I wish I had some modpoints right now... This is so true, especially if we're talking about something as foggy as terrorism. If you're in a flat out war and you want to know where the army will try to invade, a wrong confession will net you nothing because your failure will be obvious. However if you can claim you've thwarted terrorist plan x that may or may not have existed then it's all fine. Kinda like people thwarted the evil witches' plan to poison the well and hold a black mass back in the good olde days...
Appearantly, so far they only got a license for the remakes. Plus a new game in the quality of, say, lsl7 is a wee bit too expensive for them right now (some 2-3 million if I remember rightly)...
However my personal favorite is Al Lowe's new/remade Leisure Suit Larry, although I'm not quite sure if it'll make its goal... I have quite fond memories for that series.
But anyway, let's just see how many more old gems will get revived and how long it will take until the crappy ones start to creep in...
Great, now I'll have that Timberwolf tune stuck in my head for the next couple of days.
For all who don't know what I'm talking about: http://frededison.free.fr/
or Thomas Timberwolf on youtube...
Belgium (notorious for lighting every square meter of higway, it looks like you're driving in broad daylight) decided to turn of every other light a couple of years ago. After the number of accidents rose some 25% they quickly turned the lights back on!
Sorry, but that's definitely no longer correct.
They shut off most of it last year. Afaik it's still shut off and the reports on the effects ranged between "no noticable effect on the accidents" and "slight decrease". The light increased visibility, but the feeling of safety seemed to lead to more speeding accidents and reckless driving.
But somehow reduction of caffeine seems to severely lower the ability of many people to spot a joke. Even when it's striding towards them in a pink motorbike suit yodeling a novel esperanto interpretation of the national anthem of Kazakhstan.
...so as a German I, naturally, had to support this...
But all jokes aside, as a diehard adventure fan I'm really excited about it, especially the documentary part. Let's see what they do with all the excess money.
In our institute the higher powered readers will read your card from more than 50cm away. Pack the bulky equipment in your backpack, get in the tube during rush-hour and that's it.
The results are often awful but that's because the printers are/have been quite a pain to set up and tweak. However that seems to have improved a lot with newer models. Multiple colors/materials are possible with the new multiple-extruder models, so that might become interesting. We'll soon have a dual struder makerbot replicator here in the lab to print custom parts, so I'm looking forward to seeing what they can do. However I must admit I'm far less interested in artwork, my focus lies on quick cheap solutions for technical problems.
The problem with powder/spray based layers is that printing will take forever since the layers will most likely be only a few microns each.
Anything that involves Drosophila in gerneral and especially Christiane Nüsslein Vollhard is just plain silly....
examples (along with the translation if necessary)
Spätzle (a swabian kind of noodle), wingless, toll (either great or crazy), Gurke (cucumber), tube, Pelle (husk/peel), Krüppel (cripple) etc....
Basically they tried to destroy/deactivate/mutate random genes necessary for the development of the fly, without knowing what they'd hit. Then they looked for larvae or flies that looked weird or behaved funky and named them with whatever they associated with it. Finally they took the animal and tried to find the gene they deactivated. If successful, they'd give that original name to the gene, no matter how stupid the name was and no matter how important the gene is. Hilarity ensued.
or 3. The lawyers, judges, and Congress will realize that the entire government will grind to a halt if that strategy is allowed, so they will reject the strategy, completely failing to realize that this is also a problem in other areas.
They put the laptop 3CM above the sperm and tried to control the temperature from below and via air conditioning. If I got it right while skimming through it, they also measured sperm temp every 5min using an infrared thermometer.
However the control was NOT a laptop with the wifi turned off but a setting with no exposure to electrical equipment at all. Which is not a control for WiFi but a control for a "Laptop with Wifi on". Which leads me to think that the reason they chose this setup was that they couldn't get a useful result when using a laptop without WiFi as a control. The effect could in theory be caused by any part or combination of parts inside the laptop.
There is one thing that is always omitted in these nice tables.
The deaths shown in all but the nuclear incidents are mainly from work-related accidents. Like falling off a roof trying to mount a solar panel. Or getting killed in a coal mine. But that risk is part of the job, you become a roofer, you realize you could potentially fall to death while doing that and accept that risk. Plus it is probably reflected in your hourly wage. In cases like Chernobyl or Fukushima however mostly completely unrelated people who have nothing to do with and nothing to gain from nuclear power got killed or driven from their land.
Well I haven't read the paper either so I don't know how finely tuned you can program it, but the different kinetics of the different types of ion channels, their synaptic density and the way the kinetics can change upon release of various neuromodulators is something that might be a lot more challenging to implement in hardware than in software. Especially regarding the fact that while we know a lot about the neurotransmitters, we know much less about the different channel types. The thorough characterization of TMEM16 e.g. just started sometime around 2008 if I remember rightly and I see no reason why it should be the last "new" channel that's found. And I'd say we know even less about the various roles/actions of neuromodulators.
But I'm still intrigued to read the paper, maybe I'm wrong and it really allows for the customization necessary.
Plus: A "brain synapse" That's like saying this models a "computer chip". Great. Which type? There's a huge load of different types out there, each working a bit different. And imagine their joy if someone finds a new involved protein X which renders this chip's design inaccurate and thereby incomplete. It's a nice toy but nothing more atm...
Slashdot Mirror
I wish I had some modpoints right now...
This is so true, especially if we're talking about something as foggy as terrorism. If you're in a flat out war and you want to know where the army will try to invade, a wrong confession will net you nothing because your failure will be obvious. However if you can claim you've thwarted terrorist plan x that may or may not have existed then it's all fine. Kinda like people thwarted the evil witches' plan to poison the well and hold a black mass back in the good olde days...
Appearantly, so far they only got a license for the remakes. Plus a new game in the quality of, say, lsl7 is a wee bit too expensive for them right now (some 2-3 million if I remember rightly)...
So I doubt this would be possible via kickstarter
+1 here!
However my personal favorite is Al Lowe's new/remade Leisure Suit Larry, although I'm not quite sure if it'll make its goal... I have quite fond memories for that series.
But anyway, let's just see how many more old gems will get revived and how long it will take until the crappy ones start to creep in...
True.... This article was a real WTF moment for me.
still managed to kill children in a school
Just a couple of days after he went out to kill a soldier.
Twice.
Great, now I'll have that Timberwolf tune stuck in my head for the next couple of days.
For all who don't know what I'm talking about:
http://frededison.free.fr/
or Thomas Timberwolf on youtube...
Belgium (notorious for lighting every square meter of higway, it looks like you're driving in broad daylight) decided to turn of every other light a couple of years ago. After the number of accidents rose some 25% they quickly turned the lights back on!
Sorry, but that's definitely no longer correct.
They shut off most of it last year. Afaik it's still shut off and the reports on the effects ranged between "no noticable effect on the accidents" and "slight decrease". The light increased visibility, but the feeling of safety seemed to lead to more speeding accidents and reckless driving.
Awww, Flamebait? Come on, that comment nearly made me fall off my chair laughing...
But somehow reduction of caffeine seems to severely lower the ability of many people to spot a joke. Even when it's striding towards them in a pink motorbike suit yodeling a novel esperanto interpretation of the national anthem of Kazakhstan.
Coming from the swiss, that is just hilarious
Naaaah, they don't have that, that's too dangerous... Much safer to stick to your good old wireless DECT (6.0) homephone...
...so as a German I, naturally, had to support this... But all jokes aside, as a diehard adventure fan I'm really excited about it, especially the documentary part. Let's see what they do with all the excess money.
That one is a Godwin waiting to happen... ;)
UGUAAGAGUGGAAGGACAGAUUAG
AUGUGUAAGAGUGGAAGGACAGAUUAG (ftfy)
----------------
this signature is only added to that post to get around the darn caps thing
In our institute the higher powered readers will read your card from more than 50cm away. Pack the bulky equipment in your backpack, get in the tube during rush-hour and that's it.
The results are often awful but that's because the printers are/have been quite a pain to set up and tweak. However that seems to have improved a lot with newer models. Multiple colors/materials are possible with the new multiple-extruder models, so that might become interesting. We'll soon have a dual struder makerbot replicator here in the lab to print custom parts, so I'm looking forward to seeing what they can do. However I must admit I'm far less interested in artwork, my focus lies on quick cheap solutions for technical problems.
The problem with powder/spray based layers is that printing will take forever since the layers will most likely be only a few microns each.
Not as long as the open printers still exist - and I think they are here to stay.
:)
With the current system it's just large rolls of plastic filament in either 1.75mm or 3mm diameter. And 1kg of ABS filament is around 45$
So then I guess I don't need to be THAT upset that youtube blocked this video in Germany due to licensing issues with the music :/
Anything that involves Drosophila in gerneral and especially Christiane Nüsslein Vollhard is just plain silly....
examples (along with the translation if necessary)
Spätzle (a swabian kind of noodle), wingless, toll (either great or crazy), Gurke (cucumber), tube, Pelle (husk/peel), Krüppel (cripple) etc....
Basically they tried to destroy/deactivate/mutate random genes necessary for the development of the fly, without knowing what they'd hit. Then they looked for larvae or flies that looked weird or behaved funky and named them with whatever they associated with it. Finally they took the animal and tried to find the gene they deactivated. If successful, they'd give that original name to the gene, no matter how stupid the name was and no matter how important the gene is. Hilarity ensued.
or 3. The lawyers, judges, and Congress will realize that the entire government will grind to a halt if that strategy is allowed, so they will reject the strategy, completely failing to realize that this is also a problem in other areas.
They put the laptop 3CM above the sperm and tried to control the temperature from below and via air conditioning. If I got it right while skimming through it, they also measured sperm temp every 5min using an infrared thermometer.
However the control was NOT a laptop with the wifi turned off but a setting with no exposure to electrical equipment at all. Which is not a control for WiFi but a control for a "Laptop with Wifi on".
Which leads me to think that the reason they chose this setup was that they couldn't get a useful result when using a laptop without WiFi as a control. The effect could in theory be caused by any part or combination of parts inside the laptop.
ahahahahahaaaargh *choke* *dies*
There is one thing that is always omitted in these nice tables.
The deaths shown in all but the nuclear incidents are mainly from work-related accidents. Like falling off a roof trying to mount a solar panel. Or getting killed in a coal mine. But that risk is part of the job, you become a roofer, you realize you could potentially fall to death while doing that and accept that risk. Plus it is probably reflected in your hourly wage. In cases like Chernobyl or Fukushima however mostly completely unrelated people who have nothing to do with and nothing to gain from nuclear power got killed or driven from their land.
Well I haven't read the paper either so I don't know how finely tuned you can program it, but the different kinetics of the different types of ion channels, their synaptic density and the way the kinetics can change upon release of various neuromodulators is something that might be a lot more challenging to implement in hardware than in software.
Especially regarding the fact that while we know a lot about the neurotransmitters, we know much less about the different channel types. The thorough characterization of TMEM16 e.g. just started sometime around 2008 if I remember rightly and I see no reason why it should be the last "new" channel that's found.
And I'd say we know even less about the various roles/actions of neuromodulators.
But I'm still intrigued to read the paper, maybe I'm wrong and it really allows for the customization necessary.
Plus: A "brain synapse" That's like saying this models a "computer chip". Great. Which type? There's a huge load of different types out there, each working a bit different. And imagine their joy if someone finds a new involved protein X which renders this chip's design inaccurate and thereby incomplete. It's a nice toy but nothing more atm...