Good Thing

[Tuxinatorium]

bah humbug, it's slashdot's fault for not preserving plaintext formatting, and making you use html just for a freaking line break. I'm too lay to add a [br]

Super geek sex woman...Was:I can see it already...

[Anonymous Coward]

I'd like to order one damn hot foxy lady thats crazy about me and complements my geek characters.. how long do I have to waite? does it come with fries and a milk shake?

Chilling Feeling

[mmmjstone]

Why is it that when I read this article I thought "man creates great organism, great organism is too great, great organism kills man?"

Maybe it's just the product of too many science fiction movies.

Re:Chilling Feeling

[Anonymous Coward]

I must be getting tired, or I'm just a pervert; I read that as "man creates great orgasm, great orgasm is too great, ...".

Re:Chilling Feeling

[Anonymous Coward]

My inbox is full of messages advertising "Great and longer lasting organisms".

Oh, wait, I'll just read that again...

Re:I have a great Idea!

[arvindn]

I mostly agree with you, with some reservations. My argument has nothing to do with god or divinity. The issue here is entirely different from, say, cloning. We have to be extra careful here than with most other new technology. The same way people building nukes and people controlling them had to be more careful than with any other technology in human history. In a way we are fortunate that nukes are available only to governments. In this case it's worse. If this takes off as expected we're going to have a rush of private entrepreneurs racing to create new genomes. The problem is that we don't have any expericence in handling what we will create. The article mentions that they'll be put to use in tightly controlled conditions etc. How feasible do you think it is to ensure that? Sooner or later we'll have artificial organisms freely reproducing in the wild, and we'll have to get used to them and combat them.

There are many technologies that give us a lot of benefits without commensurate dangers. But this one isn't one of them. That doesn't mean we shouldn't work on it; just be more careful and forearmed.

That's life..

[gmuslera]

(programming/designing) bugs making bugs.

The problem with life is that it tend to prevail, so the bugs/bacteria/virii you made could be here for years, there is no service pack that fix magically those mistakes (well, computer worms also seems be here to stay, an example of "art" imitating life). A mistake in that kind of things and we all could be history.

Energy from organisms?

[adzoox]

I'm not sure of the ethical or moral implications of creating LIFE to be slaves to tasks or for slaughter. I suppose the dolphins in iRaq and cows/chickens already fit this bill, but we don't create them, rather; herd and domesticate them. Isn't this somewhat the premise behind The Matrix and Planet Of Apes? We create or domesticate animals/machines that are sensiant beings, they catch on that they are slaves, form a "god complex" themselves and then rebel. Who's to say these "organisms" don't gain or already have conciousness?

Related, I would like to see bioluminesence be developed in the lab. Think of the energy savings of a bioluminescent light source that fed on algae in self contained ball kind of like sea monkeys.

Re:Energy from organisms?

[Anonymous Coward]

I'll bet they're thinking more along the lines of microorganisms that use photosynthesis to split water and release hydrogen. If possible, that's a real cheap 'n easy way to power the hydrogen economy with solar.

Re:I have a great Idea!

[lpontiac]

Let's play God!

*ceases to exist*

maybe...

[Herr Brush]

I'd like to see them make a large taco creature that craps ice cream

Re:I have a great Idea!

[Anonymous Coward]

Amen/Amin/Ameen/So Be It to that!

Lilo and stitch answer

[gralem]

Does he prefer to be called "Evil Genius" or "Idiot Scientist"?

---gralem

YEAH!

[Anonymous Coward]

We shall build the perfect creature...

Behold the 5-assed monkey!

Let's get this thing going!

[Anonymous Coward]

First, we need to bring Adolf Hitler back, his DNA is intact, we have a viable sample.

Second, we need to get back to work on the Lebensborn project, that is a race of PURE ARYAN SUPERMEN, only this time we genetically engineer them. We'll be darn sure this time they are PURE ARYAN.. The herenmenschen.

Lastly, world conquest. We will cleanse the earth of the untermenschen. Mein Kampf is our bible.

Where's the lightning bolt

[Mr Bubble]

OK, this might paint me as profoundly ignorant in the ways of biochemistry, but where's the lightning bolt? I mean, one day, after enough practice, we will probably be able to construct DNA - base pair by base pair - and set them up to create some protiens that can build cells etc. etc. But, how do we breath life into the resulting tissues? Are we making the extrapolation that biochemistry=living creature? What's to say that the thing will have a "soul" -so to speak - or animating life force? If there is a "soul", where does it come from? Does it just "fill in" to the bodily form when the conditions are right or are we assuming that the soul is a funtion of bio-chemistry?

Re:Where's the lightning bolt

[Martin Blank]

You're presuming a supernatural element to life, rather than looking at it as it probably should be, and that is as an incredibly complex series of chemical reactions. You may well be right, but seeing as how we have created fully-functional viruses in the lab (see the earlier mention of the creation of the polio virus), I see no reason to think that the successful creation of a cellular organism will result in anything less functional than the original, as long as there are no chemistry-killing errors in the cells.

Re:Where's the lightning bolt

[kmellis]

" If there is a "soul", where does it come from? Does it just "fill in" to the bodily form when the conditions are right or are we assuming that the soul is a funtion of bio-chemistry?"

I'm in charge of this. Right now, the anima emplacement process is mostly automatic; complex metaphysical machinery (MM) operates 24/7 ensuring that life on Earth continues.

However, new forms resulting from biotechne will not be recognized by MM--at least initially--so I'll have to take care of each case individually.

A damn nuisance, if you ask me.

Re:Where's the lightning bolt

[Mr Bubble]

I am not presuming a supernatural element to life, I am just posing an interesting question. I don't necessarily believe in a "soul", but many people do. A virus is a relatively simple organism. It is interesting that constructing a virus resulted in a life-like virus. However, I wonder if a constructed monkey or human would have a personality and consciousness.

Re:Where's the lightning bolt

[Anonymous Coward]

If you could determine some objective scientific test that could be performed to determine whether an organism has a "soul", then maybe we'd have some way of determining whether synthetic organisms can have "souls". But how can you tell?

I'm sure there are some people out there who would deny that a synthesized human had a soul, no matter how many medical or psychological tests were performed, or what their outcomes were...

spell checker

[infonography]

If they are gonna be making DNA letter by letter, then hopefully someones gonna write a good spell checker.

DNA to order?

[megabeck42]

Ahh.. The future,

"Organisms'r'US, this is Charlene, how may I help you?"

"Hi, yeah - I'd like to order a Natalie Portman with a side of grits."

"Mmmhmm, I'll need a credit card and a shipping address - would you like that overnight?"

Re:DNA to order?

[machine of god]

I've been dealing with those slippery characters. You have to specify, otherwise your grits will only be lukewarm.

Re:DNA to order?

[Trogre]

What are these grits?

The only grits I know of are shoveled onto the garden path in snowy winter.

I guess if they're hot, it'd melt the snow more effectively...

Re:DNA to order?

[usotsuki]

Hey, we even eat grits up here, in Niagara Falls. *g*

grits:corn::farina ("Cream of Wheat"):wheat

-uso.

Re:DNA to order?

[Trogre]

Wouldn't the melted snow make the wheat go soggy?

(snigger)

clarification

[burNtchicken]

Let me get this straight.

As a species we can't feed everyone.
Subsets of our species, or "cultures", routinely commit mass murder on each other.
We can't agree on how to govern ourselves.
We can't agree on what is right and what is wrong.
(Hell, I can't eat lunch without staining my cloths, but that's me.)

And we want to control the very evolution of all life on this planet to a level so minute that we can churn our new life forms in a matter of weeks with a machine that, and I quote the article, "Is like a word processor for DNA"!! LOL. Give me a break.

Does anyone here seriously think we will be able to do this responsibly? I mean, don't get me wrong, I sincerely hope we can, because it's going to happen whether we can or not. I love science, and I am all for expanding our knowledge and ability, but we need to have a reality check here. We are no more mature as a species than we were a couple thousand years ago. Yeah, we're more "advanced" now. We have cars and books. We have factories and airplanes. But we still have the same problems we've always had. We have the same famine, the same crime, the same war, for the same reasons.

I realize that the statement I am about to make is pure speculation, but think about it. If we continue to increase our technical abilities without increasing our WISDOM then we are seriously going to hurt ourselves. It's like giving a 7 year old child the keys to your car. Sure he can get around better, but do you really think he won't crash?

I think we need to learn how to live with each other in a calm and rational manner. We need to learn how to control our own minds before we go creating new forms of life.

Re:clarification

[Anonymous Coward]

How about coming up with some thoughts of your own rather than mindlessly mouthing after talking heads on TV? Following this logic, we weren't mature enough to begin using levers or fire. Perhaps we should immediately relinquish everything but our bare hands out of concern for our lack of 'wisdom.'

pictures bush does not want you to see

[Anonymous Coward]

http://www.einswine.com/atrocities/pictures.cgi?so urce=us&page=1

Throwing out the carbon sink with the bathwater

[Alex Reynolds]

Engineering an self-replicating organism to suck CO2 out of the atmosphere would be a bad idea. The biochemistry of plant life is based around sucking this out of the atmosphere for us. Maintaining a proper ratio of all the gases in the atmosphere is key to keeping all terrestial life systems from collapsing.

Perhaps instead of allowing a bacteria to kill off all vegetation on Earth, which in turn would put all animal life in a bad spot, we should perhaps focus more on our behaviors. Deforestation and fossil fuel consumption are the main reasons why this is a problem.

Re:Throwing out the carbon sink with the bathwater

[Anonymous Coward]

Did'ya read the article? The organisms wouldn't survive outside of the smokestack.....

link clarity

[sstory]

If you're going to highlight as a link a magazine title, make the link one which goes to the magazine. If you want to link to an article, arrange the link so that the article is clearly specified. Make sure the link highlights the noun to which the target refers, please.

They are on crack

[minkwe]

Anybody who claims they can do this in a decate (if at all) is either very naive or not thinking straight.

We don't even know 0.1 % of how viruses function let alone cells. It's really laughable to hear things like these.

One fundermental question that is still far from being solved and will benefit mankind more is the 'folding problem' --- That is, given an unknown DNA sequence (gene), what is the 3D structure of the protein it produces?

Once we know that, the next problem is the 'function problem' --- Given the 3D-structure of an unknown protein, what is its function?

Current attempts at solutions to these problems are merely AdHoc devices which are far from suitable in unique situations.

Re:They are on crack

[anthonyx]

It should probably be mentioned that people have been trying to solve both the "folding problem" and the "function problem" for a lot longer than a decade. What the article envisions would require that both of these problems and a number of other, scracely more tractable, problems be solved.

Re:They are on crack

[McDrewbie]

First you're 0.1% os a little low, but I get your point. However, it seems like in a decade or so we could manufacure organisms without encountering the "folding problem" and "function problem" All we need to do is take the genetic code for naturally occuring proteins that we are (pretty) sure we know the functions of, and combine them with other ones, cutting out ones we don't need or modifying them so they act different;y (i.e. removing a binding region, a kinase domain) I admit, the concept still seems a little far-fetched in the time period the article specified since in the yeast lab I work in, we are finding possible new protein interactions on a weekly basis, and thats only focusing on the Anaphase Promoting Complex

Re:They are on crack

[devbiowonk]

You have a good point about the fact that we know very, very little about how all viruses function, but that is only a consequence of the fact that only a few have been beat to death by researchers. Take the lambda phage for example, is their anything we don't know about it? Where did that get us? To address your folding problem, we don't need to know the structure of every single protein in this minimal organism they want to create; we just need to know their FUNCTION. Granted whoever figures out the folding problem is going to be my hero, but I don't think that it will benefit manking more. This kind of rhetoric makes you sound like a structural biologist.

Re:They are on crack

[lawpoop]

Yeah, well, don't you think this will help them figure it out?

Why do they need to know it, anyway? Just use some artificial selection technique. Mimic nature.

Re:They are on crack

[Anonymous Coward]

Yep, they are on crack while you use the word 'decate' in a sentence.

Re:They are on crack

[ZuG]

One fundermental question that is still far from being solved and will benefit mankind more is the 'folding problem' --- That is, given an unknown DNA sequence (gene), what is the 3D structure of the protein it produces?

Unfortunately, it's not nearly that simple. There are many different ways any given protein can fold, most of which will produce a defective protein (functionally). The process of making sure given proteins fold correctly is a long one, involving several classes of enzymes.

There is a class of proteins called "chaperones" that among other things help proteins fold in the correct orientation. They bind to the polypeptide as it is being formed, help direct it to the right place in the cell, and ensure that it folds correctly. Another protein, called protein disulfide isomerase, rearranges S-S bonds during the folding process to ensure the correct tertiary structure happens. Yet another protein, called peptidyl prolyl isomerase also aids in folding

And, this doesn't even take into account the massive modifications that take place post translation as proteins travel through the Rough ER and Golgi apparatus, such as phosphorlyation or the addition of marker sugars such as mannose-6-phosphate.

In short, it's really not possible to determine structure simply from the DNA sequence. There are too many heavy modifications in the cell and too many possible structures to know how it will fold without seeing it in vivo.

Re:I have a great Idea!

[odyrithm]

God gave our soul a human body, which came with a pretty good interface called a brain that allows us to come up with many wonderful ideas and solutions to everyday problems.. to say where "playing god" just because we use the "brain" he gave us is utter ignorance.. he didnt give us a brain to sit back with and do nothing with.

"think" before you rant on like that.

It's like copy-paste programming

[pdan]

There are two major problems to overcome before we will be able to design a new life form from scratch.

1. Protein folding:
We believe that protein structure is determined by its sequence (i.e. two proteins having same sequence have the same structure in physiological conditions). Therefore to design new proteins of desired structure we need to "predict" its sequence. Such research has been in progress for 30 years, since 10 years it has been biennaly evaluated at Critical Assesment of Structure Prediction(CASP). After last one we can say that failure at CASP is no longer guaranteed, but a lot has to be done.

2. Gene regulation:
Even if we would know which proteins are needed to sustain life of the organism being designed, we need to provide information when such proteins are needed. This mechanism in living cell is called gene regulation. Most of the cell's DNA is used for that purpose in a way we poorly understand. It is even hard to point regions responsible for expression of a particular gene. Current research in this field is mostly finding examples (i.e. finding ways some particular genes are regulated).

There are also technical difficulties in genome assembly that have been mentioned already.

To sum up:
If Venter is going to use known proteins and copy known genes (with their alleged promotor regions) it will be comparable to "copy-paste" programming. And if it's done in a decade I don't believe it will shed much light on essential problems I mentioned above.

Re:I have a great Idea!

[Mr Bubble]

This could add a new new level to terrorism.

your right

[zymano]

with the speed up but I know i read something about the accuracy of the data. I like that 'give war a chance' statement. Your right.

Deus Ex Machina

[Diabolical]

Anyone ever read "Deus Ex Machina" by Pierre Ouellette? A very good thriller where Computertechnology meets biotech meets AI... nice outlook for our future if it becomes possible..

Scary

[Bryan_W]

It seems a bit scary that everyday our world is becoming more like the movie GATTCA

Here's what he's building

[blair1q]

They've put up a picture of the thing they're trying to build from the DNA.

Re:Here's what he's building

[Anonymous Coward]

You got the wrong picture. It's one of these.

The Future of Man (and Woman)

[AustinTSmith]

Could this be the beginning of a new Gattica driven world? The possibility of creating the ultimate human with uber-characteristics? This could possibly be the pushing evolution into overdrive, all in a new form of human advancement science.

I welcome the future, even though I probably won't be effected by it.

3 days latter

[Anonymous Coward]

and we have the perfect leader...it's billgates.

Energy?

[aechols]

Energy's great and all but metabolism is only 20-something percent efficient. I don't get the feeling that these would work as well as real living things for a while either.

New Base-Pair Letter

[handy_vandal]

Interesting detail from article: creation of a new letter for the base-pair alphabet:

While Evans and others are working on machines that could expand researchers' ability to write genes, chemists at the Scripps Research Institute in La Jolla, CA, are expanding the genetic alphabet itself. "Our repertoire of bases is naturally limited," to the familiar DNA letters A, T, C, and G, says Scripps chemist Floyd Romesberg. Because these letters tell an organism which proteins to make, the types of proteins that can be specified by the genome are limited as well. Getting, say, a bacterium to make novel types of proteins would require adding new DNA letters.

That's exactly what Romesberg's lab has done. Building on the pioneering work of biologist Steven Benner at the University of Florida, Romesberg and his colleagues have created a letter in the form of the chemical fluorobenzene. This artificial DNA letter looks nothing like a natural one, he says, so the challenge is to trick the cell's DNA replication and translation machinery into recognizing it. So far, the Scripps researchers have synthesized short fragments of DNA that incorporate the new letter and have successfully created an enzyme that can replicate the modified code. The next step is to design a system for translating the code into a completely unnatural protein--a novel drug, for instance.

Re:I have a great Idea!

[Camel Pilot]

I don't worry about man "playing god" but I do worry about humans acquiring technology before we are culturely advanced enough to reduce the possibility of wiping the human specicies of the map.

For example, suppose nuclear energy was discovered 50 years earlier in human history. There is a good chance that we would have destroyed the earth in one of the great wars of the last century.

It does not take alot of imagination to think all sorts of devious uses of custom life. What would a Saddam do if the technology was in his grasp.

What happens?

[hackwrench]

Why, we come up with even newer things to take care of the unforseen effect, of course. (also with their own attendant uforseen effects)

Re:There is more than nucleic acids... OH YEAH!

[gacp]

To create an artificial molecular autopoietical system? When we have no clue how the natural ones work? No clue whatsoever?

Give me a break. Better yet, give half a dozen breaks

Nonetheless, this is scary. they have no bloody clue about what they are doing, and their mistakes could, should, if they succeed at making it work at all (work as autopoietical system, not necesarily as intended), will be self amplifying mistakes. GREAT! And this time, we cannot expect that the wizard will come in time to save the apprentice from his own foolishness.

Is this progress? Give me yet another break! Is this Science(TM)? Then we need to replace science for something new.

[And yes, in case you were wondering and care about those things, I have a degree in biology.]

Sea Monkeys

[Anonymous Coward]

Sea Monkeys are not really Monkeys that live in the sea. They are really just Brine Shrimp.

gcc backend for genetic code

[Anonymous Coward]

I wonder when we'll see a backend for gcc that
allows us codewarriors to design our own organisms in C?

Warning: It was a movie - FICTIONAL

[Anonymous Coward]

they didn't make any dinosaurs. It was in the script. had they not written predators into the script, there wouldn't have been a movie. ;)

OK, let's get a few things straight.

[tfoss]

What this is not:

A way to make new pets, better people or 4-assed monkeys. This is unlikely to make any multi-celled organism, much less one you can even see by eye.

Anything to do with nanotechnology, this is molecular biology as has been done for years.

Anything useful to make a weapon. That can be done today so, so much easier in any decent biochemistry lab.

Anything really novel technique- or theory- wise

What this is:

A mixture of known techniques, a new machine, and ego. The likelihood of their accomplishing their stated goal isn't any better than, say, directed-evolution (which is currently a feasible technique).

Newsworthy mostly due to Venter's name. There are plenty of wacky, grandiose proposals with more upside, and a better chance of success around, they just lack a widely known scientist championing them.

A misnomer in description. They aren't making new genes in the sense of a new protein structure (or if they are, then the 10 year timetable is completely laughable). They are taking known genes are putting them together as they see fit.

-Ted

Strangely enough

[pyth]

The first intelligent life generated by this method thinks that it evolved.

Why not hunt them?

[Rob Simpson]

Its a theme park, i.e. a zoo. We dont try and reach environmental equilibrium in our zoos: we bring outside food in, and feed the tigers, the wallabies and the zebras. Why wouldn't we just bring in outside food from Jurassic park to feed them?

Heck, why not let visitors pay to hunt them? Of course, even the biggest guns would only work on the smaller ones, but going after a brontosaurus with a missile launcher would be kinda neat... ;-)

Re:I have a great Idea!

[mdielmann]

The difference is, in selective breeding, etc., God set the rules (DNA) and we played within them. IMO, this applies to correcting genetic diseases as well - we just added new equipment to the game. OTOH, when we create DNA strands that never existed before (at least not now), we're making a whole new game, possibly one where we don't know how it ends. We still run into huge problems when we introduce an existing organism into a new ecology, and we already have a good idea about how they work. We're still guessing what all the ramifications are when we look at the building blocks.

Also, if you can't keep these viruses, etc. contained, what right do you have to expose me to them? Do you honestly think we can use those and guarantee that when you walk out the the biocontainment structure that you aren't taking even one of them with you?