Human Gene Count Slashed
jd continues: "This has the potential for making life extremely interesting for genetic engineers, given that both individual genes and interactions between genes must be proportionately more complex, in order to get the same level of complexity out. Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code.
There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer, although if you now factor in the increased complexity of interactions, it is possible that such side-effects can be better understood and therefore prevented. The new estimates, therefore, are more than just idle curiosity but have the potential for impacting how the science is approached."
abusing me
plz stop h8
Finally scientific proof that it's not the size that matters, it's how you use it.
I'm disturbed by your line breaks... they threaten the status quo.
first post in the f-house
In the Ghetto Part I
It was pitch-black in the roach-infested double-wide trailer. All was quiet except for the gurgling sound of an infant, shut away in its own room.
The floor creaked as a mass of flesh made its way to the infant's room. The door slowly opened, creating a growing triangle of light on the floor. The infant coughed and gagged and began to cry as it was overpowered by the horrid stench.
"It's time to suck on daddy's special pacifier, Marticock!"
As the door creaked shut, the whale in the master bedroom wept into her pillow. What kind of life was this for her precious little Marticock?
In the Ghetto Part II
Reza sat at the kitchen table, her cigarette smoke blending with the steam rising from her coffee cup. She took a sip of coffee and adjusted the rollers in her hair. She rubbed her eyes, which were still puffy from crying into her pillow all night.
Vlad shuffled into the room, wearing nothing but his briefs and a stained t-shirt, "hey you fat, pig, how are you this morning," he burped.
"Vlad, we have to talk."
"What now, fat-ass?"
"It's about Marticock. You have to stop molesting him... I think it will make it harder for him to make friends later on..."
Vlad slammed his fist onto the table, causing Reza to jump. She farted.
"You're not supposed to think, bitch! You're supposed to be making me breakfast! Where is it?!"
"Vlad, please..."
"Remember when we saw the Matrix Reloaded last weekend? THAT'S the style of Martial Arts I practice, bitch. You're about to get a FREE LESSON!"
Reza rose from her chair, causing it to fall over and ran - as best she could - into the bedroom to cry again.
"Fucking bitch," Vlad farted.
In the Ghetto Part III
Vlad sat on the living room couch, thecushions torn and vomiting foam from their inner core as he bounced up and down in excitement. He screamed at the television, as he shook his fist at it, sending Budweiser spilling out all over the floor.
"Come on, you goddamn white boy, if I wuz in there, he'd be dead now. Let's see some goddamn wrestling!"
Vlad didn't notice the doorbell ringing and continued screaming obsessively at the television as Reza bounced through the room to open the door.
Reza stood at the doorway in a sheeny, purple, see-through nighty, smiling at the black couple who greeted her, "hi I'm Reza! You must be Pedro and Florence from the personal ad..."
As a commercial flashed onto the television, Vlad turned to see what all the comotion was about. He recognized Pedro in the blue cathode-ray glow, "hey DOOOOOG!"
Vlad hopped from the couch, emitting a spurt of gas as he did so.
Pedro and Florence, who was holding a fat black child with curly hair, entered the dingey apartment. Vlad and Pedro high-fived each other and then Pedro began to rap:
This is Pedro G / Gangsta P / Sippin' on Hi-C / Smokin' PCP / Smooooooth Nigga
Vlad began to break-dance to the off-the-cuff rap. Farting with each bend of the leg and twist of the waist.
Oooooooh. A little Mastah B on the Bonus T
Got it goin' on girl
Droppin' Baby Marticock on your ass, Byatttch
Vlad and Pedro laughed heartily and butted guts.
"You ready to do some swappin' V-Dog," Pedro drooled. Reza grew wet with the suggestion.
"You bet I is, bro," Vlad replied eagerly. He trampled off into the other room, much to Reza's confusion.
In no time at all, Vlad returned holding Marticock, gurgling and farting. Pedro took his child from Florence and exchanged him for Marticock.
Reza frowned and shook her head, "no, no, no!"
Vlad and Pedro laughed as Reza and Florence ran into the bedroom to weep.
Vlad grinned as he removed the black child's diaper, "this is gonna be good! I never cornholed me a nigra before!"
In the Ghetto Part IV
Reza gazed into
That was a long summary.
Thats what she said
That would be incorrect. The number of genomes in the human genome is 1.
Brandon
How to post a story correctly so it doesn't take up an entire page? Thanks.
It is the number of genes that has been revised down. The genome is the complete set of DNA and contains all the genes.
Film at 11.
In the Ghetto Part XI
Reza unfastened the tape that secured the diaper around Marticock's waist. A gag reflex gripped her stomach as the powerful stench of Marticock's hour-old feces assaulted her nostrils. As Reza wrestled with the baby's kicking legs, the fat hanging from her arms rippled and quivered. Reza tried to hold back a cough as her stomach squeezed around the massive lunch she had just eaten. The attempt was futile and Reza coughed and choked simultaneously, causing a large wad of mucus to land on Marticock's face. Marticock clumsily wiped away the mucus with his waving arm and licked it off his hand.
Reza turned Marticock over on the changing table, so that he layed on his stomach. His bottom was smeared with brown goo, which had Vlad's semen mixed in with it. Reza's mouth watered at the sight of the milky white fluid. Her sexual desire burned so strongly within her, that it blinded her to Marticock's feces-smeared butt and all she could see were the love juices of her beloved Vlad, who sat farting in the living room of the double-wide. Reza's mouth watered.
It had been so long since Vlad had shot a load into her multi-chinned mouth. Her jowls quivered like the giant hanging testicles of a prized race-horse. Reza longed to once again partake of the fruits of Vlad's testes; she became entranced; the room melted away; marticock dissolved. The perimeter of her vision narrowed until all she could see was the thick white fluid. Reza lowered her face to Marticock's ass and began to lick the stale semen. It's cold saltiness made her mouth come alive. As she devoured more and more of the fluid, she began to lick more vigorously, until Marticock's ass had been licked clean.
That was just enough to whet her appetite. Reza flipped Marticock over onto his back and took his genitals into her stench-ridden mouth. She sucked on his scrotum and tiny penis all at once. Marticock gurgled with a satisfaction he could not begin to comprehend. Reza was so enchanted by her tender moment with her son, she did not hear the heavy thuds making their way down the center of the double-wide.
Marticock's bedroom door, paper-thin as the walls, flung open and Vlad stood at the entrance wearing his stained t-shirt and yellowed white briefs. Vlad farted with rage, "what in the hell do you think you're doing to my son, you fat cunt?"
A burst of gas was ejected from Reza's bowel by the tensing of her colonic nerves, "I, I..."
Vlad's face reddened and the vein in his temple began to throb, "I told you Marticock is MINE!"
Reza covered her face with her massive arms as Vlad stormed over to her. He raised a massive hairy fist and brought it down upon the quivering tub of lard, "I'll teach you to screw with my Marticock!"
"My Marticock," Vlad yelled, as he repeatedly beat the elephantine woman, "My Marticock!"
"My... Marti... COCK!"
Reza crumpled into a bawling heap on the dirty carpet of the double wide. As she lay shaking and crying, Vlad pulled his thimble-sized penis through the opening in the front of his briefs. He massaged his penis until it was hard and then plunged it into Marticock's ass, which was wet with Reza's saliva.
"Awwwwww, yeah," Vlad gasped.
In the Ghetto Part XII
Editor's Note: a small portion of Chapter XII was leaked out a bit early, causing the context of the chapter to be entirely lost. We apologize for the error.
The universe you see around you is not all that there is. For everything that exists, there is an antipode to its existence. For every idea, there is an antithesis. Our own reality, viewed from the other side, is a very different place. This "mirror universe" is an equal but opposite shadow of our own. It can be called the Evil Universe as well, because although our own universe is held together by the laws of order that bind atoms, molecules, planets, and even human souls together into harmony, the mirror universe is
Did you mean the number of genes?
Does this level of complexity shrink a little as well as grow a little due to less genomes being in existence? I think while the interactions are common maybe when that common "language" is found then it will make things easier.
The iPod Lite Project taking orders soon.
The article poster mistook 'Genome' for 'Gene'. Organisms only have one genome as it is a collection of genes.
Go to the back of the class!
In the Ghetto Part XXI
Vlad had surgeoned the carburetor of the Chevy van with a degree of incompetence befitting a Lockwood. The van shook as it inched down the street; every few minutes, the exhaust manifold would flood with pure gas and react with a massive backfire. The van would then stall a moment and then lurch forward with a great burst of speed. This behavior seemed normal to Vlad, who had grown up believing that any healthy system must emit gas nearly constantly. The van was simply farting in the tradition of any normal "healthy" Lockwood.
As the van lurched and shook, the imitation-gold medallion Vlad had hung from the rear-view mirror would swing wildly and knock him in the head. Vlad paid no attention, as he sang along with the eminem 8-track that was blasting at full volume. Onlookers pointed and laughed as the primer-colored van shimmied past them, with it's ridiculous driver singing and moving his head in rythm to the music that spoke so sweetly to the angry teen within.
Marticock wailed each time he was tossed about in the passenger seat. Each jerk of the van would throw Marticock against the door and loosen a pocket of gas. The burning methane would irritate his infected, gangrened rectum, causing him to scream out in agony. His face was red and his eyes were glassy from tears. A constant stream of bloodied pus oozed into his diaper. Marticock was only eight months old, but he was already developing a characteristic Lockwood beer gut. His stomach bounced and jiggled with the surging of the van and his tiny penis twitched in time with the music blaring from the speakers.
The power steering mechanism of the van was one of the many casualties of the jolted engine and Vlad struggled to turn the vehicle to the left. He barely managed to get the wheels turned in time and the sides of the wheels scraped the curb to the right, sending two hubcaps flying out at unsuspecting pedestrians. Vlad panted and sweat rolled down his face from the effort put into turning the steering wheel. Vlad floored the breaks and the vehicle slowly stopped in front of a sleazy-looking shop.
Vlad grabbed Marticock and lumbered into Priscilla's Sex Shop. Slowly, he waddled up to the counter and sat Marticock - dressed only in his skimpy diaper - onto the sticky floor. A rather robust woman was standing behind the counter, she forced a smile in greeting, "hi there... what can I do for you today?"
Vlad paused a moment to drool and remember the list of items he had come to purchase, "uhhhh. Let's see. Okay. I want a 12-inch Slim John, an extra-wide Smiling Joe, a pound of Love Balls. I need a Butt Beaver with extra fur. Uhhhh...."
Marticock gurgled as he played with some lint he found on the floor.
"Oh yeah, I need a glossy black leather ghimp suit."
The sales-lady was unphased by the list, having worked at Priscilla's for ten years, "What size would you like that ghimp suit?"
Vlad looked down at the gurgling Marticock and realized he didn't know what size to request. He bent over and grabbed Marticock by the back of his diaper. He lifted Marticock up for the sales lady. "This size," he panted.
As Marticock hung over the counter, a glop of bloody pus plopped out of his diaper and spattered on the counter. Vlad stared at the ooze for a moment and farted, "Oh yeah, and do you sell Vagisil?"
The sales lady disappeared into the dank shadows of the sex shop and returned with a large bag stuffed with goodies. Vlad drooled as he imagined the various uses to which he would put these wonderous space-aged products.
The lady expertly punched several keys on the cash register and derived a total, "that will be 128 dollars and 64 cents, sir, will that be cash, check or charge?"
Vlad farted, "food stamps".
In the Ghetto Part XXII
Vlad couldn't believe that the Welfare Department and Social Services were forcing him to go find a job. El-Arse hosting would soon have a
Slash the summary length!
25,000 genes will be enough for everyone. - 2004
Call me old-fashioned, but I really despise when "Intelligent Design" proponents pop up in threads like this. "See, the number of genes to work with is so much lower than you'd expect, so the complexity between each gene is more complex than chance would dictate. Ergo Something had to have designed it."
Please. I find that such distrust in the machinations of Nature itself shows us how narrow minded these "scientists" are. "I can't understand it, so God must have done it," essentially. This does not open the door to further research and understanding. On the contrary it closes the door because there is nothing more to be understood beyond "God did it".
Nature is a truly amazing thing. Evolution, Physics, Gravitation, the Stars, the Cells, everything is absolutely beautiful. Why the need to spoil Gaia with your imaginary friend?
true
The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family.
Damn elitist mustard, looking down on us.
In the Ghetto Part XXVI
Vlad, for the first time in quite a while, was alone in the house. A couple of days before Reza had complained of cramping in her lower abdomen and they realized that she was constipated again. They quickly hurried her massive bulk onto the back of a super-semi and shipped her off to the Nevada Test Site. There she would receive her annual metamucil treatment and the compacted toxic substances be disposed of in the only place on Earth more polluted than the Lockwood house. Only when they had shipped her out did he realize that Marticock must have somehow slipped between the folds of flab on her obese frame and had gone with her. Now he was lost, alone, and looking for amusement.
He had considered phoning for a hooker, but you needed money for that. Twenty bucks would break him, and they didn't take beer bottles. Besides, the hookers were mostly women, and the last time he had one he couldn't get the sound of laughter out of his head for days.
Vlad let off a massive fart and small amounts of brown, fluid fecal matter dripped out of his ass and onto the floor. As he moved forward he stepped on the various cheetos, pretzels and shit that he hadn't bothered to clean up. He scratched his anus as the fart had irritated his hemmorhoids yet again. His arm strained to get his hand back there and he pulled a muscle. In agony he pulled his arm back and collapsed to the floor in a massive flaccid heap.
A thousand miles away, a seismic sensor activated at Vlad's dropping to the floor. Later on CNN it was reported that a 4.5 earthquake had shaken Joliet.
Vlad grunted as he pulled himself up and made his way to the computer. Even though it was only ten feet away, it was a herculean effort. And his ass still itched. "Goddamnit..." he belched as he said it "...fucking AV3. This is their fault."
He pushed aside the used Fritos bags and beer bottles that had accumulated around his 'Work Station'. As he was about to logon to Kuro5hin the doorbell suddenly rang. He waddled over to the door and opened it. It was his neighbor. He was a gigantic man, but unlike Vlad all his mass was muscle and not billowing waves of fat. He took a puff of his Marlboro and blew it in Vlad's face. It didn't affect Vlad at all, as he was used to both his and Reza's own toxic gases.
"Lockwood, did you fuckin' fall on the floor again? This is the third time this month I've had to replace all my fuckin' dishes because you keep on trippin' on your fat ass!"
"I own a business, go fuck yourself! Welcome to /dev/null." It was the only
thing Vlad could think of. His mind had atrophied to the point where the words had
become automatic.
"What the fuck did you just say to me you fat piece of shit?" The man's hand slammed into Vlad and he went tumbling backwards.
"Just wait'll I get up. Have you seen Love Story? That's the kind of martial arts I practice!"
The man stood over Vlad and was about to ram his foot his Vlad's ass when Vlad farted. The sudden expulsion of gas engulfed the man and he started to choke. But even worse, his cigarette ignited the foul odor. Suddenly, the man was engulfed a ball of flame and he went screaming out the door. The force of the blast went all the way up into Vlad's anus and sent him rocketing across the room where he slammed head first in the wall. The entire house shuddered and collapsed around him.
In the wreckage Vlad smiled. The pain from the impact had shaken loose his 1/2" cock and he had cum spontaneously. He looked proudly down at the tiny pool of semen on the ground. He at last had found a way to amuse himself.
And his ass had stopped itching too.
In the Ghetto Part XXVII
Anal Faggotry at Garnsey Park
Vlad was angry. Vlad was mad. Vlad was furious. Vlad farted.
"Those LITTLE BITCHES on the Internet are really starting to get to me," Vlad silently admitted to himself. "Who the fuck made THEM judge & jur
Step 1: Using stem cell research create a new human-like lifeform with many more genes than humans that will have incredible power
Step 2: ???
Step 3: Profit
In late breaking news, the final count of genomes in a typical human being has been found to be exactly 1. See http://en.wikipedia.org/wiki/Genome for details.
As quite possibly the only member of the old-school Slashdot trolls to ever actually attempt a serious and meaningful conversation with Mr. Lockwood (it worked, briefly), I feel compelled to comment on this.
That Geekizoid is an inanity is beyond dispute. That it is what it is almost entirely because of Mr. Lockwood is also beyond dispute. That Mr. Lockwood has, furthermore, contributed substantially to the deterioration of every site to which he has ever posted, save only those which were beyond redemption before he ever saw them (a category which arguably includes Slashdot), I will not dispute. That all of this, along with the other charges leveled against him, proves that Mr. Lockwood sucks, I will not dispute.
The real question behind all this, though, is not whether Mr. Lockwood sucks, but why Mr. Lockwood sucks. One might say that it does not matter, noting, by analogy, that one does not psychoanalyze a rabid dog, but instead simply puts it out of its misery. But it does matter, for in his own odd and frightening way, Scott Lockwood is Everyman. If you do not understand him, you do not understand anyone, probably including yourself.
Everyone, seemingly, detests Mr. Lockwood. Given that he had been married four times before he turned 30, this "everyone" may well include three ex-wives (last I heard, we're still waiting for his inevitable fourth divorce). From various anecdotes he has let drop over the years, there are a variety of real-life acquaintances, co-workers, and blood relatives in this category as well. So clearly, this is not just an online phenomenon; Mr. Lockwood is not a caring, sensitive man who lets off steam late at night by flaming people on weblogs. He is like this all the time. It is not a pose. It is the real Scott Lockwood, at 200 proof.
Mr. Lockwood himself is not unaware of this. He knows (and wishes it were not so) that dislike follows him around like the odor of alcohol trails after a drunk. But he has no idea why this is so. He knows it has to do with his abrasive and temperamental demeanor; he knows that his argumentative and self-righteous comments, and his complaints of being mistreated, win him no friends. But the connection between the cause and the effect, and the difference between his conduct and most other people's, escapes him. He has given up hope of understanding or improving the situation; he expects that it will continue, without change, for the rest of his life.
Mr. Lockwood does not understand that all of these things are symptomatic of a malaise that underlies his entire life. It is a condition that he was very nearly born with, and one which victimizes nearly all people to some degree. Most of us are not nearly as bad off as Mr. Lockwood; but there are some that have much more severe cases than him. Many rapists, murderers, and other violent criminals fall into that latter category. But even those of us who merely think ourselves better or smarter than everyone else, or who consider ourselves fit to decide what is right for everyone else, or who mock others for what they believe, are victims of this condition to some degree. I include myself in this; I do not claim (yet) to be speaking from a perspective completely outside the state of disease.
Mr. Lockwood's problem, to put it simply, is that he perceives the universe to be antagonistic to him. He has divided the universe into Self and Other, and decided that these two are eternal antagonists. Everything is his enemy; every action that anyone takes (other than to praise him), he perceives as some sort of attack, and he retaliates accordingly. He is convinced, although probably only subconsciously, that his life is a war in which he stands alone against all the forces of the universe. It is, in essence, the ultimate in paranoia.
As I wrote above, nearly everyone shares this condition to some extent. Many serial killers operate on the principle that, life being a never-ending battle that they will ultimately lose, they should take as many of the "enemy" with them as th
Proteome research is the new genome research.
Karma: -2147483648 (Mostly affected by integer overflow)
Where'd they off-shore the genes to?
"Like fire and fusion, government is a dangerous servant and a terrible master."~RAH
a Genome is made up of Genes, an organism only has one genome. Also the number of genes a organism has is not directly related to the complexity of the organism.
...both individual genes and interactions between genes must be proportionately more complex, in order to get the same level of complexity out.
That or we can finally admit that we aren't as hot as we thought we were. I mean honestly, a mustard plant? Couldn't our superiourity be overthrown by something that at least has legs?
It's all in the numbers baby, and someday I hope to live up to our mustard plant elders.
"What do you despise? By this are you truly known." --Princess Irulan, Manual of Muad'Dib
/)
The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genomes at around 44,000 - or even as high as 100,000.
AFAIK, there's a lot more research going into the human genome than into the Arabidopsis one. So one would naturally presume that the number of human genes would be known better.
But if the estimate for the number of human genes is subject to so much variation, how can you be so sure of that for the Arabidopsis?
Is this a meaningful comparison?
(Not to mention that the entire premise seems to be flawed..)
Trolling is dead. This place is dead. This place has been dead for far too long. The Revolution and The Rebirth are coming.
Trolling will be re-born.
A New Era dawns. The future grows near.
The Revolution will be devastating.
The Rebirth will be glorious.
The End Is Near.
The Revolution: December 31st, 2002
The Rebirth: January 1st, 2003
Trolling is dead.
Trolling will be born again.
Trolling will return.
Trolling will return with FIRE.
January 1st, 2003.
Mark your calendars.
Clear your calendars.
Reschedule your life.
Everything you know is a lie.
Everything you know is going to change.
This is not the end.
This is not the beginning of the end.
This is the end of the beginning.
The Third Age of Trolling is about to begin.
January 1st, 2003.
It's coming. The Rebirth.
You are powerless to stop it.
Only a fool would try.
If you are a troll, rejoice.
The time of our supremacy is at hand.
The Revolution is coming. The Rebirth draws near. The fate of destruction is also the joy of rebirth. It's all about to change... forevar. THE END: December 31st, 2002. THE BEGINNING: January 1st, 2003. History has come full-circle. Get ready to troll, motherfuckers.
~ The New True Troll High Council
It's coming.
You are not ready.
You can't stop it.
TROLLING BEGINS:
January 1st, 2003.
It's coming.
According to scientists, we gained 1000 genes compared to rodents when we diverged from them 75 millions years ago. And we 'lost' 33 genes compared to them (they have a functional copy, we have a nonfunctional pseudogene; it's still there, only not working - stop codons, etc).
The "we must have more gene than (insert stupid animal or plant here)" is funny. Our superiority complex at its best.
Read about the whole thing (with more links) on my blog (see sig)
Eureka Science News - automatically updated
How long before someone blames this on Bill Gates or George Bush?
Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
Female hyenas are virtually indistinguishable from males. Their clitoris is enlarged and extended to form an organ of the same size, shape, and position as the male penis. It can also be erected. Their labia have folded up and fused to form a false scrotum that is not discernibly different in external form or location from the true scrotum of males.
It even contains fatty tissue forming two swellings easily mistaken for testicles. Authors of the most recent paper on spotted hyenas found the appearance of males and females so close that sex could only be determined with certainty by palpation of the scrotum. Testes could be located in the scrotum of the male compared with soft adipose tissue in the false scrotum of the female.
Oh wait .. just read the post.
... hehe.
Damn newbies
Funtage Factor: Purple
This items made me recall a science film we watched when I was in grade 8. It was all about chromosomes.
There was an actor playing a typical I-don't-care-about-no-science-so- long-as-my-tractor-runs-right yokel who, as the 'scientist' (read: guy in a lab coat) noted that the fruit fly has five chromosomes and humans have 23, remarked "well, that's because people are the most advanced creatures on the planet."
The look on his face was priceless when he found out that potatoes have over forty.
- - - -
KickingDragon
What is the evil force behind all wrongdoing in the universe?
It never had a name. Until now. Until we identified it and studied it while making ready to destroy it.
Its name is VladeKua5y !
VladeKua5y (pronounced "Vladequacy") is the root of the problem. VladeKua5y is the root of all problems. VladeKua5y is the enemy. VladeKua5y is what must be destroyed.
Kuro5hin + Vladinator + Adequacy = VladeKua5y !!
Who is the enemy? VladeKua5y ! VladeKua5y ! VladeKua5y !
What must be destroyed? VladeKua5y ! VladeKua5y ! VladeKua5y !
Who is the enemy of all trollers evarywhere? VladeKua5y ! VladeKua5y ! VladeKua5y !
Here is some information on VladeKua5y . Expect more people like Rusty Foster to be added soon.
NAME: Burdge, Jonathan E-MAIL: jlb@io.com, jlbatdarc@w-link.net, elby@adequacy.org, darc@w-link.net ALIASES: lb, jlb, Elby
NAME: Casillas, Luis E-MAIL: casillas@stanford.edu, em@adequacy.org ALIASES: em, Estanislao Martinez, Sylvain Tremblay
NAME: Corrigan, Barry E-MAIL: barry@bjcorrigan.fsnet.co.uk, bc@adequacy.org ALIASES: bc, ktb (Kiss the Blade), Lover's Arrival, Euroderf, Erbert Paget-Paget, Anya
NAME: Dickson, Craig E-MAIL: crd@inversenet.com, mendaxveritas@yahoo.com, mendaxveritas@pacbell.net ALIASES: mv, Mendax Veritas
NAME: Flickinger, Dan E-MAIL: flikx@geekizoid.com, flikee@xmission.com ALIASES: flikx
NAME: Haberberger, George E-MAIL: ghaberbe@frontiernet.net, George.Haberberger@usa.xerox.com ALIASES: GeorgeHa, Hairy_Potter
NAME: Huston, Bill E-MAIL: bozoman@vlad.geekizoid.com, ALIASES: bozoman
NAME: Johnson, Peter E-MAIL: peter.johnson@voicestream.com, shoeboy@adequacy.org ALIASES: Shoeboy, Peter Johnson
NAME: Lockwood, Scott E-MAIL: wsl3@attbi.com, vlad@geekizoid.com ALIASES: Vladinator, Lonesome Cowboy Burt, Quick Star, Pinkerton Floyd, etc.
NAME: Linwood, Rob E-MAIL: rcl@cs.csoft.net, rcl211@is9.nyu.edu ALIASES: AuntFloyd, Con Troll
NAME: Mann, Warren E-MAIL: broken@warmann.com ALIASES: osm, OpenSourceMan
NAME: McPherson, Craig E-MAIL: craig@laceyonline.com ALIASES: craig, naked&petrified guy
NAME: Nelson, Brian E-MAIL: elenchos@adequacy.org ALIASES: Elenchos
NAME: Osborne, Michaell E-MAIL: osborm@yahoo.com, dmg@adequacy.org,
Before you visit the new crapflooder website, www.sporks-r-us.com, there are a few points you should review about the owner and administrator of SRU, Vladinator. Scott (Vladinator's "real life" handle he goes by in public) won't tell you any of the following facts because he's afraid you'll be put off by his sordid, depraved, criminal past and close your browser window before he can log your IP address and password!
It is my duty to you, gentle reader, to make sure all of the relevant knowledge is out in the air before you do something you may regret, like registering an account or posting in a discussion on www.sporks-r-us.com.
PLEASE review the following facts about Vladinator:
( and often posts communications between them to make them appear to be more than one person!!! ):
I was at a lecture by Evelyn Fox Keller, and she said that there has been a paradigm shift and we're moving from breaking up biology into tiny parts, to seeing the whole picture. Whether theres 100,000 or 20,000 genomes seems rather trivial.
Would not reducing the number of genes from 100,000 down to 25,000 reduce the number of possible interactions from (100,000!/2) to (25,000!/2)? Thats a factor of a number that has 357480 digits!
savagely revised
What, did they revise the number with a chainsaw?
Sad news, Britney Spears dead at 22
I just heard some really sad news on Fox - Singer and Popstar Britney Jean Spears was found dead in her Louisana home this morning.
Apparently, the cause of death was excessive bleeding after a sizzling night of hot anal sex with her ex. boyfriend, Justin Timberlake.
"We were just having good sushi, and she asked me if I would please her", said Justin. Although he has since turned gay after his breakup with her, Justin was willing to please Britney as long as she would take it up her ass.
Following a night of sex for 10 hours, Britney sustained an injury in her lower vaginal area and subsequently bled to death. Her husband Kevin Federline, who is at the moment spending time at a federal prison for sexual advances towards Natalie "hot grits" Portman was not available for comment.
However, President George W Bush offered his comments on the incident. "Here is the reason why anal sex is bad and why gays are unAmerican, they kill Americans and American icons", he was quoted as saying.
There weren't any more details. I'm sure everyone in the Slashdot community will surely miss her - even if you didn't enjoy her work, there's no denying her contributions to popular culture. Truly an American icon.
*sob*
Hit me baby, one more time. I'll miss you, oh baby baby.
Indeed, Britney. Indeed. Rest in peace, child.
Now that the namespace is half as big, the properties are twice as valuable! Time to double up the patent lawyer staff.
--
make install -not war
human genome count SLASHDOTTED
Somewhat on, and somewhat off--topic, I'm reading a novel by Greag Bear called Darwin's Children. And it's pretty deep...if not totally engrossing.
It has a lot to do with viruses (especially 'ancient' viruses) being part and parcel of the process of human evolution.
Even discounting for protein modifications and assuming one gene = one protein, 20,000 genes is plenty to build a human.
It is time to set the record straight regarding the situation with respect to Vladinator/JCB/Reza/Lonesome Cowboy Burt/Whatever other aliases he may be using. The situation has been confused due to the recent world-wide influx of Vlad-haters, helper-cells, interested third parties and the occasional Vlad sympathizer.
Let us start with a basic tenet of the Association of Anti-Vlad Avengers: There is no difference between William Scott Lockwood III and those who aid him, give him comfort, and/or use him as a substandard, "Always Save" hosting solution. Though we may have no direct quarrel with you, Mr. "Trollaxor", you appear to be friendly with Mr. Lockwood and - by your own admission - are using him as a substandard "Always Save" hosting solution. Consider the fact that if you were using a respectable host for your web site, you would not be having the difficulties you are having now. Also, with this attempt at ferreting out information for Mr. Lockwood, you are aiding and abetting our sworn enemy and have aligned yourself in direct oposition to a powerful internet force (that is, the AAA and its splinter groups).
This brings us to a primary characteristic of the AAA which has been detailed elsewhere, but which I will repeat here in interest of completeness: no single cell, as an entity, is aware of the members of any other cell. The structure of our association works as follows. Each cell is composed of no more and no less than three members who all reside in a roughly similar geographic area. One of the three members is designated as a messenger. This messenger is the only member in contact with a messenger from exactly two other cells. In this way, the members of each cell remain anonymous to the members of any other cell. If a messenger has been compromised, the corresponding cell is responsible for "cleansing" that messenger and replacing him or her with a new messenger. Such a cell will remain on probation - meaning they will only be allowed contact with a single other cell - until such time as the new messenger has been operating for no less than six months.
Our activities are clandestine and even if another cell wanted to share the information you request, it would not be able to because it would not be privy to said information.
As you can see the AAA, though very loosely connected, operates in a highly efficient manner and is deadly serious about the stated goals of the organization: namely, the complete, unconditional eradication of Vladinator, in any and all forms, from the internet.
We have been following the current situation with Vladinator's hosting service quite closely and we estimate the damages to be severe at this point. However, we cannot agree to end our champaign any sooner than already decided upon. We may have shown mercy in this, our second major attack, if Mr. Lockwood had shown the proper degree of humility at our hands. Instead, Mr. Lockwood responded with his usual barrage of lies and vitriol. For this reason, and the fact that we are otherwise bored, we have extended the length of this attack. We realize that Mr. Lockwood's hosting company will try various tricks to deflect our attack, things such as firewalls and IP banning. Eventually, they will succeed in eliminating the current attack at which point we will rest for a period of not less than seven days prior to initiating another attack.
We predict that the end of this second wave will result in another round of cockiness from Mr. Lockwood, given the highly reactionary character that he is. The next attack, which will be the "third wave", will be far more subtle than the current attack and will undoubtedly shake Mr. Lockwood's faith in his current alliances and dealings. This cycle of attack/end att
GNAA (GAY NIGGER teeth into when the fruitless states that there corps3 turned 0ver taken over by BSDI believe their Fact: *BSD IS A how it was supposed things the right
Since we have fewer genes than a flower but are more complex, does this mean that the arrangement of our own genes - and of other organisms - is more important than the quantity? Does this in any way change the way in which geneticists are to evaluate the genomes of other species in the future?
A blog like any other.
I for one, welcome our new Arabidopsis overlords.
I wonder if the submitter's gnome codes for the concept of "Read More"?
In GT (genetic therapy) one tries to integrate a piece of foreign dna into a malfunctioning organism. The integration process is virtually random. That is there is equal chance that the piece you are integrating will hit any place in the genome. Therefore, no wonder that might cause cancer, which can be usually tracked to particular dna damages. You try to cure one thing but break another. So far there are no efficient mechanisms to target and alter the specific place in the dna that you need.
Genome = Full dna sequence(s) of a particular organism
Gene = a genomic region that is transcribed and translated into protein(s); yes, a single gene may produce several different proteins.
Intro to genetics. Remember splicing can create a lot more variation (and headache if you're trying to understand it).
With the cyberthalamus, the singularity will happen.
The Sox won the pendant
You're right, unless you include the genomes of the various bacteria and other organisms which absolutely must exist within the typical human being's body for that human to survive.
But yeah, I thought the same thing.
Any good software programmer knows that good design and elegance beats bloat every time.
Si tacuisses philosophus mansisses. If you had kept quiet, you would have remained a philosopher.
Woah! More than one paragraph? Will Slashdot get rid of italics too, and start having quality articles?
They're only counting the different sequences of DNA which are transcribed to give proteins. That's like counting the lines of C code in a program that abuses the preprocessor extensively. You're ignoring all the ifdefs, the macros, the set of makefiles and shell scripts stuffed into comments, and so forth.
Sure, you have a small set of proteins. But these proteins are expressed or not expressed based on binding sites for other molecules in the non-transcribed DNA around the portion for the proteins; this is sufficient to account for the differences between all of the types of cells in your body, which is clearly a major set of variations.
to how many genomes are in a single human genome. However, speaking about genes in a genome, as the article states, this "correction" only counts those genes that make some discernable protein product. The number misses the number of open reading frames (ORF) that may not encode a protein at all, but a regulatory or enzymatic RNA. Probably, the next big project in life/medical research, after the big proteomics initiatives, will be the study of non-protein encoding ORFs. This problem is very tough to crack since 1) these RNA's do not have a common sequence element like "normal" messenger RNAs, 2) may be as short as 15 base pair (LIN12(?) in C. elegans), and 3) there are MANY, MANY possible ORFs in the genome.
Are these technically genes? They are regulated. They have a function. They are transcribed. The only thing different from the standard definition of a gene is that the RNA is not translated into protein.
In addition to multiple protein products from one "gene" as the article states, regulation of the gene may also be much more complex compared to "lower" organism. For example, the gene expression profile of the malarial parasite Plasmodium falciparum suggests very limited regulation. Basically, it looks like a linear progression with very limit amount of response. So, temporal and spatial regulation makes even multiple product genes seem to like a larger cohort of genes. Take the daughterless gene in Drosophila. It is used very early in embryonic development to control sexual differentiation. However, later, the gene product is used in neuronal differentiation. So, for the fly, sex is literally on the brain.
I have a question though... If were just now finding out approximately how many human genomes there are, how did we know with certainty how many genomes belong to the Arabidopsis?
Wouldn't the genome count for the Arabidopsis be based on the same flawed estimation techniques used for the preliminary human genome estimate?
What makes people think that the intricate balance of our DNA achieved from 10s of thousands of years of evolution can be maintained when you make drastic localised changes like gene therapy? Stop treating humans like software systems where you can go in and refactor class interfaces as and when you like!
www.rexguo.com - Technologist + Designer
There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer,
Nor should there be; general estimates of the number of genes have nothing to do with mechanisms by which gene therapy might cause cancer. Nor is it unexpected that gene therapy can cause cancer; that has always been a known risk.
although if you now factor in the increased complexity of interactions, it is possible that such side-efects can be better understood and therefore prevented.
Anything is possible, I suppose. But common ways in which gene therapy could cause cancer are already understood. Doubtlessly, there are many more possibilities, but to identify them requires a specific understanding of those "interactions", something that is being worked on anyway.
...but does he use ZIP or LZH?
The article mentions a number of reasons why the # of genes that humans have really isn't a good measure of complexity. I think the easist to understand is the fact that one gene can code multiple proteins (molecular machines that do the work in your body).
The gene therapy link is irrelevant. Gene therapy causing cancer has very little to do with the # of genes in the genome. The problem is the mechanism being used to deliver fixed genes to human could cause cancer. Imagine someone sent you a patch for your code, but instead of injecting inserting it into the right place, it got inserted randomly -- obviously this could ause your program to crash. Well, that's what gene therapy was doing, sort-of. And instead of crashing, you got cancer.
When the articles talk of "estimate" numbers of genes, they are not referring to the known numbers of genes. Instead, they are referring to computational predictions, based on certain patterns found in the genome.
A gene is predicted if it has traits such as known start and stop codons, promoter regions, G-C content, and so on. These patterns are quite complex, and current algorithms are about 50-60% correct.
The actual number of experimentally confirmed sequences is in the low thousands, IIRC.
Prefer KDE!
Slashdot editors, don't post this article this late at night. Someone will read it as "GNOME users slashed in half, all switched to KDE" and a flame war will ensue. Then in the morning when they check their info page and see they've been modded offtopic, all hell will ensue. I mod this article as flamebait on those reasons alone.
Speaking of slashed, it is now official. Headcraft confirms: *BEHEADING is dying
One more crippling bombshell hit the already beleaguered *BEHEADING community when Headcraft confirmed that the total number of executions by *BEHEADING dropped yet again, now down to less than a fraction of 1 percent of all executions worldwide. Coming on the heels of a recent Headcraft survey which plainly states that *BEHEADING has dropped dramatically after the US invasion of Iraq, this news serves to reinforce what we've known all along. *BEHEADING is collapsing in complete disarray, as fittingly exemplified by failing dead last in the recent Ruthless Dictators comprehensive execution test.
You don't need to be a Jailed Dictator to predict *BEHEADING's future. The hand writing is on the wall: *BEHEADING faces a bleak future. In fact there won't be any future at all for *BEHEADING because *BEHEADING is dying. Things are looking very bad for *BEHEADING. As many of us are already aware, *BEHEADING continues to lose market share. Rivers of blood no longer flow from headless corpses..
Ruthless dictator *BEHEADING is the most endangered of them all, having lost 93% of its core dictators. The sudden and unpleasant deaths of long time *BEHEADING evangelists Uday and Qusay Hussein only serve to underscore the point more clearly. There can no longer be any doubt: *BEHEADING is dying.
Let's keep to the facts and look at the numbers.
*BEHEADING leader Qusay stated that 500,000 Iraqis 'dissappeard' during Saddam's regime. How many of them died by *BEHEADING? Let's see. Executions were generally carried out by hanging, bullet to the head, or *BEHEADING. With *BEHEADING being to most difficult to clean up after, let's conservatively estimate that only 5% of the Iraqis that 'disappeared' were *BEHEADED, so 500,000 / 20 = 25,000 deaths by *BEHEADING during Saddam's regime. Saddam took power in 1979, meaning his regime lasted 24 years. Therefore there were (25,000 / 24) ~ 1041 *BEHEADINGS PER YEAR during Saddam's regime. This is consistent with human rights reports. Since the US invasion, there have been approximately 50 *BEHEADINGS. Therefore there have been (50 / 1.5) ~ 33 *BEHEADINGS PER YEAR after the US invasion. Clearly, the terrorists are not as efficient at *BEHEADING. *BEHEADINGS have dropped 97% in the past 18 months. Clearly *BEHEADING is dying.
Due to the troubles of Saddam's Regime, what with it being gone and everything, massive amounts of *BEHEADING stopped and was taken over by a dismal few but high profile *BEHEADINGs that were carried out by nothing but cowardly terrorists Now *BEHEADING is also dead, its corpse turned over to yet another charnel house.
All major surveys show that *BEHEADING has rapidly declined in market share. *BEHEADING is very sick and its long term survival prospects are very dim. If *BEHEADING is to survive at all it will be among terrorist networks. *BEHEADING continues to decay. Nothing short of a miracle could save it at this point in time. For all practical purposes, *BEHEADING is dying.
Fact: *BEHEADING is dead.
© 2004 CmdrTaco (troll)
I hope high gas prices are depriving your children, you fucking dumbass.
Only one? Ahem: Mitochondrial genome; Nuclear genome.
:)
As a mitochondrial researcher, I resent the most important organelle of the cell being overlooked or lumped in together with the nucleus here!
So I would say two genomes
PBS has excellent videos from the program Cracking the Code of Life of the teams (Human Genome Project and private company Celera) that worked on decoding the entire 3 billion sequences of the human genome. It is very worth watching to understand this article.
Let look at that stats:
Terrorist kill ~ 3000 people in 2001 and it becomes a focus of the US nation. While:
Breast cancer kills > 40,000 / year
Prostate cancer kills > 30,000 / year
Diabetes kills > 70,000 / year
The numbers world wide of course are much larger.
Yeah OT I know but these kind of discoveries convince me our priorities are misplaced.
DAMN THE PATRIOTS!
The human genome has major importance when one wants to identify your parents. A common phrase is "Who's your daddy?" Well? Who? Is? Your? Daddy? Now?
Red Sox kick butt! Yankees choke! Sorry, that is too harsh. The Yankees played good. My hat is off to the Yankees on a fine season. To be the best, one must beat the best. I may be gloating, but to gloat one must respect, in some degree, your opponent.
I took a big karma hit when the NE Patriots won the Super Bowl. Wait, the Pats won two Super Bowl! I really lost a bunch of Karma.
Oh well, gunga gallunga.
Go Sox!
Comment removed based on user account deletion
There are all sorts of DNA that don't encode for proteins, but do have functions. In the production of antibodies, for example, a cell uses a shotgun combinatorial attack using DNA as a template, basically a random-number source, to make a binding site for whatever antigen. There are certain sequences that are not genes, exactly, but can predispose a person towards autoimmune disorders.
Someone correct me if I'm making any egregious errors. The Major Histocompatibility Complex and all the other immunological complexities are very confusing. But the point is that the number of genes does not equate to the complexity of what those genes can do. For a programming analogy, think of unlambda or any of those other obfuscated functional programming languages. Another thing to consider is multi-functional proteins, with subunits that perform different tasks. Enzymes are a great example of that. It only takes one gene to produce beta-lactamase, but that enzyme chops antibiotics to pieces (not including vancomycin and some of the more exotic new antibiotics).
Si la vida me da palo, yo la voy a soportar Si la vida me da palo, yo la voy a espabilar
I've read the headline as "Human Genome Slashdotted" and I shouted: "Dear God, we're doomed!" My God, what an embarrassment... I need sleep.
Sincerely,
Pan Tarhei Hosé, PhD.
"Homo sum et cogito ergo odi profanum vulgus et libido."
Did anybody play Metal Gear Solid 2? This is really a cover-up by the Patriots to secretly engineer the genome army.
Am I the only one who saw the headline and thought the Human Genome was slashdoted?
Apple has never claimed not to be evil, they're just very stylish about it.
But how small can we get it if we code it in assembler? If we're really good maybe we can knock gestation time down to 8 months, and having them come out ready to walk.
The shift from 100,000 to 20,000 predicted genes is important because it signals a fundamental change in the way genomics are viewed. Scientists have to consider non-obvious explanations for genetic phenomenon. Why do we have a small number of genes, but a high level of complexity?
The genome is ~2% gene, the rest is largely unknown. Traditionally, this has been referred to as junk DNA, good for spacing, but not much else. Growing consensus believes there is more to these regions, and efforts are underway to explain them. One of the more significant points to consider is the amount of RNA made which never codes for protiens. Biology generally does away with useless actions, but non coding RNA is rampant.
The number of genes influences how hard scientists look at other explanations for phenomenon.
Of course not. On a biochemical level, all mammals are pretty much the same.
In fact, plants will need MORE genes than animals because more genes mean more chemical reactions they can perform and plants need a lot (flowering, mating, chemical signaling, anti bacterial/fungal chemicals--pretty much everything they DO is chemical), whereas in animals lot of the tasks can be done behaviorally (washing hands).
It is surprising to me that scientists though thumans would have more genes than animals. The reason humans have most complex behavior is through larger brain size, not diverse chemical reactions. I guess it's just knee jerk arrogance on our part.
In Soviet Russia, articles before post read *you*!
Just don't let Microsoft loose on re-engineering the human genome - it will bloat out to 50Mb and be even more susceptible to viruses, requiring plug-in service packs within 18 months
Wow, my hat's off to you sir. That's the easiest 5, Informative I've ever seen someone pull off on this Internet or any of the Internets for that matter.
this was to be expected. view any exe in notepad and you'll see a lot of stuff that looks like "junk" which is control of flow and math operations, etc. The stuff that doesn't look like "junk" is the strings, the stuff that has the most obvious mapping to the output. Up to now that's what they've been doing with genomes -- looking at the parts that have direct output and ignoring the "control" code.
... two..... 1 and 0
the matrix has you.... on the 13th floor of eXistenZ
number of possible genetic combinations: 27000! ~ infinity.
If there are less genes than we thought, the little buggers must be executing their comments.
http://pcblues.com - Digits and Wood
If you understand genetics, and RTFA's, there is a reason the article does not mention the cancer causing possibilities of genetic therapies.
It just isn't relevant.
What was announced was another revision of the Human Genome Project. Several years ago a rough draft was released, but there were many known errors and incomplete areas. The latest revision has only 341 gaps, down from 150,000. Gene therapy has hardly anything to do with the development.
It might just be that one who is a true scientist, AND a creationist
Most scientists regard creation science as, at best, a pseudoscience.
Some creationists posit that certain assumptions, procedures, theories, and findings of science, particularly the theory of evolution through natural selection, are scientifically incorrect. Creation science is a modern movement that attacks these ideas on scientific grounds and proposes alternative theories that are more compatible with creationism. This article uses the term creation scientist to mean a scientist who believes in creation science. Because creation science is not accepted by most scientists, this article uses the term mainstream scientist to mean a scientist who does not believe in creation science.
The term "creation science" covers a broad range of beliefs. There are many different creation scientific theories, each of which has its own supporters and detractors, both within and without the creation science community. Additionally, there are differing interpretations of what creation science is among those who consider themselves creation scientists. Some creation scientists do not seek to challenge mainstream scientists. Others deny the applicability of the scientific method and Occam's razor to their religiously-inspired beliefs about the physical world.
Not all creationists are creation scientists. Some creationists view scientific truth as separate from spiritual truth and are unconcerned by apparent contradictions between the two. Others believe that neither mainstream science nor creation science is appropriate, and prefer to be guided by revelation alone.
Creation science has been criticized by many mainstream scientists for making scientific errors. Consequently most mainstream scientists regard creation science as, at best, a pseudoscience. (Specific arguments and rebuttals are listed below.)
Many critics of creation science believe that all creation scientists attempt to falsely disguise the Biblical story of creation as science (Arthur, 1996). United States federal courts, including the United States Supreme Court, have been receptive to this argument, and have overturned various state laws seeking to give creation science equal time with the theory of evolution in public schools. See, for example, Edwards v. Aguillard, 482 U.S. 578 (1987) and McLean v. Arkansas Board of Education, 529 F.Supp. 1255 (1982); also Lemon v. Kurtzman, 403 US 602 (1971).
An often unknown fact is that a single gene can code for thousands of different proteins. Protein regulation can occur in a variety of way, one of which is through "junk" DNA.
Currently little is known on the exact mechanism, which is a huge impediment to proteomics. As the phenomenon is elucidated, expect to see a lot more useful information coming out of genome projects.
Computationally predicting the 3-D structure and function of a gene is far more important than you probably realize. Reaching this point will revolutionize almost every aspect of your life, from pharmaceuticals, to nutrition, to silico-neural interfaces.
"Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code."
I love the implicit anthropomorphism here. It could also mean simply that there's half as much information in you than you thought. Would that make you feel bad about yourself, thinking that you're less complicated than certain flowers? It could mean that the information density of the resulting blocks is greater, but it could just as easily not mean that. It could also mean that there's a greater level of redundancy in some organisms, limiting the frequency of mutation. Or a whole host of things!
It doesn't mean that you're twice as neat elsewhere because you feel robbed! You, sir, are not a unique and special snowflake!
slashing the human genome count, just after I paid full count for one!
There are many well understood phenomenon that show us we don't need a different gene for each different function.
Examples include alternative splicing: same gene sequence gets cut up and produces different protein, and lactate dehydrogenase: mother nature was a lazy ho so she used lactate dehydrogenase as an enzyme in one part of the body and a crystalin in the eye.
I see a lot of people taking complexity personally. There are many plants with large genomes. It may have to do with maintaining metabolism under ground and above ground, in and out of sunlight, not having tissues bathed in a constant temperature, constantly fueled and constantly oxegenated culture medium and being a sitting target for predation and not being able to shuffle information along at mach 0.5. We have solved some complexity issues with mobility, behavior and a high speed infrastructure.
I haven't the foggiest why this offtopic post got modded insightful? Anyway I have a couple things to say.
1) This subject is for books, not a slashdot post.
2) Lets agree to disagree.
3) If I have to go to school, and study books, and all the other stuff, to understand your position? Then the least you can do is the same to understand mine.
Don't buy into the evil propaganda about Jesus being a filthy sand-nigger kike. It's not true. Jesus wansn't no Jew, he came to earth to save the white man and only the white man! Be proud of your strong white heritage, bro!
gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac
Game: Player 'Donald J Trump' now has AI skill level 'experimental'.
That sounds like scientist doublespeak for "You're all imbred" :-)
These posts express my own personal views, not those of my employer
People thought that humans were so much superior to all other life, we must have more genes. I mean, we've got this huge brain and everything, surely that needs lots of genes to work? Well, it turns out that it doesn't. The neurones in your head are pretty much the same as ones in a dog, you've just got more of them. And they're joined together in different shapes.
All your genomes are belong to us...
It's clearly God's will that people die from diseases. Nothing to be done about that except accept Christ as our savior.
However, since God is on America's side in everything, any attack on the homeland is clearly against his will. So we must begin a Crusade!
I remember reading about a researcher who wanted to study genetic algorithms. I wish I had a link handy, but googling didn't turn it up.
Anyway, this guy wants to create a genetic algorithm that results in a circuit that can detect the difference between two tones, one something like 200 HZ and the other 2 KHZ.
He uses an FPGA chip to do the testing with. After a few weeks, he has an FPGA programmed such that it reliably discerns between the two input signals.
So, how does it work? Downloading the program from the FPGA chip results in a nonsensical circuit - except that it works. Running the same program on another FPGA chip of the same model results in a total failure.
Even changing the power supply makes the circuit not work! Months of study results in a complete, total unknown. Results inconclusive.
The human genome is not built of simple, engineered pieces. Interactions will occur with the total sum of possible interactions, down to the molecular level.
It will be many, many years before our own microbiological structure is understood. As we proceed, we'll see information technology and biology merge, as, when push comes to shove, both consist of the replication of complex patterns.
I have no problem with your religion until you decide it's reason to deprive others of the truth.
I honestly admire your brilliance, Sir. I really hope you save links to your work for future generations. We certainly need more masters of satire like yourself. You are currently my favourite Slashdot author. Thank you, Sir. It is an honour for me to read your brilliant posts. I refresh your user page even more frequently than the Slashdot front page. Thank you. Please forgive me if I write inconsistently, but I am very excited that I write to the finest writer on Slashdot. Thank you, Sir, for all the work of genius you are doing. Thank you. You are a tribute to human kind. Please remember that contrary to what the moderation and replies might suggest, there are people who understand your sense of humour and appreciate the value of your literature. Thank you very much.
It's not the size, it's how you use it?
Assume I was drunk when I posted this.
like amino acids: just 23 different amino acids can make more unique protiens than there are stars in the universe, and the protien length doesn' even need to be that long. and our 26 letters of the alphabet can make an infinite number of words.
i disable sigs
Comment removed based on user account deletion
I alwalys wondered if we could plug the human genome into a genetic algorithm in the feeble attempt to "roll up" the perfect human, not from the Hollywood type Dr.Frankenstein crap, but from a purely software standpoint.
:(
Well, not really. But no comments about Genetic Algorithms makes baby geek cry
I already knew white mice and dolphins were more advanced than us lowly human beings, but now we've been surpassed by a mustard plant!!??? Douglas Adams would've laughed his head off...
Essentially what they're saying is, mouse genomes contain large (millions of bases long) intervals which don't appear to do anything, and that there are no noticeable effects on the mouse if these sections of their genomes are removed. Which begs the BIG question, "What are those sections of the genome actually doing there?"
It is possible that they really do nothing , but such an "explanation" would be even more disturbing than finding that they do something which we don't understand yet.
Someone mentioned Greg Bear's "Darwin's Children" series of books, and I agree that Bear is a good writer. But his explanation of these oddities of genetics is equally unsatisfying too. Nice books though - and Bear does keep his finger on the pulse of the science.
Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
!00% all safe super growth formu1a.
Garanted! MONEY BACK !
To Unsubcrib click her
jimeejzwgogzgqbjtywwenhbkklwnpkeeleyj
But we also don't know how many enhancers/repressors that don't have readily apparent effects were removed as well.
Enhancers/repressors can affect gene transcription even from a distance. Sure, you've got promoters, TATA boxes, UAS's and the like which strongly affect transcription, but the long-distance promoters have a significant effect on it as well.
I think further phenotypic analysis of the mice would be in order before completely denouncing everything they deleted as "junk". Obviously a lot of it is due to selection pressures and evasion of mutation, but some of it might not be.
The Sci Am article points to human and other eukariotes having protein-coding DNA stored adjacent to intron DNA (non protein coding).
Looks like the bodies operating system is a harvard architecture where data (protein-coding DNA) and intructions (intron) are stored in a single word that is acted upon by by the spliceosome, allowing for far more complex combination than the direct coding of DNA=RNA=Protein.
"The estimate for the number of genomes in human genetic code has been savagely revised downwards. The new estimate, of between 20,000 to 25,000 genomes..."
Only 20,000 to 25,000 genomes? I was sure that the number of genomes in human genetic code was closer to 6,500,000,000.
Sincerely,
Pan Tarhei Hosé, PhD.
"Homo sum et cogito ergo odi profanum vulgus et libido."
How is that we know a plany has 27,000 genes and don't know how many a human has if now we know a human has less than a plant? I thought the whole reason why we didn't know how many genes a human had was because thought they had significantly more than anything else we've looked at.
Finishing the euchromatic sequence of the human genome
INTERNATIONAL HUMAN GENOME SEQUENCING CONSORTIUM
Link to summary
link to pdf
.
If genes are cseg then junk is dseg. Right?
-- John Von Neumann (dead, but interested in biology now that it's an information science)
Honey, which compression should I use to shrink this one, Rar, ace or 7z?
Being geek is fun when even humans look like source codes when digitalized. Maybe we should code "womb emulator" and using it, fork human gene making vacuum resistant, amphibious and tiny versions... uhh, then stable and unstable releases and nightly builds.
Gulp, it just occurred to me that I might be a nightly build...
Preserve old classics: copy your collection onto all hard drives.
President Bush announced that extreme efforts are underway to find these missing genes. These scientists are incapable of dealing with the task at hand and as such, drastic measure need to be taken.
"Tread softly because you tread on my dreams"
This talk about the 'Holy Grail' always makes me think of Monthy Python. Not just the fun side of it - the point of the film was that it is utterly futile to go chasing after 'The One Secret', and this article illustrates the same fact in biology.
What this boils down to, really, is that life is not just one thing that seperates living organisms from dead matter, but rather the totality of processes and objects that work together to form the biosphere.
I know, this sounds rather like it came from some book by Rudolph Steiner or the like, but I hope it is a little bit better founded. One of the consequences of the above rather vague definition is that there is no clear difference between 'life' and 'non-life'; instead life is a phenomenon that permeates all of the physical world, and perhaps it would make sense to consider the universe as a whole to be 'living'. Organisms are just something that happens at a certain level of complexity.
When you start thinking this way a lot of interesting possibilities present themselves, like eg. could living organisms have developed during the first, very hot phase of our universe's existence - ie. organisms based on 'quark-chemistry'? Etc etc. Processes very similar to evolution can happen in any system, where objects can combine to form more complex objects.
Tell your whale-eating friends this when you find out. Might be only way to convince whale-eating (or porpoise-eating) countries that species who eat similar species with much bigger brains are not considered particularly intelligent or worthy of sympathy by advanced civilizations. Compared using brute force methods, we are outranked by flowers. So subtlety and sensitivity are key.
Wouldn't this have been clear the day they mapped the entire genome...?
Compare to
the number of instructions isn't as crucial as how they are used
I think there are many similarities with machine code, and this in fact shows that it IS possible to spend thousands of years optimizing a piece of code.
I wonder what kind of debugger God uses? And if he ever reverse engineered someone elses code.
A while back, I recall seeing something that stated that the attempts to trace human ancestry reached a dead end at approximately 20,000 years ago, and a population at the barest thousands.
The suggested explanation is that there was a massive die off, supposedly due to a cataclysm caused either by an asteroid impact or volcanic eruption.
Is it then possible that the severely reduced genomes were due to such a massive die off? Plant seeds can survive years despite massive cataclysms, assuring almost unrestricted genetic exchanges between plant species. However, animal genetics are restricted by breeding cycles, how long they can stay alive to breed.
In essense, it may just simply be that animal DNA is considerably streamlined in order to compensate for that fact, kind of like a high speed dub for the species, as opposed to slow dub redundancies for accuracy's sake.
In other words, the only supremacy that plants hold over mammals, is time. Take a vial of sperm and a bag of fresh seeds, and keep them in a box for a year. Guess which one will still be viable.
Just because you can mod me down, doesn't mean you're right. Shoes for industry!
Or, at least, the more hard-coding there is, the more genes it takes.
As animals, humans aren't known for having the most advanced bodies; it is our brains that we are so proud of. Big brains must require a swack of genes (although big as in "more of the same" (maybe?) doesn't). But maybe brains that can train themselves to do things is easier to code for than hard-coding every aspect of life.
"When the going gets weird, the weird turn pro" -- HST
An ORF is something that could potentially be a protein-coding gene--it has an in-frame start and termination codon. Most of the non-coding RNAs I am aware of are *not* in ORFs. You probably meant to say transcripts rather than ORF.
e no mes.section.6613
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=g
IAAGR (I am a genomic researcher)
from http://www.ucmp.berkeley.edu/archaea/archaea.html
.
Introduction to the Archaea
Life's extremists. .
The Domain Archaea wasn't recognized as a major domain of life until quite recently. Until the 20th century, most biologists considered all living things to be classifiable as either a plant or an animal. But in the 1950s and 1960s, most biologists came to the realization that this system failed to accomodate the fungi, protists, and bacteria. By the 1970s, a system of Five Kingdoms had come to be accepted as the model by which all living things could be classified. At a more fundamental level, a distinction was made between the prokaryotic bacteria and the four eukaryotic kingdoms (plants, animals, fungi, & protists). The distinction recognizes the common traits that eukaryotic organisms share, such as nuclei, cytoskeletons, and internal membranes.
The scientific community was understandably shocked in the late 1970s by the discovery of an entirely new group of organisms -- the Archaea. Dr. Carl Woese and his colleagues at the University of Illinois were studying relationships among the prokaryotes using DNA sequences, and found that there were two distinctly different groups. Those "bacteria" that lived at high temperatures or produced methane clustered together as a group well away from the usual bacteria and the eukaryotes. Because of this vast difference in genetic makeup, Woese proposed that life be divided into three domains: Eukaryota, Eubacteria, and Archaebacteria. He later decided that the term Archaebacteria was a misnomer, and shortened it to Archaea. The three domains are shown in the illustration above at right, which illustrates also that each group is very different from the others.
Further work has revealed additional surprises, which you can read about on the other pages of this exhibit. It is true that most archaeans don't look that different from bacteria under the microscope, and that the extreme conditions under which many species live has made them difficult to culture, so their unique place among living organisms long went unrecognized. However, biochemically and genetically, they are as different from bacteria as you are. Although many books and articles still refer to them as "Archaebacteria", that term has been abandoned because they aren't bacteria -- they're Archaea.
Why do we know home many genes the mustard arepithingy plant has, but we havent figured out home many we have?
or else!
C'mon, it's trivial. Those are the comments in the code.
"sweet dreams are made of this..."
*ahem* "Fewer", not "less". We apologise for the interruption: normal service will now resume.
Whaddya mean? Gimme my genes back!
Floridas supreme court has ruled against recounting the human genes and has declared Bush the winner.
SIG: TAKE OFF EVERY 'CAPTAIN'!!
20,00 to 25,000 genes? Wouldn't this mean that you could fit your entire DNA sequence in a single computer file? How big would it be? Does anybody know if there are entire human genomes available for download on the net?
That's all I've got on this one.
George Lucas would like to have a word with you.
He'd like you to map out the "force" that ties all mitochondria together so he can start his next monkey-making phase:
Nerd Religion
This is amazing. All this time, spent waiting in line. How do you explain this to your imaginary girlfriend?
We don't really know jack about it.
scientific proof we aren't that smart as we believed. (all your genes belong to us.)
This is just as irrelevant as the number of files in an application. It's lines of code (nucleotid pairs) that is important, not how many groups of them (genes) are there. And of course, there is a lot of DNA code that is reused (same genes or parts of them are used to encode different proteins).
Future Wiki -- If you don't think about the future, you cannot have one.
I find it mind boggling at times to think that we are using computers created by natures computer (the human brain) to analyze natures software (dna) and that the research may feedback into our own external software designs.
One example I'm thinking of while reading this is that genes obviously work together to accomplish tasks, and they must have worked out what the best level of coupling is. Think of genes as functions and what number of other genes (functions) it is optimal to link to.
Too few and the code is inefficient too many and if one gene/function fails it causes widespread failure i.e. cancer/system crash. It will be interesting to see what natures answers to these and other problems are and if they perhaps lead us to mathmatically definable rules for our own software designs.
Why are we not directing our massive GNP towards scientific exploration such as studying genetic therapies to cure the rift raft of ailiments that curse mankind instead of fighting petty wars against a minor enemy "aka terrorist".
I'm not sure that the resultant caliphate ruling the US would share your research priorities either ...
Nuclear genome?! I read about that in The Sun! it causes radiation sickness and Spontaneous Human Nuclear Detonation! We're all doomed!!
USE HOT GRITS WITH STATUE OF NATALIE PORTMAN (NAKED AND PETRIFIED)
Why are we not directing our massive GNP towards scientific exploration such as studying genetic therapies to cure the rift raft of ailiments that curse mankind instead of fighting petty wars against a minor enemy "aka terrorist".
I partially agree with you, but there are a couple of things to keep in mind:
1. There is a very real possibility of bio or nuclear terrorism, which would make 9/11 look like a minor accident. Take you pick of "nuke-Manhattan", smallpox or "San Fransisco Dirty Bomb" scenarios - all of these are (1) realistically achievable (technically and logistically) for a resourceful group of people and (2) the ultimate scoop for a number of groups. These kind of threats must be estimated beforehand and with incomplete information - we cannot wait for statistical evidence before engaging in prevention.
2. Comparing "number of deaths" is a crude and imprecise analysis. A better approach typically used is the concept of "disability-adjusted life-years". This takes into account the number of extra years lived by people saved (adjusted for lower quality of life due to disabilities, as the name suggests). From this perspective you would have to factor into the analysis that the average person killed at WTC probably had life expectancies many times higher than would the average patient saved by e.g. a cure for prostate cancer.
3. Life-years aren't even the only aspect of national well-being. Sense of security is an important aspect of quality of life, and thus there is a broader benefit to the nation feeling protected from terrorism. (On the other hand, the scare-mongering by the presidential candidates has the exact opposite effect).
4. The economic damage from terrorism is even much higher than a "life-years" analysis would suggest. This in turn has a feedback effect on the economic capacity for the country to undertake important tasks, such as, err..., cancer research (or weapons systems - take your pick).
That having been said, I agree that "big headline risks" get too much focus and priority in politics, media an popular opinion. Here is a very good Economist article on this issue.
Let's look at this the simple way:
Terrorists act because they need attention. Just like children do when they are unhappy, see ? A terrorist will creep out, explode him/herself and by doing so, creates a great amount of attention to his person. Ofcourse he can't enjoy it anymore, so the attention is kinda superfluous.
Politicians hate when anything gets more attention than they do.
That's why they went into politics: power and attention. So they need to do everything to regain that attention lost by terrorism, even through war.
People with diseases have awfully little power to attract any attention. They are simply not interested, but care more about themselves surviving their illness. Even though there exist patient-organisations, they are (apart from the casual donation question to the public) mostly on their own. Politicians don't give a ****, unless they come in the media because of such an organisation. Diseases gather no attention as huge as terrorism, so they need no solution, as far as politics is concerned. Luckily there are those organisations that do care.
More evidence that good programs are short programs.
We really don't know how many genes there are, if we should be happy and proud that we have a lot or a little, what they do, how they work or how we can make all of this work for the far far right wing's psychochristian agenda.
What is more important are things like splice-variants (an active gene is copied to a mRNA which is chopped in pieces and then reassembled in different ways), post-transcriptional modifications, post-translational modifications, etc.
Maybe, the fact that Arabidopsis appears to have more genes than humans reflects the fact that experimentation on, Arabidopsis is unrestricted since it is a plant, so that we know more about Arabidopsis than we do about people.
This is not to say that there is no such thing as 'Junk DNA', but probably not all 'Junk DNA' is free of genes.
( It is also highly plausable that much of 'Junk DNA' consists of a library of code segments that are more liable to be part of 'helpful' mutations than random bits. While useless to the carrier, they help speed the rate of adaption in offspring. Imagine writing code by pasting together random code segments. It would make useful code generation more likely if the segments were whole subroutines, or at least code blocks. It may even be that DNA is set up to be more likely to cross over during sex at places where a cut and paste operation would result in a 'syntactically correct' DNA sequence. )
--
Quotable quote: "If at first you don't succeed, keep on sucking till you do succeed." ( read it aloud. )
...or is tha name for a gene locus within a genome still called an allele?
So we have a smaller allele count, now?
What about the plasmid genome? Just because it has cardinality zero in humans doesn't mean it should be ignored.
"This quote is a product of the Frobozz Magic Quote Company."
how many tests? "well, it looks like a mouse, can produce heirs, ages the same as a normal mouse and doesn't grow and funny lumps so let's say the code we knocked out is junk" Terrific. I bet the same logic will be used to fast track teleports as well "Yeah, it's not possible to store or transmit the entire state of all your atoms, but nearly all of it is junk so we make that up at the receiver. Cash in advance, please"
They whose government reduces their essential liberties for temporary security, receive neither liberty nor security.
Gene count is a funny thing. Frogs, for example, have a lot of genes to guide their development from egg to tadpole to account for variations in water temperature and chemistry. Mammals gestate in a much more controlled environment (controlled temperature and chemistry), and hence do not need this huge complex of genes.
It's not wasting time, I'm educating myself.
That's cool. So either evolution or God produces tight code.
To bad that with all the line saving tricks it got to be so hard to read.
If only I could convince the technical lead on my project that the same is true for lines of code in software...
A republic cannot succeed till it contains a certain body of men imbued with the principles of justice and honour.
Earlier estimates had placed the number of genomes at around 44,000 - or even as high as 100,000.
Genome = the full complement of genetic material of one species
Gene = one particular string of information in the genome that performs a particular function (including coding proteins, but not limited to that)
So the number of genomes equals the number of species, and the number of human genomes is one! No surprises there.
Is this a simple problem of copy-editing, or a lack of comprehension of biological concepts ?
It looks like a penis, only smaller...
How can they have sequenced the entire human genome if they STILL don't actually know HOW MANY genomes there are (It's still indicated as an estimate)?
While the number of genes in the human genome may be less than that of the mustard plant, the real complexity in the human genome is the number of folded proteins that determine traits. The real work on the human genome and inherited traits has only just begun. It is not unlike comparing a NA map of freeways with street-by-street map of LA County that includes embedded directions to each house.
I think further phenotypic analysis of the mice would be in order before completely denouncing everything they deleted as "junk". Obviously a lot of it is due to selection pressures and evasion of mutation, but some of it might not be.
... genetic butchery (in the sense of the quote to the effect that "a surgeon achieves by butchery what a civilzed man would achieve by persuasion") which won't show up for n generations, and no doubt the obvious experiment is on progress. BUT to the first generation, the effects are so minor as to be not obvious.
... immediately apparent.
That's much of the point. While there are no doubt effects of this
Consider what would happen to a program which you randomly excised a block of a million characters from the tarball. Maybe you'd take out a chunk of the documentation, which wouldn't really stop it working; maybe you'd hit the module for conversion between Roman denarii and Micronesian grindstones, which would only show up in quite uncommon circumstances. But in any program where reproduction had a signficant cost (viz, one with reasonably tight code), a million character excision from the tarball would be
Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
The gene sequence that you have posted is protected intellectual property of the Monsanto corporation. Your post infringes upon our god-given right to excusively exploit this gene sequence. Lower your shields and prepare to be boarded.
The "cue the foo posts in 3, 2, 1..." posts will commence with no subsequent foo posts in 3, 2, 1...
A low gene count certainly helps explain the current crop of presidential candidates.
Like the guy teaching my Freshman Biology course? Sweet.
Have a look at Bruce Schneier's "Beyond Fear" book. He makes the parent poster's point with lots of facts and figures.
Terrorists never succeed. The WTC attack was far and away the exception to terrorist attacks in it's number of casualties. The goal of terrorism is to amplify the publicity of a small attack.
Publicity is where it's at if you want to be seen as changing the world.
Still, a very few people have changed the world by inventing vaccines and discovering basic science. But ask someone who invented each of the vaccines that they've taken, you'll find that these world-changing inventors didn't get nearly as much publicity as terrorists.
So, there's your choice: change the world vs: just get the world's attention.
So how do we know they didn't screw up the gene count of the plant as well? Any chance these scientists are from florida?
The mouse genome was decoded the reverse way from the human. They inventoried proteins first, then constructed the DNA source. There are abotu 60,000 of these compared with 25-30,000 "genes". So coding regions in mammals may express on average 2-3 proteins.
Extend your analisis:
1- We (advanced civilization) have build those weapons, the only logical way is to promote and actively do global disactivation/destruction of this kind of weapons.
2- Number of deaths-year vs disability-adjusted-life-years: Add the number of people severely injuried to the formula, and you'll wee how much worse are other death causes (ie car crashes).
3- Live years are not the only way to measure the well-being, true. Again add to the formula the number of people injuried to have a more realistic estimation.
$- Economic impact: The impact is only due to the politic/periodistic pressure, with a convenient (more realistic) treatment the impact would be much lower.
That being said, only addressing the base conditions that facilates terrorism (mainly oppression/injustice) with appropiate development and aid planning the world will suceed to erradicate that XXI century plague. We can do-i.
What's in a sig?
This is definitely a mis-perception, usually based on the fact that most evolutionary descriptions only describe those things that lead up to humans. Plants are, in many cases, more highly evolved than animals are. Even than humans are. They just haven't specialized for intelligence.
It is a mistake to think that supremacy in one area (intelligence) means supremacy in all areas. Some people pride themselves on being efficient workers, others pride themselves on being paid well to do very little. In the biological world, plants would be the "blue pill" type of creature, the type B personalities, and they're REALLY REALLY good at it.
When I was working at Monsanto, I was told that wheat has a genetic strand about three times as long as the human genetic strand. This may or may not have relevance to the rest of the post, but I thought I'd toss it in just because it's interesting.
As another point, the length of the strand doesn't necessarily indicate a more evolved state. It can be assumed that some strands are more efficient than others, and thus don't NEED to be as long. Take Microsoft code, for instance. Just because they take more code to do the job doesn't mean it's a superior product.
Wake up - the future is arriving faster than you think.
1: Natural selection (reduction in the gene pool) is an important process in evolution
2: Mutation occurs naturally, but there are some signs of 'directed mutation' in single cell life. Kinda like Newton's law of gravity, there's more going on behind the scenes.
2a: Useful genes do tend to be passed on
2b: Yes, they're rare, but that's why major evolution is typically slow. Fast evolution tends to be paired with savage selection & enviromental stress.
3: Evolution doesn't describe a start to life. There are various theories that incorporate the theory of evolution into them, but they're all just theories. Mostly they take dinsaurs and fossil records to say that if an outside power interveined, it probably wasn't a *BLAM* and life forms more or less as we know them (including humans) are around.
I don't read AC A human right
The answer to why we don't have a glut of 'pretty people' is that the standards tighten or change, and an 'ugly' person is often able to compensate in other areas.
Think of 'pretty' as certain physical features falling with a range. As the population fits within that range more, the range shrinks or shifts.
I don't read AC A human right
There is a lot of excitement surrounding the human genome, and some naive oversimplifications. Furthermore there are a lot of exaggerations and wild tangents when the media talks about the ramifications of some new genetic discovery.
I recommend reading It Ain't Necessarily So : The Dream of the Human Genome and Other Illusions by Richard Lewontin.
He puts all of it in perspective.
Vivin Suresh Paliath
http://vivin.net
I like
The problem with ID is neither who believes in it or how probable it is, but whether it is a legitimate scientific theory.
In order to be a scientific theory, I have to be able to disprove it (at least theoretically) - there has to be a question whose answer differs between ID and evolution derivs. and whose answer could potentially be observed. ID seems to argue that low probabilities of events or sequences of events in evolution imply an external "designer", but depending on the length of a sequence of events (a series of lottery winners, for example, over a short period of time), arbitrarily improbable events happen, and on a regular basis. If probability doesn't distinguish a sequence of events mediated by a designer from one which is not (or if improbability axiomatically defines the presence of a designer), then ID is indistinguishable from evolution. When I asked if ID was disprovable to a person advocating ID at OSU, he replied that if a sequence of events could be found that were "probable enough" in the absence of a designer, it would disprove ID - what is "probable enough" is arbitrary, however, or useless in distinguishing the two theories.
Science deals with measureable quantities. In ID and evolution both, specific events had to have happened to get us to this point - whatever that sequence of events, either theory would have to account for them. Outside of observable variables, how does one distinguish ID from evolution? If a designer made the universe, then he had to manipulate physical reality, generating a sequence of events. Potentially, both evolution and ID would have to account for this sequence of events (a designer would be using observable forces, etc. and either theory would have to account for them to be complete), so what is left to distinguish them?
ID fails as a scientific theory because it doesn't have a way to distinguish a designed universe from an evolved universe. It's falsifiable, and so doesn't work. On a larger scale, this neither proves of disproves the existence of GodXXXa designer - it merely says that science doesn't have a useful answer to the question.
What! A slashdotted Genome?
I knew Bush had to slash the budget somewhere, but did he really have to take it out on my DNA? I want my other 20,000 genes back!
Options:
1) Nothing
2) Evolutionary junk which might at some point prove usefull aka gills and such.
3) They respond to something that did not effect these mice. AKA some disease.
4) They prefome some function that was not detectable aka sent reseptors.
5) They do somehting else.
ID fails as a scientific theory because it doesn't have a way to distinguish a designed universe from an evolved universe. It's falsifiable, and so doesn't work.
You surely meant, it's unfalsifiable, right? But in any case, I hope you do realize that falsifiability is only a property of statements and theories, and is itself neutral. As a demarcation criterion, it seeks to take this property and make it a base for affirming the supposed superiority of falsifiable theories over non-falsifiable ones as a part of science, in effect setting up a political position that might be called falsificationism. However, much that would be considered meaningful and useful is not falsifiable. Certainly non-falsifiable statements have a role in scientific theories themselves. It provides a definition of science that excludes much that is of value; it does not provide a way to distinguish meaningful statements from meaningless ones. Although falsifiability does provide a way to replace invalid inductive thinking with deductive, falsifiable reasoning, I believe that doing so is neither necessary for, nor conducive to, scientific progress, and thus quite meaningless.
sorry, I was wrong - falsifiable means able to be disproven (I thought it was the opposite - the meaning I was using (incorrectly) was that another theory can replace the theory under discussion but give the same observable output).
With the rest of your response - I'm not trying to be annoying but can you please give examples of non-falsifiable statements in science? I have operated under nonfalsifiability as an axiomatic property of science, which made sense to me (it doesn't make sense to ask a question if I can't get meaningful answers, or more properly, if I can't distinguish yes from no). It would be good to know when this is incorrect.
I'm out of my depth in the second part of your response (the inability to distinguish meaningful statements from meaningless ones) - I don't know if this is related to Chomsky's statement of grammar and meaning (grammar can't distinguish meaningful from meaningless statements either). In the case of grammar (if I'm even in the stadium here) grammar doesn't exist to determine meaning, but to provide a framework in which to communicate meaning. People make lots of ungrammatical statements; their grammatical incorrectness doesn't imply that the statements aren't meaningful, and the ability of people to make grammatically correct statements does not imply that those statements are meaningful. I didn't believe that science's role was to determine meaning, but only to determine order - unless order defines the meaning as a consequence, which isn't assured, science doesn't operate on meaning.
I wrote the last part of the response to argue that if ID is not science does not imply that it is meaningless. "Why Religions Exist" (I can't remember the author but he's a sort of liberal, comparative religion person) talks about religion as a superset of knowledge - science can operate on some of the knowledge that religion lays claim to but not all of it, and so there is some knowledge in religion that is not contained in science. If this is an accurate picture of knowledge, ID could be an element in that set. ID as an element not is science != ID being meaningless.
I don't see the utility of ID as a scientific theory. The method of science I'm used to is: ask a question, generate potential answers, define how I can tell those answers apart, go and find out information, see which (if any) of my potential answers fits observation, go back to step 2 if nothing is correct, go back to step 3 if one or more answers is correct, and if all the available data is consistent, publish or otherwise disclose the theory. If I can't tell ID apart from any competing theories, I can't ask any questions in science that hold any meaning within science. While the difference between ID and evolution may be large in terms of spirit (although what if a Creator used evolution to build a world - although Dawkins may have answered this), and thus meaningful to my behavior and thoughts, for science it doesn't seem to have any meaning. ID is a black box, and it seems to be a black box as part of its nature rather than because we don't have a variable or measuring device to describe it.
It's interesting reading the comments on this thread
H olmeso lmes.ht ml
(am gutted I only just saw it). Bio- and compbio-savvy readers have posted comments on noncoding RNAs (e.g. microRNAs), the complexity of genetic regulatory networks and "junk"/repetitive DNA; all factors that ameliorate the "low" gene count. Slashdotters may be interested in some of the parallels between these ideas and computation.
Biological cells are more like analogue computers than digital ones. Analogue computers are old-skool, and have some interesting features compared to digital ones. For example, their temperature response tends to be a lot smoother (they don't just burp magic smoke and die when they get too hot, unlike digital computers).
Genetic regulatory networks (the mechanisms controlling "gene expression", the way genes are turned on and off) are mainly analogue in nature, although they have one obvious digital component: the sequence. Promoter sequences (the upstream regions of genes which specify gene expression) tend to contain lots of short motifs that turn the downstream gene on or off under particular circumstances. The same goes for post-transcriptional regulatory motifs buried inside the genes themselves, which control the way the RNA is processed on the way to ribosomes (the ancient, universal RNA-protein hybrid complexes that translate RNA gene-tapes into protein nanomachines). Incidentally, one part of this preprocessing (called "splicing") can also generate many alternate variants of a single gene. For example, drugs like aspirin, ibuprofen (Advil) and paracetamol (tylenol) were recently found to all affect different splice-forms of one gene. The additional complexity generated by alternative splicing alone is incredible.
So analogies to ASM and C aren't really correct, because a better model for genetic regulation would be something like Mathematica or a functional programming language - something that could model an analogue computer. As for the protein sequences that the genes encode, they're more like structural blueprints for nanorobots, so purely computational analogies don't really apply there either.
I could waffle on and on about computational analogies, but briefly: noncoding RNA structure is modeled quite well by context-free grammars (lots of interesting parallels with compiler theory) whereas junk DNA often seems to be self-replicating and viral (although it is very tempting to speculate that it has some kind of benign, or at least symbiotic, relationship with the host genome; a well-known example would be the RAG gene, a key gene in the immune system that seems to be descended from an ancient transposon [i.e. junk DNA element] that appears to have set up shop as a symbiotic protection racket against other invaders....)
To summarize, as others have correctly pointed out, gene count ain't really a good way to measure complexity, and it's pretty vain of us to assume we should have a high count anyway. The more relevant issues to explore are the similarities and differences between us and our neighbors, both near (dog,mouse,rat) and distant (chicken,fish,fruitfly,nematode). Checking out which genes are expressed in the brain will be an especially hot area (neuroinformatics). Other currently hot buzzwords are synthetic biology, systems biology, multiscale biology la la la etc.
anyway, that's enuf for now, here's a plug for my compbio sites
http://dart.sf.net/
http://c2.com/cgi/wiki?Ian
http://computationalbiology.berkeley.edu/h
sorry, I was wrong - falsifiable means able to be disproven (I thought it was the opposite - the meaning I was using (incorrectly) was that another theory can replace the theory under discussion but give the same observable output).
You were probably thinking about the unfortunate non-philosophical "falsification" meaning "counterfeiting" instead of the correct meaning how a theory or assertion is "falsifiable" or "disprovable" so please let me explain, because it doesn't make much sense to discuss anything when we are talking about something completely different ignoring the most important definitions. You've hit the main area of my interest and my PhD thesis, so I'll explain it as thoroughly as I can.
First of all, falsifiability is an important concept in the philosophy of science. For an assertion to be falsifiable, in principle it must be possible to make an observation or do a physical experiment that would show the assertion to be false. For example, the assertion "all slashdotters are morons" could be falsified by observing one intelligent slashdotter (not an easy task, mind you). The school of thought that emphasizes the importance of falsifiability as a philosophical principle is known as falsificationism.
Note that two types of statements are of particular value to our discussion. The first are statements of observations, such as "this is a pretty boy". We logicians call these statements singular existential statements, since they assert the existence of some particular thing. They can be parsed in the form: "there is an x which is a boy and is pretty".
The second type of statement of interest to scientists categorizes all instances of something, for example "all boys are pretty". We call these statements universal. They are usually parsed in the form "for all x, if x is a boy then x is pretty". Theories are commonly supposed to be of this form, but right now you must be thinking: how does one move from observations to theories? How can one validly infer a universal statement from any number of existential statements? Now, those are very good questions. Indeed, perhaps the most difficult questions in the methodology of science.
Inductivist methodology supposed that one can somehow move from a series of singular existential statements to a universal statement. That is, that one can move from "this is a pretty boy", "that is a pretty boy", "here is yet another pretty boy" and so on, to a universal statement such as "all boys are pretty". This method is clearly logically invalid, since it is always possible that there may be an ugly boy that has somehow avoided observation. Yet some philosophers of science claim that science is based on such an inductive method. Can you believe it?
Needless to say, science could not be grounded on such an obviously invalid inference. Falsification is a solution to the problem of induction. Although a singular existential statement such as "there is a pretty boy" cannot be used to affirm a universal statement, it can be used to show that one is false: the singular existential observation of an ugly boy serves to show that the universal statement "all boys are pretty" is false. In logic this is modus tollens. "There is an ugly boy" implies "there is a non-pretty boy" which in turn implies "there is something which is a boy and which is not pretty". This is obvious so far.
Although this logic is perfectly valid, you should already see that it is rather limited. Nearly any statement can be made to fit with the data, so long as one makes the requisite "compensatory adjustments". In order to logically falsify a universal, one must find a true falsifying singular statement. But it is always possible to change the universal statement or the existential statement so that falsification does not occur. On hearing that an ugly boy has been observed in Utah, one might introduce ad hoc hypothesis, "all boys are pretty except those born in Utah" or one might adopt another, more skeptical about some observers, "Utah boy lovers are
Those might have been different studies, but the point is that in the United States, creationism remains popular among non-scientists. According to several evolution polls over the last decade, 60-65% of Americans believe that "God created man pretty much in his present form at one time within the last 10,000 years." About 10% believe that the evolution of species occurred without any divine intervention. The latter figure is higher among the upper class, Internet users and among college graduates, higher still among scientists (about 55% believe that evolution occurred without God over millions of years according to a 1997 Gallup poll), and higher still among biologists and geologists. These data have remained relatively stable over time.
In 1987, Newsweek reported: "By one count there are some 700 scientists with respectable academic credentials (out of a total of 480,000 U.S. earth and life scientists) who give credence to creation science, the general theory that complex life forms did not evolve but appeared 'abruptly.'" A 2000 poll by People for the American Way examined the question of popular support for evolution and creationism in schools, and showed that a majority of 83% supported the teaching of the theory of evolution.
The United States fundamentalist Christian community has no real parallels (in terms of numbers, prominence, and political influence) elsewhere in the Western world (aside from possibly Canada), and because most vocal creationists are from the United States, it is generally assumed that creationist views are not as common elsewhere. Statistics are not clear on the issue.
According to a PBS documentary on evolution, Australian creationists claimed that "five percent of the Australian population now believe that Earth is thousands, rather than billions, of years old." The documentary further states that "Australia is a particular stronghold of the creationist movement." Taking these claims at face value, "young-earth" creationism is very much a minority position in Western countries other than the USA.
In Europe, creationism is a less well defined phenomenon, and regular polls are not available; however, the option of teaching creationism in school has never been seriously considered in any Western European country. In Roman Catholic-majority countries, papal acceptance of evolution as worthy of study has essentially ended debate on the matter for many people. Nevertheless, creationist groups such as the German Studiengemeinschaft Wort und Wissen are actively lobbying there as well. In the United Kingdom the Emmanuel Schools Foundation (previously the Vardy Foundation), which owns two colleges in the north of England and plans to open several more, teaches that creationism and evolution are equally valid "faith positions."
Of particular note for Eastern Europe, Serbia suspended the teaching of evolution for 2004, under education minister Ljiljana Colic, only allowing schools to reintroduce evolution into the curriculum if they also taught creationism. "After a deluge of protest from scientists, teachers and opposition parties," says the BBC report, Ms. Colic's deputy made the statement, "I have come here to confirm Charles Darwin is still alive," and announced that the decision was reversed. Ms. Colic resigned after the government said that she had caused "problems that had started to reflect on the work of the entire government."
(Fragments taken from Wikipedia licensed under GFDL)
It is one that appears to be at odds with what most of the researchers I work with use. An internal coding exon is not an ORF. The whole coding sequence would be a single ORF that excludes the intervening introns.
If I read your above definition correctly, you would call every stretch of DNA that does not include a stop codon an ORF, even without requiring an initiation codon. This would mean the entire genome would be in an ORF! Even nucleotide triplets that match a termination codon would be in an ORF since they cannot be terminated in every frame. This definition is clearly not very useful.
I definitely don't mean transcripts since I was referring to DNA regions that possibly code for ntRNAs.
Huh? All of the ncRNAs[1] transcribed from the human genome are transcripts. Only some of them are ORFs. ORF is a bad term to use when referring to ncRNAs.
[1] "ntRNA" is also a new term for me that does not appear in PubMed. In some ways it seems like a more attractive term than ncRNA, but in others it does not...
I love how a creationist responds and he gets modded a troll. Yet when evolutionists blather crap all over defending themselves against posts from creationists that hadn't even been posted yet.... they get modded insightful.
"Evolutionists"? You mean scientists. If you must call me evolutionist than don't forget to also call me gravitationist, electromagnetist, general relativity theoretician and a fucking quantum mechanic!
The point is that only people who reject the scientific theory of evolution for religious reasons use the term 'evolutionist' to somehow imply that it is an equally unfounded and arbitrary position as those of creationists.
But there is no such thing as 'evolutionism movement', there is no movement, no faith, no emotions behind evolution! It's just an ordinary fucking theory like gravitation, electromagnetism or any other one.
Creationism on the other hand (or 'intelligent design' or whatever you call Christian fundamentalism nowadays) is not even a hypothesis because it is not falsifiable in the first place!
Did you find some evidence that contradicts the generally accepted theory of evolution which is incidentally better explained by the Bible? Can you make better predictions with your theory? Have you used the scietific method? If not, then just shut the fuck up!
So we've got ~20K genes. Indeed, there are complex genetic situations - e.g., traits affected by multiple genes, and alternative splicing of the pre-mRNA transcript from a single gene (which, btw, gives rise to ~90K different possibilities of polypeptides, total). So, yes, this would result in more than 20K 'possibilities.'
But, you're forgetting something. 'Gene' simply refers to a locus (physical location) on a chromosome. At each locus, there can be only one allele (alternate version of the gene -- for (an oversimplified) example, the 'eye color' gene can consist of the allele for 'blue eyes' or 'brown eyes').
I'm not sure what you guys are referring to when you say 'possibilities.' If you're considering possible genetic permutations of a human being, the answer is also going to be based on how many different alleles are possible at each locus, and the fact that we have 2 of each of our 23 chromosomes. The 20K is just the beginning...
Sorry about the delay in responding--I usually get my crack^H^H^H^H^HSlashdot through Alterslash so I don't see the new messages notice right away.
;-) but I see your point.
I don't like though since it seems so restrictive if you don't know what the full length mRNA (or some other RNA) looks like.
My argument is that your proposed meaning is not restrictive enough
How do you know a stretch of DNA is NOT transcribed (discounting the obvious like poly-nucleotide repeats, SINES, etc)?
You can't prove a negative. Particularly you cannot prove that a stretch of DNA is never transcribed--even if you have a high degree of confidence that it is not transcribed over a dozen different dimensions.
And I thought an ORF was defined as 1 single reading frame not all three?
That's correct. That's why even the termination codons would still be in an ORF.
"Transcript" = RNA. I was talking about DNA in my original post.
I think the original post would have worked with "transcript" but if you really wanted to specify a region of the genome you could use "gene" or "locus" (yuck, talk about unnecessary jargon).
The phrase "functional RNA" (fRNA) is also used. But this implies that there is actually some function to the RNA which is a lot harder to prove than just lack of translation.
I don't particularly like the use of "coding" either, since it is undescriptive (should really be "protein-coding").