Slashdot Mirror
US Scientists Predict Long Battle Against Ebola
An anonymous reader writes: Despite recent advances in medicine to treat Ebola, epidemiologists are not hopeful that the outbreak in west Africa will be contained any time soon. Revised models for the disease's spread expect the outbreak to last 12 to 18 months longer, likely infecting hundreds of thousands of people. "While previous outbreaks have been largely confined to rural areas, the current epidemic, the largest ever, has reached densely populated, impoverished cities — including Monrovia, the capital of Liberia — gravely complicating efforts to control the spread of the disease. ... What worries public health officials most is that the epidemic has begun to grow exponentially in Liberia. In the most recent week reported, Liberia had nearly 400 new cases, almost double the number reported the week before. Another grave concern, the W.H.O. said, is 'evidence of substantial underreporting of cases and deaths.' The organization reported on Friday that the number of Ebola cases as of Sept. 7 was 4,366, including 2,218 deaths." Scientists are urging greater public health efforts to slow the exponential trajectory of the disease and bring it back under control.
That's about the number of deaths measles cost us every 6 days and we've had a vaccine for that for over 50 years.
I don't want a long battle. I was hoping this was the beginning of a quick end. I wanted to see Ebola (or something) spread across the globe and wipe most of us out. It would have been fantastic.
i'm not worried
For those of you in the US, the PBS show Frontline had part of an episode dedicated to what's going on. While it is very hard to get, cultural problems there make it really easy (mourners touch the dead). People in remote villages are scared to tell doctors that they have symptoms since they'll be whisked off to the clinic, never to be seen again, just like almost everyone else that went to the clinic. In the larger cities, some nitwits are spreading the rumor that Ebola doesn't exist and the government is just trying to steal blood from the patients. So bands of people think that patents bleeding from every orifice needs to be rescued(!).
Your ancestors came out of there around 200,000 years ago, when they climbed off the trees.
It's not a battle. We are going to degrade and ultimately destroy Ebola.
exactly.
You have obviously never been to west africa. People there can and do ignore the governments, which are mostly irrelevant to every day life on a scale American libertines and European anarchists cannot imagine. The whole concept of "they should do X" is laughable. There is no one who can or will do "X". Life is not like that.
Sent from my ASR33 using ASCII
Drink some coffee, google around a bit, and get back to us.
For all intensive purposes, "whom" is no longer a word. That begs the question, "who cares"?
Kodos, is that you?
"Transparent" is a shit show that trades on every stereotype going. A man in drag is NOT a transsexual.
He's not talking about African governments.
He's telling Europe, America and Asia to shut the borders before it spreads.
Also:
I love you Ebola chan.
Did you read the post you replied to. He wasn't suggesting anything that required anybody to comply with government orders. He basically advocated putting a big wall around the infection zones and mowing down anybody who tried to climb over.
Completely sidestepping the huge moral issues, I'm not convinced that could actually be done at a national level. At least, not for countries in Africa - there is just way too much area to try to patrol. You really need geographic barriers if you're going to do something like that for anything bigger than a city (and even a city would require a HUGE force/effort to lock down). If all the infection areas are surrounded by some natural barrier then you could make that your line of defense - people can't easily cross open deserts/etc without vehicles and those could be easily detected and destroyed from the air. Anybody who manages to make it through could probably be spotted for days in advance. Africa itself would be able to be geographically isolated if you cut off all air and shipping to the continent.
I don't see any of this happening, however.
Coffee is shit.
American coffee is shit.
Drink some coffee, google around a bit, and get back to us.
I do like to drink my Columbian coffee, that according to you own link was probably indigenous to and first cultivated in Yemen.
---Saying gnome 3 is better than windows 8 not so much a compliment as it is damning with light praise.
Coffee is shit.
ooo, the Nonsense Game...lets play!
All Ice Cream is disgusting.
Chocolate is hideous.
Vegetables are the devil.
Soda tastes like a rotten corpse.
Water is ebola.
Sunshine is evil.
OK, your turn!
Some people exposed to this disease will survive and develop an immunity.
Shouldn't we be developing vaccines based on human beings who have survived and develop that? The human condition itself is a remarkable platform for self preservation and we have science as a tool. Thinking this is not our problem or that it is a challenge of a particular country seems to be a great way to spead this disease.
Ebola is a human challenge, shouldn't we treat it that way?
My ism, it's full of beliefs.
At least you got the part about not bringing infected people back here correct. It's a mistake to do that. We will eventually have someone in this country who is infected with a mutated virus that spreads more easily than the current strain.
I do like to drink my Columbian coffee, that according to you own link was probably indigenous to and first cultivated in Yemen.
You should try Colombian coffee instead!
They must begin an exit quarantine of 30 days to prevent the spread. Taking someones temp at an airport will only find those already infected and showing symptoms. Ebola, has a 30 day incubation period.
Ebola is the UN Super weapon of choice to kill humans and rid the planet of the Anthropocene Eon.
Columbian coffee? You mean, from the Starbucks across the street from the White House?
Crater the airfields. Mine the harbors.
Snipers sans frontieres, At the borders.
Nothing leaves.
The cure for overpopulation is ebola.
The cure for ebola is napalm.
Civilization is a choice. Make it soon.
The west must crater african airfields and mine its harbors and coasts so that nothing can leave. Isolation is the only thing that used to work (when Ebola was rural), it is still the only solution.
cggacacacaaaaagaaagaagaatttttaggatcttttgtgtgcgaataactatgaggaagattaata
The truth is, that whenever the world has mass die offs due to nature, we do not get wars.
Right now, we have massive numbers of small wars popping up. This has gotten old. In addition, it could lead to a real war with nukes.
But, if the world takes a massive loss of life due to say Ebola going airborne, it would lower the likelihood of a nuke war.
I prefer the "u" in honour as it seems to be missing these days.
ex africa semper aliquid novi
"Always from Africa comes something new." Pliny.
Que haya no navedad
"May no new thing arise." Traditional Spanish benediction.
Those who advocate genocide deserve every protection afforded by law, and none afforded by common human decency.
That's the fun part about so many infections...
The more people with the virus, the more chances for mutations per given unit of time. The more chances for mutations, the higher the chance of a nasty mutation arising.
For large sets, this will be our guide even unto death, for the LORD will work for each type of data it is applied to...
Embargo completely those countries were it is currently at. No one in, no one out.
A couple of weeks ago that would have included the US, the UK and Spain.
Watch this Heartland Institute video
Reading the last publications about the spreading of Ebola, I've got the idea that WHO tries to hide information, in particular about the different types of spreading. So I'm making this up from common sense, maybe somebody with access to privileged information might add details:
Spreading in slums: That seems to be the case in Monrovia ultimately. Inhabitants don't trust the public health system (with certain reason...) and believe in which doctors or conspiracy theories. Once >500 persons are infected, it becomes practically impossible to research the infection tree and to isolate contacts. In the last 3 weeks Ebola spread exponentially. Please tell me if I'm wrong, but I got the impression that Monrovia is probably "lost".
Spreading across the "pepper coast" via land connections: The area from Guinea to Ghana seems to be relatively sparsely populated with exception of a few cities. And these cities are now basically disconnected from international air traffic. Part of the borders are closed. The villagers along the land connections will become increasingly suspicious of travelers from the cities, so I would predict increasingly violent confrontations. Maybe this might lead to slower spreading (apart from disastrous consequences for the economy, obviously).
Spreading to Nigeria: Nigeria has 170M population, as opposed to 4M for Liberia, and Nigeria is well connected internationally. The recent cases seem to have been contained and tertiary and quartiary contacts have been followed-up. So apparently things work out better in Nigeria compared to Liberia.
So my understanding is: A Pandemic will start once Ebola reaches the slums of Nigeria and starts spreading to more cases than the MSF or others can contain (maybe some 200-500 cases). The pandemic will end once a vaccine becomes available in large quantities, which is supposed to happen in 3-9 months.
Correction: CIA predicts long battle against ebola
I read you are here http://slashdot.org/comments.p... and seeing you keep a TomHudson sockpuppet account http://slashdot.org/~tomhudson... and this other of your many sockpuppets on slashdot too http://slashdot.org/~Barbara%2... also makes me believe you may be. Are you?
Hmmm... and why are they not using their own research and solution?
A PDF of Janice Speshock and Saber Hussain's research at the US Air Force National Laboratory.
Before some anonymous coward yells some shill-inspired-drivel about the dangers of silver.... the US Defense Threat Reduction Agency (DTRA is part of the Department of Defense, created in 1999) confirmed the authenticity of this research.
So, will "medical science" aka big pharma and their marketing arm, the FDA, "allow" this potential cure, or will they just let thousands die, because "we have not cure" and won't have for a long time? There are too many african anyway, aren't there? is what they seem to be saying by their actions.