Firefox 10 Released

← Back to Stories (view on slashdot.org)

Posted by samzenpus on Wednesday February 1, 2012 @08:34AM from the brand-spanking-new dept.

Taco Cowboy writes "It's time to upgrade again. Firefox 10 is out and here's a list of bugs fixed in the new version."

364 comments

And we care because... by JMJimmy · 2012-02-01 08:36 · Score: 1, Offtopic

?
Plods along on 3.6 still...
1. Re:And we care because... by Anonymous Coward · 2012-02-01 08:37 · Score: 0, Funny
  
  I'm still on 3.5.
2. Re:And we care because... by noh8rz2 · 2012-02-01 08:38 · Score: 5, Funny
  
  if it was called Firefox X I would totally be on board! or maybe FirefoX.
3. Re:And we care because... by Anonymous Coward · 2012-02-01 08:38 · Score: 3, Funny
  
  I am on mosaic
4. Re:And we care because... by Anonymous Coward · 2012-02-01 08:43 · Score: 5, Funny
  
  i am on telnet. beta.
5. Re:And we care because... by Anonymous Coward · 2012-02-01 08:44 · Score: 0
  
  I'm still running Phoenix.
6. Re:And we care because... by Anonymous Coward · 2012-02-01 08:47 · Score: 0
  
  3.6.24 here.
  Still working like a champ.
7. Re:And we care because... by Anonymous Coward · 2012-02-01 08:47 · Score: 0
  
  I still write and send people physical letters and go to the library.
8. Re:And we care because... by oodaloop · 2012-02-01 08:49 · Score: 5, Funny
  
  i am on telegraph stop insensitive clods stop could be faster stop
  
  --
  Tic-Tac-Toe, Global Thermonuclear War, and relationships all have the same winning move.
9. Re:And we care because... by arglebargle_xiv · 2012-02-01 08:51 · Score: 5, Funny
  
  if it was called Firefox X I would totally be on board! or maybe FirefoX.
  If it was called FireAsaDotzler I'd be 100% behind it.
10. Re:And we care because... by houghi · 2012-02-01 08:54 · Score: 0
  
  Full ACK. Pretty insightful for a FP. Pity I don't have mod points at this moment.
  The news factor of this is low, even for /.
  
  --
  Don't fight for your country, if your country does not fight for you.
11. Re:And we care because... by Anonymous Coward · 2012-02-01 08:56 · Score: 1
  
  I use gopher.
12. Re:And we care because... by JeanCroix · 2012-02-01 09:03 · Score: 5, Funny
  
  *smoke*
  *smoke*
  *smoke*
  *smoke*
13. Re:And we care because... by maxwell+demon · 2012-02-01 09:03 · Score: 0, Redundant
  
  I'm still using smoke signals.
  
  --
  The Tao of math: The numbers you can count are not the real numbers.
14. Re:And we care because... by tripleevenfall · 2012-02-01 09:04 · Score: 4, Funny
  
  (whacks oodaloop over the head with a bone, shrieks loudly)
15. Re:And we care because... by flatt · 2012-02-01 09:04 · Score: 4, Insightful
  
  ?
  Plods along on 3.6 still...
  We care because there are substantial performance gains in recent Firefox versions and Firefox 10 finally addresses the plugin situation in a reasonable manner. Sure 3.6 will continue to work but you're missing out... but feel free to keep your head in the sand.
  I never thought I'd say it but it looks like the new release schedule is finally starting to pay dividends. Now if we could just get Mozilla to play better with the enterprise.
16. Re:And we care because... by jameskojiro · 2012-02-01 09:08 · Score: 5, Funny
  
  (Uses protein expression between clusters of cells)
  
  --
  Tsukasa: All I really want, is to be left alone...
17. Re:And we care because... by Anonymous Coward · 2012-02-01 09:08 · Score: 0
  
  i use telepathy
18. Re:And we care because... by tripleevenfall · 2012-02-01 09:19 · Score: 3, Funny
  
  (is not)
19. Re:And we care because... by Anonymous Coward · 2012-02-01 09:20 · Score: 2, Funny
  
  I set the entire universe in motion with carefully designated laws such that it was inevitable that the following message would be expressed:
  It is truly beautigul.
20. Re:And we care because... by Laxori666 · 2012-02-01 09:20 · Score: 5, Funny
  
  i know
21. Re:And we care because... by rjstanford · 2012-02-01 09:22 · Score: 4, Insightful
  
  Of course they could have kept to exactly the same release schedule without completely changing the definition of "major version number" to the point that they now have no way of telling people when a real, serious, actually major change is happening.
  
  --
  You're special forces then? That's great! I just love your olympics!
22. Re:And we care because... by bughunter · 2012-02-01 09:27 · Score: 1
  
  We know; it's distracting. Please stop projecting.
  At the very least, lay off the BBW pr0n while we're eating.
  
  --
  I can see the fnords!
23. Re:And we care because... by ArcherB · 2012-02-01 09:37 · Score: 4, Funny
  
  if it was called Firefox X I would totally be on board! or maybe FirefoX.
  It' would have to be FirerfoXXX for me to get on board. The XX stuff is a bit lame for my perverted tastes.
  
  --
  There is no "I disagree" mod for a reason. Flamebait, Troll, and Overrated are not substitutes.
24. Re:And we care because... by eternaldoctorwho · 2012-02-01 09:38 · Score: 1
  
  (Changes electron spin orientation, causing bonded atoms to switch theirs as well)
25. Re:And we care because... by jbeaupre · 2012-02-01 09:43 · Score: 1
  
  UGUAAGAGUGGAAGGACAGAUUAG
  
  --
  The world is made by those who show up for the job.
26. Re:And we care because... by Anonymous Coward · 2012-02-01 09:44 · Score: 0
  
  AOL - Hey I just got another free floppy in the mail for 600 minutes!
27. Re:And we care because... by Anonymous Coward · 2012-02-01 09:56 · Score: 0
  
  Your organization needs to implement rfc2549.
28. Re:And we care because... by Anonymous Coward · 2012-02-01 10:03 · Score: 0
  
  No, he implemented that but then his neighbor instituted a DOS attack with a shotgun.
29. Re:And we care because... by Anonymous Coward · 2012-02-01 10:13 · Score: 0
  
  Please don't give them ideas! I'm embarrassed enough of the new versions of Firefox as it is...
30. Re:And we care because... by Anonymous Coward · 2012-02-01 10:13 · Score: 1
  
  If it was called iFox, millions of Apple fanbois would totally be on board!
31. Re:And we care because... by flatt · 2012-02-01 10:15 · Score: 1
  
  Oh, I most certainly agree. If it were up to me, this would have been version 4.6 (5.0 being 4.1 and so forth) and the plugin situation would have been changed to the current status in 4.0, even if it meant a release delay. Mozilla has been trying to get to the point where the version number is irrelevant (ala Chrome) but shot themselves in the foot in basically the only place that it actually matters. Of course, everyone loves version inflation.
  I have high hopes for their LTS releases.
32. Re:And we care because... by J_Darnley · 2012-02-01 10:17 · Score: 0
  
  Another shout for the 3.6 crowd from me!
33. Re:And we care because... by jonadab · 2012-02-01 10:28 · Score: 3, Funny
  
  You upgraded to 3.6?
  
  I tried 3.0, got tired of losing data, and downgraded back to 2.0. I tried 3.5, got tired of losing data, downgraded back to 2.0, poked around in Bugzilla until I found the relevant issue, noticed that the problem was not fixed in 3.6, and did not attempt the upgrade.
  
  The most important bug that was keeping me from updating was finally fixed in, umm, I think version 8, maybe 9, but by then I had kind of lost interest in the upgrade treadmill, so at the moment I'm currently still using 2.0.0.20 for now. Maybe I'll upgrade eventually, but I think I'll wait and see which version people say the right kinds of things about so I can upgrade to a *good* version.
  
  An example of "the right kinds of things", which would make me WANT to upgrade, would be something like, "This version doesn't have a lot of completely pointless UI changes, but it does fix most of the outstanding bugs. Support has also been added for a couple more CSS features, and the browser now remembers if you select an alternate stylesheet for a particular site and uses the same one when you visit the site again."
  
  I'm *unlikely* to be so excited about upgrading to a version about which people are saying things like "The new up-is-down left-side scrollbar[1] really makes the browser feel more modern, especially in conjunction with eliminating the window border and hiding the minimize and maximize buttons, which was long overdue. Also, having your preferences stored in the new Choices database allows a completely redesigned preferences dialog that allows you to search and get results from not just your prefs but also from your cookies and the Mozilla Planet feed, all in one unified interface. Additionally, hovering over a link now checks to see if the page it points to has any embedded video or plugin content, and if so it starts playing that in an overlay in front of the page you were looking at."
  
  [1] Imagine if a talented graphics artist spent sixty hours in Photoshop making a Xaw-style scrollbar (like Emacs used to use before it got GTK support) that looks like something out of a magazine ad, complete with reflectivity and glittering highlights. I can totally see the people who thought up the post-3.6 UI changes thinking that would be awesome.
  
  --
  Cut that out, or I will ship you to Norilsk in a box.
34. Re:And we care because... by theweatherelectric · 2012-02-01 10:32 · Score: 4, Informative
  
  Now if we could just get Mozilla to play better with the enterprise.
  The first Extended Support Release is based on Firefox 10: http://www.mozilla.org/en-US/firefox/organizations/. The FAQ outlines the life cycle for the ESR builds.
35. Re:And we care because... by oodaloop · 2012-02-01 10:35 · Score: 1
  
  will pay 1000 pesos to defeat infamous tripleevenfall stop
  
  --
  Tic-Tac-Toe, Global Thermonuclear War, and relationships all have the same winning move.
36. Re:And we care because... by JMJimmy · 2012-02-01 10:35 · Score: 1
  
  The whole point of a rapid release is that version numbers don't really matter. It's news if FF adds a major new feature or finally passes an Acid test. It's just not news worthy.
  I'm not keeping my head in the sand, I just hate the new UI and am testing alternatives for 3.6's EOL
37. Re:And we care because... by Yvan256 · 2012-02-01 10:46 · Score: 2
  
  42
38. Re:And we care because... by wickedskaman · 2012-02-01 10:47 · Score: 1
  
  Using spooky action over here. Oh, and here.
  
  --
  Sand's overrated... it's just tiny little rocks.
39. Re:And we care because... by phinneas · 2012-02-01 10:59 · Score: 0
  
  They have released the Extended Support Release as well (the other ESR) which is part way there, at least in terms of a slower release cycle. http://www.mozilla.org/en-US/firefox/organizations/
40. Re:And we care because... by lvxferre · 2012-02-01 11:03 · Score: 2
  
  You'll just need to wait Firefox 20, aka FirefoxXX. It'll be coming next month. So, finally, your browser will comply with all perversion it saw since you installed it.
  
  --
  Nerdy news for your nerdy needs? http://www.soylentnews.org Soylent News is people!
41. Re:And we care because... by Niedi · 2012-02-01 11:27 · Score: 1
  
  UGUAAGAGUGGAAGGACAGAUUAG
  AUGUGUAAGAGUGGAAGGACAGAUUAG (ftfy)
  ----------------
  this signature is only added to that post to get around the darn caps thing
42. Re:And we care because... by hairyfeet · 2012-02-01 11:31 · Score: 1
  
  I care because I just updated it across my systems and they STILL haven't fixed the major issues which are keeping me off Firefox as my main browser. I USED to use FF as my main, even before it was called FF, and the Moz suite before that. Remember what their mission statement was when they got us off the suite? To be "A light and fast standards complaint browser"? Remember that? Well since FF 4 its frankly sucked ass on AMD CPUs. Now the devs swear they aren't using the Intel Cripple Compiler but whatever they did in FF 4 seriously screwed AMD chips. And whatever it is has GOT to be in the main code as i've tried Pale moon, both x86 and x64 and the same problem is there. On launch it thrashes the hell out of the drive and launching an SD video, which plays just fine in Comodo Dragon with the standard non IE Flash, causes FF to slam the hell out of the CPU.
  For some reason this behavior isn't nearly as bad on Intel chips though which makes me think somebody goofed up somewhere. I mean when a first gen P4 is using less resources than a brand new AMD dual? Something is wrong here fellas. And why does it STILL need admin to update? I will give them credit for one thing though, they have managed to cut it down to where it only slams the CPU to 88-90% instead of a full 100% between FF 8 and FF 10, but when I can gain nearly an hour on my AMD netbook by simply using Comodo Dragon there is something wrong somewhere. I'm not a coder so I can't point out a specific line but if I had to guess i'd say its gecko. This kind of stuff didn't happen nearly as often before Chrome came out but since then its been benchmark bingo between those two and I think gecko has been stretched to its limit. That still doesn't explain why it plays nicer on an old P4 than on a new AMD though. Hell maybe they ought to use Webkit? I don't know. All I do know is in my own tests on real world web pages (FB, Yahoo and Gmail, slashdot, a couple of different tube sites, just basic crap folks use every day) I always end up with Opera first, QTWeb and Dragon trading second, FF and IE bringing up the rear. YMMV but at least on the sites i use the benchmarks and real world don't match.
  But I'll keep trying each new version, hoping the next one is the charm, simply because even though I doubt its needed with low rights mode and Secure DNS I still miss the fine grained controls of NoScript. But at least on the low power AMD chips like the e series, the Semprons, and the Brazos APUs its just painful to use FF for any length of time whereas Opera, QTWeb, and Dragon all give a quite usable web surfing environment, even on this 1.8GHz Sempron I keep at the shop for a nettop. And i'm certainly not gonna just toss a machine that surfs perfectly well on the browsers i mentioned so i can throw together a pentium D just to make FF happy. I do wish them nothing but luck and hope they fix whatever has gone wrong so that I can give FF out again on my handy freeware discs i give out with each sale.
  
  --
  ACs don't waste your time replying, your posts are never seen by me.
43. Re:And we care because... by Tyrannosaur · 2012-02-01 11:42 · Score: 1
  
  I think the plan is to have the version number jump by 100 for every major release, and 1 for every minor release. I can't wait for FF200!
44. Re:And we care because... by gparent · 2012-02-01 11:43 · Score: 2
  
  Do you also not have a Facebook account and do you refuse to use texts? AKA who gives a shit?
45. Re:And we care because... by Gordo_1 · 2012-02-01 12:04 · Score: 4, Insightful
  
  I tried 3.0, got tired of losing data, and downgraded back to 2.0. I tried 3.5, got tired of losing data, downgraded back to 2.0
  Pray do tell what this mysterious critical data losing bug was that has you scared in a corner clinging to FFx 2.0 while tens of millions of other people have somehow managed to use every version since without a problem?
  
  An example of "the right kinds of things", which would make me WANT to upgrade, would be something like,
  
  Does "the right kind of thing" include not being vulnerable to exploits that were discovered after December 18, 2008?
46. Re:And we care because... by Anonymous Coward · 2012-02-01 12:11 · Score: 0
  
  I use gopher.
  Gopher rocked! Damned www ruined the net.
47. Re:And we care because... by iggymanz · 2012-02-01 12:37 · Score: 1
  
  the ESR also changes too quickly. so the original point stands, "Now if we could just get Mozilla to play better with the enterprise."
48. Re:And we care because... by bzipitidoo · 2012-02-01 12:52 · Score: 2
  
  You hate the new UI? I love it! More screen space devoted to web pages instead of interface. Chrome may have started this trend, but Firefox is keeping up.
  I used to use addons to do the things newer versions of Firefox now do much better. Tried autohide addons for the menu bar and status bar, and they worked but not flawlessly. Settled on an addon that put the entire menu on a button next to the URL bar-- worked better than the menu autohide. Now I don't have to install any of that anymore. Another thing I always do is enable "small icons". And now the lowest hanging fruit for more screen space is the window manager. Title bars and scroll bars waste space. That sort of thing is pretty important on small screens.
  The main reason to stick with 3.6 is memory footprint. Version 9 is unusably slow when you have only 128M RAM. Am wondering how much 10 improved.
  
  --
  Intellectual Property is a monopolistic, selfish, and defective concept. It is "tyranny over the mind of man"
49. Re:And we care because... by Call+Me+Black+Cloud · 2012-02-01 13:14 · Score: 3, Funny
  
  You win. Or you would have won, if you were.
50. Re:And we care because... by ppanon · 2012-02-01 13:39 · Score: 1
  
  And why does it STILL need admin to update?
  Because an update involves replacing executable code. It's a good thing that your regular user accounts don't have permissions to change the executable files on an application that's used by multiple users, including system administrators. The opposite is a major security hole that's begging for a privilege escalation attack the next time an administrator needs to use the browser to download an update.
  
  --
  Laissez lire, et laissez danser; ces deux amusements ne feront jamais de mal au monde. - Voltaire
51. Re:And we care because... by Tubal-Cain · 2012-02-01 13:50 · Score: 3, Funny
  
  *grunt* *hoot* *growl*
52. Re:And we care because... by jbeaupre · 2012-02-01 14:55 · Score: 1
  
  doh! Thanks.
  Hey! I've evolved!
  
  --
  The world is made by those who show up for the job.
53. Re:And we care because... by arekq · 2012-02-01 15:13 · Score: 1
  
  I don't like the new default UI (with no menubar) either.
  You can revert it to the old style by enabling the "Menu Bar" (in the Preference menu item)
54. Re:And we care because... by Anonymous Coward · 2012-02-01 15:39 · Score: 1
  
  > Pray do tell what this mysterious critical data losing bug was
  It's not mysterious at all. It was bug 440093.
  > Does "the right kind of thing" include not being vulnerable to
  > exploits that were discovered after December 18, 2008?
  Meh.
  Which specific exploits should I be concerned about?
  I used to pay attention to Mozilla security patches, reading about each one as it was released, but over time I started noticing that pretty much all of them are either inconsequential privacy-nut stuff (e.g., horror or horrors, website A that I visit might theoretically be able to deduce whether I've also visited website B recently; I don't, to put it gently, really care very much about that) or else require exotic contrived circumstances to trigger.
  Okay, occasionally they do discover a pointer error or whatnot that theoretically could allow a buffer overrun, but the number of known pieces of malware in the wild that actively exploits flaws of that sort in Firefox 2 to do anything significant (by which I mean, remote code execution) and will run on my operating system is, to the best of my knowledge, still zero so far. (I'm a Debian user. Most malware that runs on Linux systems gets in through vulnerable services via open ports, or vulnerable server-side dynamic scripting run via services on open ports, typically because some clown neglected to taint-check user input before interpolating it into a database query, or allowed sendmail to listen on port 25 on a public IP address, or something of that nature. Most of the rest is designed to be installed by hand on an already compromised system and is usually distributed in source form. Almost all of the rest is trojans, which can only get in by exploiting an active logic flaw in the keyboard-to-chair interface. Exploiting flaws in client applications, in a binary-specific way such as with buffer overruns and the like, is much more common on other operating systems, for a variety of practical reasons.)
  I figure, compared to the average Firefox user, I can more than make up for a lack of recent browser patches by not having a large collection of completely unnecessary plugins installed for handling content types I don't give a fig about (Flash, Shockwave, RealAudio, RealVideo, Quicktime, Windows Media, Silverlight, twelve different brands of "Webinar" and "online meeting" plugins, Overdrive Media Console, Adobe Digital Editions, ...), each which probably has more unpatched security vulnerabilities than the top five browsers combined.
  Anyway, if security were a really big concern on this system, running my browser in a separate user account from my other applications would be a MUCH more important step than making sure the browser has the latest patches. (I do maintain some systems where security is that much of a concern, but they're servers, and I definitely don't use them to browse the web, because, duh.)
55. Re:And we care because... by BZ · 2012-02-01 16:04 · Score: 1
  
  So what qualifies as a "major change" in your book? A rewritten JS JIT apparently does not. Significant additions to web standards support apparently do not. Rearchitecture of various parts of the browser to reduce memory usage don't.
  Do you only consider random user-interface changes "major"?
56. Re:And we care because... by BZ · 2012-02-01 16:08 · Score: 1
  
  What sort of AMD chip are you using? Does it have SSE2 support?
  For some workloads, I can definitely see a P4 with SSE2 blowing away a processor that doesn't have SSE2.... Some of those workloads can include "JS execution", because at least some JS jits depend on having SSE2 instructions (the alternative being to have a whole bunch of extra code to do x87 codegen).
57. Re:And we care because... by SpzToid · 2012-02-01 17:06 · Score: 1
  
  No wait, have you ever been to France. They have Minitel that can do everything!
  
  --
  You can't be ahead of the curve, if you're stuck in a loop.
58. Re:And we care because... by haruchai · 2012-02-01 18:34 · Score: 1
  
  What are your system specs? I've been running only on AMD desktops for 6 years and haven't seen anything like you describe. There have been issues but nothing that is dramatically different from the other browsers, except for memory hogging.
  
  Right now I'm on a Athlon II X4 640, FF 10, a handful of addons, 100+ tabs spread across 15 windows and memory / CPU is running at 900MB / 6-15%. Just a few hours ago, while still running FF9.01, the same tabs / windows were hogging about 2GB.
  
  --
  Pain is merely failure leaving the body
59. Re:And we care because... by Anonymous Coward · 2012-02-01 18:58 · Score: 0
  
  I use Terminate and FidoNet.
60. Re:And we care because... by hairyfeet · 2012-02-01 19:13 · Score: 2
  
  Which one? i have the Sempron Paris core 1.8Ghz wchich according to CPU-Z has SSE2 as well as 3DNow, although i'm probably gonna throw a mobile Athlon in there just because i know a place i can get mobile socket 754 chips cheap, I have an E-350 which has all of the latest features up to SSE4A I believe, that's a 1.6Ghz Dual core APU with Radeon 6310, and finally there is the Thuban 1035T in my gamer box which is a 6 core with SSE4a as well. the Sempron is XP Home, the E350 and Thuban are Windows 7 HP X64.
  Now you can't tell squat on the Thuban because the thing is so insanely overpowered and has turbocore so frankly i can run a half a dozen CPU hogging apps and it doesn't even flinch, but on the E350 and the Sempron you can definitely tell the difference between Comodo Dragon or QTWeb and FF because I have AnVir Task Manager on the Sempron and on the E350 i have AllCPUMeter and on both of those you can watch the FF just pound the CPU and the longer i use it the worse it gets on RAM, even when i close tabs. Both Dragon and QTWeb use a little more memory per tab but when you close a tab you get that memory back, with FF it seems to gain a little with each tab you open no matter if you close it or not.
  So its not SSE as both have SSE2 and I posted previously i also tried Pale Moon and saw similar results, and it can't be the OS because we have two different OSes, and it can't be the AV because I have Avast Free on one and MSE on the other. Believe me friend if it were something simple i would have tripped over it, I've removed and/or disabled extensions, tried FF straight and with the release mem on minimize trick, but I can launch FF on a P4 right next to the E350 and even though the E350 is a newer chip with more RAM the Pentium 4 will often win with FF, whereas both Dragon and QTWeb seem to be CPU agnostic. I don't know what the hell causes it but its bad enough my youngest was like "I don't know what you did to my machine, but its like a new system!" and all I did was install Dragon on his early Athlon X2 system and set it for default instead of FF.
  Its a head scratcher but I've got enough machines going through the shop that I can tell you its pretty widespread, frankly the ONLY customer of mine with an AMD I didn't see it on was the one that has an X3 and that seems to be that FF doesn't know what to make of an odd core so it sticks to dual and leaves his third alone. The rest have X2s or more often X4s and i heard nothing but complaints after FF 4 which is why I ended up switching them to Dragon. Not trying to plug Dragon as frankly i miss the days of FF and frankly don't like the Chromium GUI as much as the older FF GUI which I've kept but it just makes web surfing a total drag on the Sempron and E350 and its too much hassle to switch back and forth so lately I've been strictly Dragon and only playing with FF when a new version comes out. So far though while 8-10 did see a drop in CPU spiking frankly its still a good 20%+ higher than dragon or QTWeb and I can't take that kind of hit when it comes to battery life.
  
  --
  ACs don't waste your time replying, your posts are never seen by me.
61. Re:And we care because... by Randle_Revar · 2012-02-01 20:19 · Score: 1
  
  You just had to mention Xaw, didn't you? I will have nightmares tonight. Ugly nightmares.
  
  --
  Climate Progress - Hell and High Water
62. Re:And we care because... by Eraesr · 2012-02-01 20:23 · Score: 1
  
  I don't use any form of Internet at all.
63. Re:And we care because... by unixisc · 2012-02-01 20:27 · Score: 1
  
  Nobody on Netscape?
64. Re:And we care because... by unixisc · 2012-02-01 20:32 · Score: 1
  
  Wouldn't that be Firefox XXX? Or FirefoXXX? In that version, they could introduce something like win-enter when the address bar is highlighted to append .xxx as the TLD, just like ctrl-enter appends .com @ the end.
65. Re:And we care because... by Anonymous Coward · 2012-02-01 21:45 · Score: 0
  
  A Windows service to update applications without asking Administrator password will be in Firefox 12, and I'll be switching to the Aurora 12 builds as soon as they're out due to them fixing the Ctrl F page search results no longer appearing right at the bottom of the viewport, obscured so easily by overlaid "info bars" that websites put down there. Now the results will appear in the middle of the screen, FINALLY!
66. Re:And we care because... by Anonymous Coward · 2012-02-01 22:51 · Score: 1
  
  Hey, it took them long enough to settle on the name the first time. Don't give them any ideas, or we're going to be faced with FireNarwhal v.19.2.54.x as the next major upgrade, and FlamingWombat v.18.2.3.x as the stable maintenance release.
67. Re:And we care because... by FooBarWidget · 2012-02-01 23:49 · Score: 1
  
  It's faster than 3.6.
68. Re:And we care because... by pugugly · 2012-02-02 00:29 · Score: 1
  
  Missed by that much!
  More Monkeys!
  
  --
  An Invisible Entity of Vast Power whose existence must be taken on faith alone: Liberal Media
69. Re:And we care because... by BZ · 2012-02-02 00:44 · Score: 1
  
  That's really odd. If you're willing to spend a bit of time on this and have a machine on which performance noticeably dropped from one Firefox release to another, would you be willing to use http://harthur.github.com/mozregression/ to find when exactly that drop happened? That would be incredibly useful!
70. Re:And we care because... by JMJimmy · 2012-02-02 01:29 · Score: 1
  
  You can only partially revert it.
71. Re:And we care because... by JMJimmy · 2012-02-02 01:34 · Score: 1
  
  I'm sure there are many improvements, top on my list would be Snap Links Plus improvements. However, I did an analysis a while back and FF3.6 configured with file menu + small icons + search + address bar on one row and 2 toolbars takes up less space than the new FF UI and actually keeps functionality instead of burying it. A few things can be reverted back but overall it just feels like they expect you to want less functionality available via the mouse.
72. Re:And we care because... by Anonymous Coward · 2012-02-02 04:33 · Score: 0
  
  Even Mozilla's own help site points to you Status-4-Evar. That combined with re-enabling the menu bar and putting the tabs on bottom pretty much restores the whole old UI you want, I'd think. Oh actually, move the stop/reload buttons too. There you go.
73. Re:And we care because... by rjstanford · 2012-02-02 04:42 · Score: 1
  
  So what qualifies as a "major change" in your book? A rewritten JS JIT apparently does not. Significant additions to web standards support apparently do not. Rearchitecture of various parts of the browser to reduce memory usage don't.
  Do you only consider random user-interface changes "major"?
  Completely internal changes like reducing memory use? No, not so much. Changing the JIT? Hmm... maybe, since it would possibly trigger an external testing cycle. Changing web standards support? Yep, because that actually changes the way that the system behaves (as opposed to the way it performs) and installing it may well break existing usage patterns.
  
  --
  You're special forces then? That's great! I just love your olympics!
74. Re:And we care because... by BZ · 2012-02-02 04:55 · Score: 1
  
  I believe every single one of Firefox 5, 6, 7, 8, 9, 10 had changes to web standards support... That's one of the reasons the version numbers are what they are.
75. Re:And we care because... by brianerst · 2012-02-02 08:24 · Score: 1
  
  You are still running 2.0.0.20 because of the "open all bookmarks in tabs" bug?
  For those who don't feel like looking up the bug, the issue is that if you perform an "open all bookmarks in tabs" command on a bookmark folder by right-clicking on the folder and selecting from the menu, it will overwrite the active tab. If, OTOH, you do the same thing via a middle-click, CTRL-left-click or by opening the folder and selecting the "open all..." item, the active tab is unchanged.
  So - there were known (and easy!) workarounds for this "bug" since 2008. The main reason it wasn't "fixed" is that there was some disagreement as to whether this was a bug - some people preferred the fact that there were two, easily accessed modes - "active tab replaced" and "active tab left alone".
  That has to be one of the odder reasons to refuse to upgrade for nearly four years... If you "accidentally replace" tabs so often that it prevents an upgrade but can't do it often enough to remember to use a middle-click or ctrl-left click instead of the right click context menu, you have hit quite the sweet spot of use cases my friend...
76. Re:And we care because... by hairyfeet · 2012-02-02 08:25 · Score: 1
  
  The specs for my personal systems are posted above and as i said they did fix it a little in FF 10 but not nearly enough IMHO. run Comodo Dragon or QTWeb next to FF and use any true memory tool like Process Explorer to check resources. Frankly you're not really gonna notice much on a quad like what you have because you have so many cycles to spare, turn off a couple of cores and underclock it a little so it is more like one of the ULV chips and then you'll probably get a taste. Since the Intel compiler rigging and bribery came out I've been an AMD only shop so I've had my hands on a lot more AMD chips than you most likely have friend and frankly if you have an overpowered chip like my 1035T you don't notice it simply because you can waste a hell of a lot of cycles before you drag down the system but try it on an AMD C or E series ULV or one of the Semprons or ULV Phenoms and you will see a difference.
  Again YMMV, hell it may be that FF simply doesn't like certain sockets or AMD designs, hell if i know, i'm just reporting what I've seen with my shop and with my customers, most of whom bought the MOR triples and quads along with C and E series netbooks/laptops.
  
  --
  ACs don't waste your time replying, your posts are never seen by me.
77. Re:And we care because... by hairyfeet · 2012-02-02 08:34 · Score: 1
  
  Honestly I don't know if I'd be comfortable putting a programming language i don't know or use on my systems, these machines make me money by ordering parts, transcoding home movies to DVD, etc and when i typed "Python malware' into Yahoo I got over 700,000 hits including ones that steal CC numbers. Since i don't use the language and have no idea what it hooks into or where it would frankly be hell to try to isolate it and lock it down.
  I'm sure as someone who probably uses python in your job you might find this silly, but i know plenty of guys that use Adobe products without risk either, because they stay on top of it. i simply don't have the time to learn where the hooks are or subscribe to the mailing lists for a language I'll never use in any other capacity. Just not much uses for programming skills in home and SMB PC sales and repair, sorry.
  
  --
  ACs don't waste your time replying, your posts are never seen by me.
78. Re:And we care because... by BZ · 2012-02-02 08:49 · Score: 1
  
  I totally understand not being willing to stick python on your machines.
  If you're willing to, you can also manually download nightlies from http://ftp.mozilla.org/pub/mozilla.org/firefox/nightly/ (you want the dated directories ending in "mozilla-central"). Again, I understand if you don't want to put in the time to do this; it's just that we do have AMD test machines and they're not showing the symptoms you describe....
79. Re:And we care because... by rjstanford · 2012-02-02 08:59 · Score: 1
  
  I believe every single one of Firefox 5, 6, 7, 8, 9, 10 had changes to web standards support... That's one of the reasons the version numbers are what they are.
  Major changes that call into serious question their interoperability with applications built targetting the previous versions? I'm surprised, and not sure if I'm impressed or concerned. But that's good to know.
  
  --
  You're special forces then? That's great! I just love your olympics!
80. Re:And we care because... by BZ · 2012-02-02 09:07 · Score: 1
  
  Mostly additions, but it turns out that the way web apps are written adding new APIs can easily break them....
81. Re:And we care because... by haruchai · 2012-02-02 09:08 · Score: 1
  
  I have an Athlon64 X2 3600+ I can throw together to test; it's the lowest I can go for a functional AMD machine but I'll have to scavenge for videocard and power supply and I'll try underclocking it - I don't think that mainboard will let me disable a CPU but I can try using processor affinity to force as many things as possible onto 1 CPU
  
  --
  Pain is merely failure leaving the body
82. Re:And we care because... by ppanon · 2012-02-02 18:54 · Score: 1
  
  Honestly, I'm not sure how I feel about that. In an enterprise setting, it means rolling out updates is somewhat simpler. However in an enterprise environment, you've proably got some kind of infrastructure for rolling out updates and would prefer to have more explicit control over update deployment to be able to do regression testing first. As an individual user, do I really want every major shrinkwrapped application setting up a service with admin privilege to update itself? That would be a lot of network-capable code with admin privileges that could have bugs that lead to privilege escalation attacks. On my personal computer, I think I prefer to control that more explicitly.
  
  --
  Laissez lire, et laissez danser; ces deux amusements ne feront jamais de mal au monde. - Voltaire
83. Re:And we care because... by hairyfeet · 2012-02-02 20:47 · Score: 1
  
  What should I do with the nightlies? Does it have some built in tester tools? because the big tax rebate sales are coming right right ATM but as soon as they are over i wouldn't mind throwing it on the Sempron and the E350 when its plugged in, its just as I said I can't use it on the battery as it drains it too fast. I've bookmarked it so i can come back after I've unloaded the sales machines and can find it again easily. BTW I don't know if this is correct or helps any but I think it may have something to do with Google Analytic and Flash as I've noticed if I have a page with flash and it really starts grinding on the CPU and pounding the HDD I'll look and it is Google Analytic that FF says its loading. this combo seems to really pound the system hard, maybe its one of those rare corner cases where the combo of AMD chips plus that particular code causes a hang, maybe its the particular codec that is in the flash as I never thought to check whether its H.264 or VP6, but I can tell you when I hit that particular combo it can slam so hard I have to ctrl-shft-esc and kill FF that way because it'll slam the CPU too hard for me to get it to respond.
  Wish I could be of more help but I'm just a humble bass playing fixit guy, my thing has always been hardware not software. Do you think it could be the GPU? As come to think of it I had the same problem with my youngest boy even though he has a Pentium D, the only thing we have in common is HD4850 GPUs, everything else is completely different. When i switched him from FF to Dragon he too lost the hanging and grinding problem, is FF using some sort of GPU acceleration in the release branch? Again sorry if that's a dumb question but with dozens of regulars and the walk ins i just haven't had time to keep up with software development. I remember reading that Chromium was gonna go GPU which is what made me think of it. but after the sale I'd be happy to slap it on the Sempron and maybe the E350 if I have time to use it plugged in, its mostly my service call netbook.
  
  --
  ACs don't waste your time replying, your posts are never seen by me.
84. Re:And we care because... by BZ · 2012-02-03 03:36 · Score: 1
  
  > What should I do with the nightlies?
  You were saying you see startup being slow when it didn't use to be slow, right? What would be good is testing the various nightlies to see which one is the first one that appears.
  I really have no idea what the issue could be here, hence trying to gather more data.
85. Re:And we care because... by hairyfeet · 2012-02-03 08:51 · Score: 1
  
  Well I don't know what the numbers would be on the nightlies but I can tell you based on releases what i saw. 3 was good, better than 2 and the memory usage was improving, 3.5 got a little slower but not bad, 3.6 got a little slower and draggier still, 4 took a serious nosedive especially on HDD usage, 5 and 6 similar but they both used more CPU, 7 thrashed like mad, 8 wasn't much better, 9 lowered the thrashing by about 5-8% and 9 was same as 8 and 10 lowered again another few percent so that now with 10 it takes about 90% CPU on launch instead of 100% CPU like I saw with 5/6/7 but the longer I run it the draggier it gets. Pretty much watching an SD video is only possible on the nettop with FF if there isn't anything else running and its still jerky and without launching anything fancy or letting SD videos play (If I want to watch them in FF I use downloadhelper and watch them on the desktop) then I can get between 4-6 hours but after that it'll begin to affect the system, with the mouse starting to drag and jerk and the whole thing starts getting unresponsive.
  Hell if I know why it does what it does, like I said I've tried killing extensions, removing my security password for the password DB, both regular and optimized versions like Pale moon, no dice. All I know is FF is using on average a good 20%+ more resources than Dragon and when you are talking about a low power system that 20% can mean the difference between a responsive system and one you have to ctrl-shft-esc out of to regain control. After the sale I'm gonna try the ESR, see if it helps.
  
  --
  ACs don't waste your time replying, your posts are never seen by me.
Can't update on my work computer by schlesinm · 2012-02-01 08:37 · Score: 1

For unknown reasons, my work computer (still on Windows XP but Win 2007 is coming any day now) won't let Firefox higher than 8.X run. 9.X or 10.X just freeze when starting up.

--
My company home page
1. Re:Can't update on my work computer by 93+Escort+Wagon · 2012-02-01 08:48 · Score: 4, Funny
  
  You need to edit your computer's maxVersion entry to read 10.0.*
  
  --
  #DeleteChrome
2. Re:Can't update on my work computer by rwise2112 · 2012-02-01 09:11 · Score: 4, Funny
  
  Or if you want to keep going for a couple od weeks, change it to 100.0.*
  
  --
  
  "For every expert, there is an equal and opposite expert"
3. Re:Can't update on my work computer by Korin43 · 2012-02-01 11:38 · Score: 4, Insightful
  
  When did FF go from being the crown jewel of OS to absoloute dogshit?
  Never?
  Or are you making the mistake of paying too much attention to Slashdot trolls?
4. Re:Can't update on my work computer by Anonymous Coward · 2012-02-01 12:32 · Score: 0
  
  it is not trolling to point out the multitude of problems caused by the needless version churning of Firefox. The project has become vile dog shit.
5. Re:Can't update on my work computer by Anonymous Coward · 2012-02-01 12:36 · Score: 1
  
  Erm, except no one seems to have pointed out any problems other than (1) the version numbers are higher and (2) some people don't like updating their software often, so they're going to give up on Firefox and switch to Chrome. Oh, wait...
6. Re:Can't update on my work computer by Seumas · 2012-02-01 15:16 · Score: 0
  
  And 3) memory management - whatever the excuse - continues to be shit all these years later, while the same browsing behavior on Chrome does not result in hanging and crashing.
7. Re:Can't update on my work computer by Anonymous Coward · 2012-02-01 16:25 · Score: 0
  
  When did FF go from being the crown jewel of OS to absoloute dogshit?
  Never?
  Or are you making the mistake of paying too much attention to Slashdot trolls?
  At the risk of being accused of feeding a troll... FF is not at OS. Mayhaps you think of Fedora Linux? Firefox, Fedora Linux... almost the same thing. Also, Firefox runs on Fedora Linux, so it's a perfectly natural mistake.
  Also... 10? Already? Didn't 9.0.1 come out like a week or two ago?
  You know, this really all means absolutely nothing, all they did was move a decimal point, so now it looks like it's more advanced, or better somehow. Remember when Netscape 6 came out, right after 4.72 or whatever? They just skipped 5 to keep up with M$ Internet Exploiter, a sad and pathetic move... Which means in reality NS 6 was NS 5, 7 was 6, or however high they went before they died...
  So Firefox 10 is really Firefox 4.2.0, or something like that. How does that merit making the front page of Slashdot?
  In other news, the 2012 Cadillac Escalade EXT's brake booster computer firmware was updated to version Ab7.083s.288 b.01. Or something. Front page Slashnews.
  Or... does Mozilla Firefox pay /. for the slashvertisement?
8. Re:Can't update on my work computer by guitardood · 2012-02-01 21:18 · Score: 1
  
  Erm, except no one seems to have pointed out any problems other than (1) the version numbers are higher and (2) some people don't like updating their software often, so they're going to give up on Firefox and switch to Chrome.
  
  My company is developing a product which is highly dependent on javascript speed. When we started coding the project in early 2010, FF was our targeted browser because of JS speed. Throughout 2010 and 2011, FF's javascript engine seemed to take a huge performance hit that exponentially decreased as the version numbers increased. The only issue that matters to us at the moment is that even with the supposed rewritten JIT engine, Chrome spins circles around FF. Safari's engine is even faster. As a matter of fact, Safari running under wine on Ubuntu is faster than either Chrome or FF. For anyone who cares, our test platforms include Windows, Linux & MacOS on equivalent Quad-Core 2.4Ghz systems with 8G memory. Every test invariably comes up Safari, Chrome, Opera, Firefox. We stopped wasting our time with IE at version 6 because the JS code required too many "IF BROWSER==IE" exceptions.
  Three suggestions:
  1) Nobody really cares about the version numbers if the software is 100% functional for the intended task.
  2) Spend more time making sure the engine works than on the fancy coat of paint with flames on the hood. I've never fired up someone's browser and said, "Wow what a great theme!".
  3) From a user standpoint, 3 seconds is an eternity when waiting for the UI to respond
  
  --
  -- L8R, guitardood
9. Re:Can't update on my work computer by arose · 2012-02-01 23:25 · Score: 1
  
  Considering that some people have been bitching about memory usage basically since before 1.0, it's safe to say that that couldn't be the reason to lose anything Firefox used to have.
  
  --
  Analogies don't equal equalities, they are merely somewhat analogous.
10. Re:Can't update on my work computer by Anonymous Coward · 2012-02-02 04:57 · Score: 0
  
  Do you have a single sign on product installed? There is a known bug
11. Re:Can't update on my work computer by crutchy · 2012-02-08 18:36 · Score: 1
  
  have the firefox peoples introduced the DOM file.lastModifiedDate yet?
  
  I really need it for a project at work. Apparently Chrome has it but Chrome is evil. Aurora doesn't seem to have it yet (version 9.something).
12. Re:Can't update on my work computer by crutchy · 2012-02-08 18:41 · Score: 1
  
  hahaha "Internet Exploiter"... even better than "Internet Exploder"
  
  btw... is it just me or are most of the apps on the Android market really crap? i would assume that the iphone equivalent is also full of similar crap
"Firefox n released"... by Sez+Zero · 2012-02-01 08:37 · Score: 4, Insightful

"Firefox n released" is not a story.
1. Re:"Firefox n released"... by jcreus · 2012-02-01 08:39 · Score: 1
  
  It's a routine.
2. Re:"Firefox n released"... by Anonymous Coward · 2012-02-01 08:54 · Score: 5, Funny
  
  "'Firefox n released' is not a story" is not a comment.
3. Re:"Firefox n released"... by MarkGriz · 2012-02-01 08:57 · Score: 3, Insightful
  
  And nothing of value was gained.
  
  --
  Beauty is in the eye of the beerholder.
4. Re:"Firefox n released"... by sconeu · 2012-02-01 10:26 · Score: 1
  
  And nothing of value was *returned*.
  
  --
  General Relativity: Space-time tells matter where to go; Matter tells space-time what shape to be.
5. Re:"Firefox n released"... by Anonymous Coward · 2012-02-01 10:53 · Score: 0
  
  "\"'Firefox n released' is not a story\" is not a comment." is not a comment either!
6. Re:"Firefox n released"... by adamofgreyskull · 2012-02-01 11:16 · Score: 5, Funny
  
  /* "'Firefox n released' is not a story" */ is a comment.
7. Re:"Firefox n released"... by Anonymous Coward · 2012-02-01 11:28 · Score: 3, Funny
  
  | is not a pipe.
8. Re:"Firefox n released"... by Lanteran · 2012-02-01 13:42 · Score: 1
  
  Scumbag slashdotters, complain about political news for not being news for nerds, complain about actual news for nerds.
  
  --
  "People don't want to learn linux" hasn't been a valid excuse since '03.
9. Re:"Firefox n released"... by DMUTPeregrine · 2012-02-01 13:52 · Score: 1
  
  Firefox moved from "releases are news" to "ready or not, here it comes" release management. New version escapes aren't news.
  
  --
  Not a sentence!
10. Re:"Firefox n released"... by Tetch · 2012-02-01 17:21 · Score: 1
  
  "ceciceciceci" ..... [laughs asthmatically]
  
  --
  If you don't pray in my school, I won't think in your church.
11. Re:"Firefox n released"... by Anonymous Coward · 2012-02-01 19:53 · Score: 0
  
  object not set to an instance of a news story?
12. Re:"Firefox n released"... by Tom · 2012-02-01 23:26 · Score: 1
  
  Yeah. I wonder when they'll simply release the trunk once a day and call if "Firefox 20120202" etc.
  But I figure they'll stop the nonsense when they're some distance ahead of Chrome and feel like they've "won" the version number pissing contest.
  
  --
  Assorted stuff I do sometimes: Lemuria.org
13. Re:"Firefox n released"... by Anonymous Coward · 2012-02-02 04:21 · Score: 0
  
  /* "'Firefox n released' is not a story" is a comment. */
  /* compiles properly now */
Before any jokes appear by jcreus · 2012-02-01 08:38 · Score: 5, Informative

Firefox has launched a new version release system, creating an ESR for enterprises, organizations, etc. which is released once in 7 Firefox usual releases (Firefox 10, 17, 24, etc.), so that they don't have so much trouble (it must be horrible to find that two new versions have appeared as you are updating...). See a submission which didn't get to the front page for more details.
1. Re:Before any jokes appear by rjstanford · 2012-02-01 09:23 · Score: 1
  
  I actually thought this was a joke before reading the follow-on commentary.
  That's a problem.
  
  --
  You're special forces then? That's great! I just love your olympics!
2. Re:Before any jokes appear by linebackn · 2012-02-01 09:56 · Score: 1
  
  Is there an actual update channel for the ESR versions, or does this depend on manual updating?
  In other words, if I need to set machines to use 10.x and receive the security updates, while ignoring all the intermediate "major" versions until the next ESR is released, then how do I do that?
3. Re:Before any jokes appear by fph+il+quozientatore · 2012-02-01 10:19 · Score: 1
  
  Ah, it's always good to have software that helps you exercising in modular arithmetics --- quick, tell me, is Firefox 59 an ESR or not?
  
  --
  My first program:
  Hell Segmentation fault
4. Re:Before any jokes appear by Barefoot+Monkey · 2012-02-01 10:33 · Score: 1
  
  Announcing important developments instead of arbitrary version numbers? That would have been a much better story for the front page.
5. Re:Before any jokes appear by Cro+Magnon · 2012-02-01 10:42 · Score: 0
  
  So, ESR FF will update weekly instead of daily?
  
  --
  Slow down, cowboy! It has been 4 hours since you last posted. You must wait another few hours.
6. Re:Before any jokes appear by bn557 · 2012-02-01 18:26 · Score: 1
  
  Nope, isn't 59 prime?
  
  --
  Humans are slow, innaccurate, and brilliant; computers are fast, acurrate, and dumb; together they are unbeatable
7. Re:Before any jokes appear by Anonymous Coward · 2012-02-01 22:41 · Score: 0
  
  Wouldn't it be more sane to mark the "once in 7 usual releases" as version 5.0, the next 6 versions as 5.1, 5.2, 5.3, etc., then make the 17th as 6.0, the next 6 versions as 6.x, and so on?
  Maybe that wouldn't work either, but I can't say I'm fond of their new versioning scheme. There's no easy way to tell "this is a feature upgrade version, likely with ample bugs" versus "this is a maintenance release focused on stability". At least for me, I'm looking for stability, which is why I've been sticking with v.3.6.x ever since Mozilla started with its experimental numbering schemes.
8. Re:Before any jokes appear by digitalsolo · 2012-02-02 05:34 · Score: 1
  
  It's (59 - 10) / 7 So yes, it is an ESR.
  
  --
  Just another ignorant American.
9. Re:Before any jokes appear by tibit · 2012-02-02 06:32 · Score: 1
  
  Mozilla handles this issue via so-called update channels. What you describe implies switching from release channel to esr channel. I don't think that there's any way to do it (in a supported fashion) other than just installing the ESR release (it's a different binary from the regular Firefox 10, go look for it on their website). It automatically sets its update channel to esr and that's it.
  
  --
  A successful API design takes a mixture of software design and pedagogy.
Chromium master race by akilduff · 2012-02-01 08:38 · Score: 5, Funny

Firefox's constant updates drove me to Chromium.
1. Re:Chromium master race by jcreus · 2012-02-01 08:43 · Score: 5, Insightful
  
  [sarcasm]Which has a faaaar slower release schedule. Definitely.[/sarcasm]
  
  Where do you think Firefox got the idea from?
2. Re:Chromium master race by Anonymous Coward · 2012-02-01 09:02 · Score: 0
  
  Don't use logic against people who don't think in logical terms.
3. Re:Chromium master race by Anonymous Coward · 2012-02-01 09:05 · Score: 0
  
  Seamonkey doesn't have the major version jumps that Firefox has (if that makes any difference to you). I think it still gets updates almost as often, although the smaller version jumps can give less incentive to need to upgrade. It is only on 2.7 right now.
4. Re:Chromium master race by Abreu · 2012-02-01 09:39 · Score: 2
  
  Don't use logic against people who don't think in logical terms.
  And avoid people who use terms like "master race"
  
  --
  No sig for the moment.
5. Re:Chromium master race by StikyPad · 2012-02-01 11:15 · Score: 1
  
  Maybe you'd have gotten the GP's post if he'd enclosed it in imaginary sarcasm tags for you, like this:
  [sarcasm]Sarcasm tags are so useful.[/sarcasm]
  Unfortunately, that just ruins the joke for everyone else.
  
  --
  https://www.eff.org/https-everywhere
6. Re:Chromium master race by Anonymous Coward · 2012-02-01 11:17 · Score: 0
  
  There was sometime ago, where your post had been answered with:
  
  WHOOOOOOOOOOOOOOOOOOOOOOSHHHHHH
  
  Ah, where did those times go to?
7. Re:Chromium master race by Dan541 · 2012-02-01 12:30 · Score: 1
  
  Firefox's constant updates drove me to Chromium.
  Same, while I still like Firefox it's Chrome for the foreseeable future on my PCs.
  
  --
  An SQL query goes to a bar, walks up to a table and asks, "Mind if I join you?"
8. Re:Chromium master race by elashish14 · 2012-02-01 12:32 · Score: 5, Funny
  
  Obviously from Windows. I mean, they went from 3.1 to 95! No idea how they pulled that one off.
  
  --
  I have left slashdot and am now on Soylent News. FUCK YOU DICE.
9. Re:Chromium master race by Brucelet · 2012-02-01 12:50 · Score: 1
  
  Chromium has a much subtler release process, which is actually the reason firefox updates were a problem.
10. Re:Chromium master race by Anonymous Coward · 2012-02-01 13:35 · Score: 0
  
  Obviously from Windows. I mean, they went from 3.1 to 95! No idea how they pulled that one off.
  That's nothing. Bungie took Marathon straight from 2 to infinity, skipping all the numbers in between!
11. Re:Chromium master race by Anonymous Coward · 2012-02-01 14:35 · Score: 0
  
  Firefox's constant updates drove me to Chromium.
  Dude! On Ubuntu at least, Chromium updates *every* *friggen* *day*!!
  And considering daily updates in the urgent bucket (otherwise you could batch them in weekly updates), those might be many security holes.
12. Re:Chromium master race by Nimey · 2012-02-01 14:52 · Score: 1
  
  There is only one Final Solution to that problem.
  
  --
  Hail Eris, full of mischief...
  
  E pluribus sanguinem
13. Re:Chromium master race by Ol+Biscuitbarrel · 2012-02-01 16:02 · Score: 1
  
  Any word on the release date for Google Chrome Google? ;)
  Alternatively Moz could announce the release of Firefox Google, which would sow enough confusion for them to regain some market share, I bet.
14. Re:Chromium master race by CharlyFoxtrot · 2012-02-01 16:26 · Score: 1
  
  There had versions 3.5 and 4 too before they switched to year-type labeling.
  
  --
  If all else fails, immortality can always be assured by spectacular error.
15. Re:Chromium master race by Anonymous Coward · 2012-02-01 21:52 · Score: 0
  
  and from 95 to 2000
16. Re:Chromium master race by Anonymous Coward · 2012-02-01 23:54 · Score: 0
  
  Whooooooosh!
17. Re:Chromium master race by asdf7890 · 2012-02-02 00:22 · Score: 1
  
  [sarcasm]Which has a faaaar slower release schedule. Definitely.[/sarcasm]
  Well, yes, but... The update process was one of the things keeping me off Chromium/Chrome. Once that difference had gone I had one less reason not to consider switching.
  
  If you use X over Y because in part because X doesn't do Z, when X starts doing Z you reconsider the option of using Y.
  
  Also a couple of releases got on my nerves by breaking things I use. For a while, around v7 and v8 IIRC, all plugins kept not being available: not disabled, just no UI elements to interact with them (sometimes restarting Firefox helped, sometimes it didn't) and during that period I discovered that the tools built into Chrome could do most of what I used Firebug for and do it more responsively.
18. Re:Chromium master race by tenco · 2012-02-02 03:06 · Score: 1
  
  That was when they started to use numbering based on revisions instead of arbitrary version numbers.
19. Re:Chromium master race by Anonymous Coward · 2012-02-03 04:26 · Score: 0
  
  Where do you think Firefox got the [upgrade timetable] idea from?
  They didn't get the full idea -- you shouldn't really advertise each new version. Chrome updates quietly. I'm now on version 18.0xxxxx of Chrome... I originally installed Chrome the day it came out. Can't remember a single "CHROME VERSION X.X IS NOW AVAILABLE!" email.
20. Re:Chromium master race by Anonymous Coward · 2012-02-04 08:55 · Score: 0
  
  I don't much care about the constant update what I don't like are the memory hogging bloated crap versions out now. At one time yes ago I could leave Firefox openand have 200 tabs open and it ran fine. Not any more. With 20 tabs open and left running all night I go to use it next day and it is none responsive and must be killed and restarted. I don't even bother any more. I just use chrome or Mozilla but they are only slightly better.
End of Fark? by Anonymous Coward · 2012-02-01 08:44 · Score: 0, Funny

From the list of bugs fixed:

688365 [Skia] Enable 'new AA' mode
Finally, an Acoholics Anonymous mode! So, will this sense when I'm drunk off my ass and about to post something really stupid - aka posting while drunk?!
Shit! That will put Fark out of business, uinless Drew adds a script and disclaimer 'Sorry, Firefox 10.0 and above will not work on this site.'
1. Re:End of Fark? by K.+S.+Kyosuke · 2012-02-01 09:25 · Score: 3, Funny
  
  Finally, an Acoholics Anonymous mode! So, will this sense when I'm drunk off my ass and about to post something really stupid - aka posting while drunk?!
  
  No, it's simply a mode in which the dwarves drawing lines in your graphics card walk with their brushes in a straight line instead of staggering along a jagged line like drunkards.
  
  --
  Ezekiel 23:20
How does it compare to Chrome? by yog · 2012-02-01 08:44 · Score: 2, Insightful

I still care about Firefox--it was the first real challenger to Internet Explorer since Netscape was dethroned, and it's such a nice browser... but Chrome just feels faster and more modern.
I guess considering that Google funds the Mozilla Foundation, the two browsers are not exactly competitors, and yet they are. Well, if Firefox slimmed down enough, I might switch back, since browsers are so functionally interchangeable these days, but for now I'm happy where I am. Sorry, Firefox team!

--
it's = "it is"; its = possessive. E.g., it's flapping its wings.
1. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-01 08:55 · Score: 0
  
  I'm curious.. why would you consider Firefox less "slim" than Chrome? At least, to the point where it hinders your use of the browser?
2. Re:How does it compare to Chrome? by kripkenstein · 2012-02-01 09:02 · Score: 4, Insightful
  
  Well, if Firefox slimmed down enough
  Actually if you download the Chrome and Firefox installers, you will see that Chrome is twice as large.
  
  There are various definitions of "slimness", each browser wins on some, unsurprising because both of these are good browsers.
3. Re:How does it compare to Chrome? by bhcompy · 2012-02-01 09:23 · Score: 4, Informative
  
  firefox RAM usage on http://news.slashdot.org/story/12/02/01/1840252/firefox-10-released, only tab open - 243mb across 2 processes(firefox.exe, plugin-container.exe)
  chrome RAM usage on http://news.slashdot.org/story/12/02/01/1840252/firefox-10-released, only tab open - 99mb across 4 processes(chrome.exe x4)
  
  This isn't a problem on your average desktop, but it blows ass on older machines, laptops, and netbooks that don't have the resources or the newer technologies that help offset the fact that Firefox is fat
4. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-01 09:40 · Score: 1
  
  The thing is, it'll stay at that 243mb if you open 10 or 20 or 30 more tabs. Alright, maybe not eexactly 243mb, but it is rather stable.
5. Re:How does it compare to Chrome? by ArcherB · 2012-02-01 09:44 · Score: 3, Interesting
  
  firefox RAM usage on http://news.slashdot.org/story/12/02/01/1840252/firefox-10-released, only tab open - 243mb across 2 processes(firefox.exe, plugin-container.exe)
  chrome RAM usage on http://news.slashdot.org/story/12/02/01/1840252/firefox-10-released, only tab open - 99mb across 4 processes(chrome.exe x4)
  This isn't a problem on your average desktop, but it blows ass on older machines, laptops, and netbooks that don't have the resources or the newer technologies that help offset the fact that Firefox is fat
  Firefox does have issues with being leaky. I came into the office the other day and it was using over 700MB RAM with about six tabs open. A restart fixed the issue, but Chrome doesn't have that problem. Then again, Chrome doesn't have side tabs (Tree Style Tabs), which is a must for having many tabs open. Tree Style Tabs is the only thing keeping me on FireFox.
  Currently, Firefox is using 417 MB for 9 tabs. The second largest memory hog on my system is Notepad++ at 96 MB.
  
  --
  There is no "I disagree" mod for a reason. Flamebait, Troll, and Overrated are not substitutes.
6. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-01 09:44 · Score: 2, Informative
  
  I can too pull numbers out of my ass. But I don't.
7. Re:How does it compare to Chrome? by b4dc0d3r · 2012-02-01 10:01 · Score: 1
  
  How does the download size make any sense to mention? The last time I unpacked Firefox installer to troubleshoot an installation issue, it was multiply packed in such a ridiculous way it made my head numb. They go through a lot of trouble, or at least did for 3.x, to make it small.
  Chrome apparently requires javascript to install, so I didn't even take a peek at its installer to see how it is packaged.
  The only time it makes sense to compare download sizes is when something is likely packaged the same way, like version 4 and 5 of software, or from the same company. Or something like a game add-on which is probably going to be stored compressed anyway (like a WAD or PAK file for doom/quake).
8. Re:How does it compare to Chrome? by viperidaenz · 2012-02-01 10:10 · Score: 3, Funny
  
  Currently, Firefox is using 417 MB for 9 tabs. The second largest memory hog on my system is Notepad++ at 96 MB.
  You're lucky you don't work with IBM software.
  My local WAS instance regularly goes above 1.2GB ram usage.
  RAD is happy chewing up 600 odd MB
  Plain old eclipse doesn't usually need more than 300M
9. Re:How does it compare to Chrome? by bhcompy · 2012-02-01 10:27 · Score: 4, Funny
  
  I don't, either. I pull them out of Process Explorer. That is unless your ass actually is Process Explorer
10. Re:How does it compare to Chrome? by inode_buddha · 2012-02-01 10:57 · Score: 3, Informative
  
  Dunno, I've never had that issue. 6 months ago, my entire machine had 512 megs. Yes, you read that right. FF3.x did just fine on that. System software is Debian Squeeze, fully patched/updated. And no, the box isn't slow or anything noticeable.
  I rarely have more than 3 or 4 tabs open, tho - maybe that's the secret. If I need to refer back to something that bad, then I just "save page as" or "print to file".
  
  --
  C|N>K
11. Re:How does it compare to Chrome? by lvxferre · 2012-02-01 11:08 · Score: 2
  
  Comparing Chrome and Firefox to use in an older machine is very much like comparing two whales to see which one fits in your goldenfish aquarium. Midori does wonders for these.
  
  --
  Nerdy news for your nerdy needs? http://www.soylentnews.org Soylent News is people!
12. Re:How does it compare to Chrome? by ZFox · 2012-02-01 11:10 · Score: 2
  
  That is unless your ass actually is Process Explorer
  I would suddenly begin to love showing people why their computers are running so slowly.
13. Re:How does it compare to Chrome? by shutdown+-p+now · 2012-02-01 11:19 · Score: 2
  
  chrome RAM usage on http://news.slashdot.org/story/12/02/01/1840252/firefox-10-released [slashdot.org], only tab open - 99mb across 4 processes(chrome.exe x4)
  Since you mention Process Explorer - did you account for memory pages shared (e.g. from same .exe and referenced DLLs used) across those processes?
14. Re:How does it compare to Chrome? by StikyPad · 2012-02-01 11:30 · Score: 5, Funny
  
  That is unless your ass actually is Process Explorer
  That would explain a lot about Process Explorer.
  
  --
  https://www.eff.org/https-everywhere
15. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-01 11:41 · Score: 0
  
  You're testing with addons, dumbshit. Tests like that are invalid. Plus firefox mem usage was proven to be lower, try harder next time with real benching, not loading a single tab. Or you could not bother and just look at the people smarter than you who tested the browsers a few weeks ago.
16. Re:How does it compare to Chrome? by labnet · 2012-02-01 13:57 · Score: 1
  
  Then again, Chrome doesn't have side tabs (Tree Style Tabs)
  Yep. I ditched Chrome back to FF because some glen@chromium.org dude thought it was bloat.
  
  --
  46137
17. Re:How does it compare to Chrome? by dudpixel · 2012-02-01 14:26 · Score: 4, Insightful
  
  Isn't that memory mostly a cache? so if your machine has less memory it will try to use less so it doesn't run out of memory on the machine?
  and if your pc has oodles of memory it will use it, thereby increasing performance.
  unused ram is worthless. software using ram as a cache is a good idea if done right.
  dont complain if it uses too much memory - only complain if it doesn't free it when you need it for something else.
  
  --
  This seemed like a reasonable sig at the time.
18. Re:How does it compare to Chrome? by Seumas · 2012-02-01 15:13 · Score: 2
  
  It _is_ a problem on your average desktop. In fact, it's a problem on your high-end desktop.
  I switched to Chrome, as of Firefox 9. I worked at Netscape in the 90s, so it was not a switch I made lightly, due to my Mozilla loyalty. The difference between the two (on multiple machines, across multiple versions, with multiple operating systems) is that on a system with 12gb of RAM and one to two dozen tabs (just averaging, here), Firefox grinds to a halt. It starts hanging/beach-balling. Eventually, it gets to the point where every action you take results in the OS saying the application isn't responding for ten to sixty seconds. Click a tab, hangs. Scroll. Hangs. Type in a text box. Hangs. Type in a new URL? Hangs. Click on a link? Hangs. Same type of surfing and extensions on Chrome? Never hangs. Never crashes.
  All the "we don't have memory leaks" or "we have memory leaks, but *here is why*" or "well, it's because of evil extensions!" in the world is irrelevant, when _it_just_works_ for your competitor. Whatever the explanation or justification for Firefox's experienced problems, the counter is that _Chrome_works_.
  I figure I gave Firefox enough time to get its shit together. It had problems in 3x (2x, too, probably - but that was so long ago I don't really even remember what my 2x experience was like). So I waited for 3.6. Then I waited for 4x. Then I waited for 5x. Then 6x. Then 7x. Then 8x. Then 9x. After like 8 major point releases over four years, I've stopped waiting and moved on.
19. Re:How does it compare to Chrome? by teh+dave · 2012-02-01 15:54 · Score: 5, Insightful
  
  Well, right now, Firefox 9 on my work system is using 568,948K of RAM and I have 73 tabs open. It has been open all day, with heavy usage for most of it. I sometimes put my work box to sleep instead of turning it off.
  I personally find that Chrome is better at managing small numbers of tabs and Firefox is better at managing many tabs. If I have saved around 10 tabs on each, Chrome always starts up within two seconds and loads all saved tabs quickly, and uses around half the RAM Firefox does. Firefox takes around 10-15 seconds or so before it's fully ready and uses twice as much RAM as Chrome does. In this way Chrome is a lighter and faster browser. However, if I have more like 50 saved tabs in both, then I find Firefox is ready to go sooner and uses far less RAM (30-40%) than Chrome does.
  Some people find Firefox is fine, others find it is a huge hog. I get this behaviour on all my systems on which I have both installed (ranging from Atom based to Sandy Bridge machines), but I have had friends say they have the opposite experience I do. So it depends on the user and the sites they visit, the number of tabs people keep open, the extensions they have installed and their browsing habits.
20. Re:How does it compare to Chrome? by colinrichardday · 2012-02-01 16:19 · Score: 1
  
  The difference between the two (on multiple machines, across multiple versions, with multiple operating systems) is that on a system with 12gb of RAM and one to two dozen tabs (just averaging, here), Firefox grinds to a halt.
  I have 25 tabs open with only 3 gb of physical RAM. I also have 6 gb of swap, very little of which is being hit.
21. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-01 16:32 · Score: 0
  
  Or about the ass.
22. Re:How does it compare to Chrome? by Nivag064 · 2012-02-01 16:36 · Score: 3, Informative
  
  In preferences ==> General
  
  Set
  'When firefox starts'
  to be
  Show my windows and tabs from last time''
  
  and tick the checkbox
  'Don't load tabs until selected'
  
  This vastly reduces the RAM used by Firefox, I often carry over a 100 tabs from one login to the next.
23. Re:How does it compare to Chrome? by PwnzerDragoon · 2012-02-01 18:38 · Score: 1
  
  I hope for your sake you're using a projector as a display.
24. Re:How does it compare to Chrome? by Randle_Revar · 2012-02-01 20:16 · Score: 1
  
  undo slip of the mouse mod
  
  --
  Climate Progress - Hell and High Water
25. Re:How does it compare to Chrome? by deroby · 2012-02-01 22:31 · Score: 1
  
  Although you already mentioned it as irrelevant, I doubt it is : CHECK YOUR ADDONS !
  I too was feeling FF getting sluggish over time and a colleague finally convinced me to give Chrome a try. WOW, it felt quick, it felt snappy... but it lacked on some parts; eg. somehow the chrome-internet had a lot more ads !?! So I installed Ad-Blocker for Chrome... Oh, and no live-bookmarks ?? No worries, plugin for that too. Hmm, clearly I need Password-maker too because I don't know any single pwd apart from my master pwd... luckily it was ported.... ugly, but workable, more or less. FoxyProxy on chrome ? Check, works albeit seems to mess around with the OS-settings instead of just those of Chrome.. .oh well, small price to pay I guess. Finding add-ons, err, extensions I mean, isn't fun either, you have to scroll through a gazillion poster-size flashy icons with no obvious explanation of what they do, how is that useful? Anyway, seems there is no chrome-alternative for https://addons.mozilla.org/en-US/firefox/addon/tortoisesvn-menu/ and the author's page seems to have vanished. Too bad, maybe I'll give it a go myself on a dreary day... Luckily my grease-monkey scripts pretty much work right out of the box, so no losses there.
  Let's have a look what else I have in FF, oohh, 7 more addons that I actually don't really need... time to uninstall them...
  After some days of alternatively using both I've managed to tweak Chrome so it does what I want it to do but as a result it feels a lot less snappy now than it did when it was virgin new and after upgrading FF to version 9 and removing those unneeded add-ons that one now feels pretty much the same as Chrome when browsing around the internet with the added benefit that it has the TortoiseSvn plugin that I really miss on Chrome. Yes, Chrome is remarkably faster too start but to be honest I leave my browser(s) open most of the time with tens of tabs open.. and I usually hibernate my laptop so it only gets reboot every few days anyway. Who cares about the browser taking 10 seconds extra to start ?
  In the end I've gone back to FF completely except for the occasional situation where I land on some page in a foreign language and I do need to know what's on it (eg. some taiwanese driver page). Chrome really shines when it comes to the 'online' translation thing.
  Out of curiosity I now have both open and chrome uses about 170Mb on 12 processes for 3 tabs, firefox takes about 450Mb for 18 tabs, but again, who cares as I've got another 450Mb of memory in standby anyway.
  And as for as responsiveness is concerned, I've never experienced FF to hang like what you're describing unless I got in a situation where EVERY program starts behaving unresponsive, in those cases FF is no exception... there is only so much stuff you can cram in 4Gb of ram ... If you suffer from 'beach-balling' with 12Gb of memory, you're either having a lot of memory-hungry programs open (not sure how OSX handles swapping out memory of background programs, I guess not that different from Windows) or you're hard disk is going to die some of these days and warning you with IO-bottlenecks right now... (use some tool that can read the SMART info).
  
  --
  If there is one thing to be learned on slashdot, it has to be sarcasm.
26. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-01 23:16 · Score: 0
  
  Isn't that memory mostly a cache? so if your machine has less memory it will try to use less so it doesn't run out of memory on the machine?
  When I had the problem (either the leak I ran into has been fixed, or something changed so I don't hit it anymore), it did run out of memory. Everything would slow to a crawl while the machine was swapping heavily, and then after a while, Firefox would have allocated so much memory that the system ended up killing it. Often Firefox itself was not responding while the rest of the system became slow, like it was stuck in some loop allocating memory - but it could be that the garbage collector just kicked in way too late, and the memory the GC needed would push it over the edge.
  When starting it again, I could click "restore all tabs", and it would work fine (for a while), so it's not like it needed to allocate more memory than the system had.
27. Re:How does it compare to Chrome? by higuita · 2012-02-02 00:10 · Score: 1
  
  on my machine, one debian testing amd64
  1 tab - http://news.slashdot.org/story/12/02/01/1840252/firefox-10-released
  Chrome Virtual: 1223MB RSS: 59MB
  Firefox Virtual: 783MB RSS: 174MB
  2 tabs + http://slashdot.org/
  Chrome
  1223+463+868=2554MB 64+62+9=135MB
  Firefox
  802MB 185MB
  3 tabs + http://www.lwn.net/
  Chrome:
  1235+472+868=2575MB 66+65+9=140MB
  Firefox:
  803MB 182MB
  4tabs + http://tech.slashdot.org/story/12/02/02/028249/darpa-works-on-virtual-reality-contact-lenses
  Chrome:
  1235+473+868=2576MB 66+67+9=142MB
  Firefox:
  812MB 189MB
  on this totally random test, chrome is good for machines with lots of swap and only one page... you add more pages and you need more virtual memory... so better have some swap so you can start other apps also
  firefox is heavier to just one page, but adding tabs it doesnt increase much and used a lot less virtual memory...
  
  --
  Higuita
28. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-02 00:42 · Score: 0
  
  Which makes it pretty obvious that you're a lightweight user.
  
  Average for me is:
  
  a) One window open with 6-12 tabs to talk to our internal bug tracking / project management system through the day. Plus other tabs there with test URLs open, or to make use of other internal web applications.
  
  b) One window for whatever I am researching at the moment. Google in the first tab, interesting looking results opened up in the other tabs. See something that looks like it might fix the issue or answer a question? Middle-click and it goes into a background tab while I keep looking through the rest of the results. Which could be 6 tabs at a time, could be up to two dozen.
  
  c) One window per task at hand. Get a new phone call asking me to look into something? Up pops a new Firefox window along with a dozen new tabs.
  
  If I have less then (3) windows open with less then 3 dozen tabs or so, then I've probably rebooted this week and haven't reached my normal level of usage.
  
  Firefox uses about 450MB at the moment on a 3GB machine, but often pigs out to 750MB. Which is annoying because I need that spare memory for firing up development environments or virtual servers / clients.
29. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-02 01:30 · Score: 0
  
  This isn't a problem on your average desktop,
  It is certainly a problem on servers, where a single user who leaves a Firefox instance running can end up gobble up gigabytes of memory. Multiply by number of users who do so. Chrome isn't much better, in that it incorrectly believes that it's always OK to use up to half the total RAM of a system. It doesn't work that way on multi-user machines.
  Midori seems to be far better behaved, but there still needs to be a way for admins to limit number of tabs globally. Sure, cgroups can limit memory usage, but leads to programs crashing. You don't want that - if a user had something important open (and to each user, what they do is important), there will be tickets coming back to you.
  So, what's the solution for those of you who run servers and thin clients?
30. Re:How does it compare to Chrome? by webheaded · 2012-02-02 01:46 · Score: 1
  
  What the hell do you have so many tabs open for? Good god man. o_O I use Firefox at work too, and even then I usually keep it down to 10-15 tops. At home, I read things and then close them...I just don't understand how people like you have so many tabs open...why? Why do you have to have that many tabs open?
  
  --
  "Those who would sacrifice essential liberties for a little temporary safety deserve neither liberty nor safety." - BenF
31. Re:How does it compare to Chrome? by spiralx · 2012-02-02 01:47 · Score: 1
  
  Thanks, I'd not seen that option last time I checked the preferences :)
32. Re:How does it compare to Chrome? by DuckDodgers · 2012-02-02 01:48 · Score: 1
  
  There was a recent Slashdot article about Firefox memory leaks: http://developers.slashdot.org/story/12/01/17/1338225/notes-on-reducing-firefoxs-memory-consumption in more recent versions of Firefox, the leaks are all or almost all related to add-ons. Add-ons are a big reason to use Firefox, so it's still a problem, but it's not as bad as it was. And they're working on ways to help developers who create add-ons prevent memory leaks too.
  
  In terms of overall speed and memory usage, Tom's Hardware Guide does a very thorough browser comparison shootout a few times a year. For a long stretch Firefox was awful. But Firefox won the last two comparisons: September 30, 2011 http://www.tomshardware.com/reviews/firefox-7-web-browser,3037.html and January 6 http://www.tomshardware.com/reviews/macbook-air-chrome-16-firefox-9-benchmark,3108.html
33. Re:How does it compare to Chrome? by webheaded · 2012-02-02 01:49 · Score: 1
  
  Agreed. I'm not entirely sure WHAT causes it, but Chrome is much smoother and I get sick of the damn Firefox interface freezing up. They're supposed to be splitting the browser interface from the tabs soon, I here. I'm very interested in that...I think it would help greatly with stability if a tab could freeze without taking down the whole damn browser.
  
  Of course, that still may not fix it simply feeling like a slow piece of crap half the time. I can't quite put my finger on it but even without 2 dozen tabs open, it just kind of runs like crap in general.
  
  --
  "Those who would sacrifice essential liberties for a little temporary safety deserve neither liberty nor safety." - BenF
34. Re:How does it compare to Chrome? by hobarrera · 2012-02-02 01:50 · Score: 1
  
  You can't add "plugin-container" to the ecuation. That's flash (most likely). Kill it with fire!
35. Re:How does it compare to Chrome? by teh+dave · 2012-02-02 09:31 · Score: 1
  
  I use them like bookmarks. Bad habit, I know. Whenever I'm doing something that gets shoved to the side in favour of something else, I leave the tabs open so I can resume where I left off, and to remind me to come back to them. Sometimes I go back to them and finish with them, sometimes I never get around to it. Over time they just stack up.
  Every now and again I go on a tab-closing rampage and close 80% of them. It's probably getting around about that time now...
36. Re:How does it compare to Chrome? by werewolf1031 · 2012-02-02 10:46 · Score: 1
  
  What the hell do you have so many tabs open for? Good god man. o_O I use Firefox at work too, and even then I usually keep it down to 10-15 tops. At home, I read things and then close them...I just don't understand how people like you have so many tabs open...why? Why do you have to have that many tabs open?
  Because different people sometimes do things differently.
  Shocking, I know.
37. Re:How does it compare to Chrome? by dudpixel · 2012-02-02 14:20 · Score: 1
  
  Isn't that memory mostly a cache? so if your machine has less memory it will try to use less so it doesn't run out of memory on the machine?
  When I had the problem (either the leak I ran into has been fixed, or something changed so I don't hit it anymore), it did run out of memory. Everything would slow to a crawl while the machine was swapping heavily, and then after a while, Firefox would have allocated so much memory that the system ended up killing it. Often Firefox itself was not responding while the rest of the system became slow, like it was stuck in some loop allocating memory - but it could be that the garbage collector just kicked in way too late, and the memory the GC needed would push it over the edge.
  So there probably was a bug.
  
  When starting it again, I could click "restore all tabs", and it would work fine (for a while), so it's not like it needed to allocate more memory than the system had.
  That's not necessarily true. The cache may be full of things that firefox thinks you "might" be going to look at next. When you closed it, reopened it, then did 'restore all tabs', that cache is likely gone, and all you are left with is just the memory required for the tabs you have open at the time.
  I am making assumptions about how firefox (and other browsers) work(s) though...
  
  --
  This seemed like a reasonable sig at the time.
38. Re:How does it compare to Chrome? by Anonymous Coward · 2012-02-03 05:22 · Score: 0
  
  I use them like bookmarks. Bad habit, I know. Whenever I'm doing something that gets shoved to the side in favour of something else, I leave the tabs open so I can resume where I left off, and to remind me to come back to them.
  I use the History for that. The Awesome Bar searches through the pages I've visited if I want to revisit.
  
  Every now and again I go on a tab-closing rampage and close 80% of them.
  Every day or so I open the History (sorted by last visited). Anything I don't want to revisit I either delete or forget the entire site.
  Bad habit, I know. I should probably bookmark the ones that I really want to keep so I won't accidentally delete them. It doesn't happen often enough to bother with, though.
39. Re:How does it compare to Chrome? by Seumas · 2012-02-03 09:07 · Score: 1
  
  The reason extensions are irrelevant is that I can get the same type of functionality with Chrome's extensions, but sans the performance issues. Eventually, I could only make excuses for it for so long before I couldn't tolerate it.
  As for Firefox's responsiveness - that is almost certainly a function of the browser. Perhaps I am a heavier user of it than most people, but it will inevitably grind to a halt the longer you run it. I don't use Firefox on Linux or Solaris, but I can speak to this being the way it behaves on OSX and Windows (XP, Vista, and 7) across multiple machines over multiple years, whether running on SSD or not. Chrome, on the other hand, has never behaved this way. No hitches, no hangups, no stalling, no "application is not responding" and no crashing. Firefox does this even when it is the only application operating. The longer it runs, the more memory it uses and the more likely it is to behave this way and only restarting the browser will resolve it.
40. Re:How does it compare to Chrome? by crutchy · 2012-02-08 18:53 · Score: 1
  
  that would explain if a process suddenly ran like shit
Using it now by Anonymous Coward · 2012-02-01 08:45 · Score: 0

on Linux. Seems unstable, crashes, is slower that 9.
1. Re:Using it now by Lanteran · 2012-02-01 13:46 · Score: 1
  
  Performance in linux has been degrading since about 7, before which I never had memory leaks. After firefox took up over 60% of my RAM for 7 tabs, I swapped to chromium and never looked back.
  
  --
  "People don't want to learn linux" hasn't been a valid excuse since '03.
OMG guys by eexaa · 2012-02-01 08:46 · Score: 4, Insightful

Every time you users are hit by the "release early, release often" that you always wished, I hear you moaning.
"It's time to upgrade again."
Attitude of that sentence somehow doesn't fit on shlashdot for me. I hoped that it was _here_ where people can appreciate the last "big" and still free browser.
1. Re:OMG guys by Windwraith · 2012-02-01 08:52 · Score: 1
  
  I actually like it, but I have acute versionitis, I use git/hg/etc more than apt-get...so I don't count.
  The transition from latest versions has been quite smooth actually. No addons here (30+) failed to load in about 3-4 releases (beta channel).
2. Re:OMG guys by 0123456 · 2012-02-01 08:53 · Score: 4, Insightful
  
  "Release early, release often" is intended for testers and bleeding-edge users, not end users who just want a stable product.
  It's not as though there have been any user-noticeable changes between 3.6 and 9 other than them buggering up the GUI.
3. Re:OMG guys by CanHasDIY · 2012-02-01 09:01 · Score: 1
  
  "Release early, release often" is intended for testers and bleeding-edge users, not end users who just want a stable product.
  Pretty sure that was also John Holmes' personal philosophy.
  
  Thank you, thank you, I'll be here 'til Thursday.
  
  --
  An enigma, wrapped in a riddle, shrouded in bacon and cheese
4. Re:OMG guys by Pope · 2012-02-01 09:33 · Score: 1
  
  Well, then, see you next Thursday.
  
  --
  It doesn't mean much now, it's built for the future.
5. Re:OMG guys by Anonymous Coward · 2012-02-01 10:36 · Score: 0
  
  Well yeah, if by "buggering up" you mean making it way better. And really, that's THE thing people notice.
6. Re:OMG guys by equex · 2012-02-01 12:32 · Score: 1
  
  One bug kept me from downgrading to the last 3.x version: When you scroll web pages with the mouse wheel, half the vertical space is scrolled a little more than the right side (about 4-5 characters worth). You have to scroll a little back and forth to make it align
  
  (wtf kind of bug is that anyway; either you scroll all the page or none of it; i suppose someone had a brilliant idea about backbuffers and optimizing but it turned out that scrolling on a computer screen was a problem we solved in the 80s and so someone just #included some 80's source code in 4.x to make it work again :] )
  
  Anyway, it's annoying enough to actually get on the 4.x train. I read about this bug before when 3.6 was hot, but it never happened to me. Of course, now that i actually wanted this version back, the bug appeared. /sigh
  
  --
  Can I light a sig ?
7. Re:OMG guys by iggymanz · 2012-02-01 12:38 · Score: 0
  
  I've noticed the increasingly pointless and insipid changes to Firefox's UI, if that's what you mean by "way better".
8. Re:OMG guys by elashish14 · 2012-02-01 12:44 · Score: 1
  
  http://en.wikipedia.org/wiki/History_of_Firefox#Version_3.6.
  Since 3.6, Firefox has come way down in terms of memory usage, they've implemented a new Javascript engine and a plugin container, they've added all sorts of tools for tracking memory leaks, and HTML5 support. JS speed has gotten damn close to that of Chrome. Yes, these are not user-noticeable things. That does not mean they are not important. Yes, they're copying a lot from Chrome, but they're copying the good things (features) and leaving the bad ones (lack of privacy) out.
  I thought it was as stupid as anyone else when they first adopted the release strategy, but now I realize that it makes a lot of sense. The browser is plenty stable. New features are being getting added much more rapidly. I was totally wrong back when they adopted this strategy. Honestly, I'm starting to find that I'm really glad that they made it. And the new ETS version is a great step in the right direction. At this point, it looks to me like people hate on Firefox just cause it's trendy, not because it's technically inferior. Still the best browser IMO.
  
  --
  I have left slashdot and am now on Soylent News. FUCK YOU DICE.
9. Re:OMG guys by CharlyFoxtrot · 2012-02-01 16:33 · Score: 2
  
  I hoped that it was _here_ where people can appreciate the last "big" and still free browser.
  Maybe it's because we remember when Firefox (then called Phoenix) was the small, lightweight, nimble browser that saved us from Mozilla's insanity ? Unfortunately it has gone over to the dark side.
  
  --
  If all else fails, immortality can always be assured by spectacular error.
10. Re:OMG guys by Anonymous Coward · 2012-02-01 19:15 · Score: 0
  
  I call bullshit. The reason you think it's memory footprint has decreased is that you are ignoring the plugin_container process which, on my machine, has a larger footprint than firefox.exe
11. Re:OMG guys by Anonymous Coward · 2012-02-02 03:05 · Score: 0
  
  "Release early, release often" is FOR END USER. It means that every bug is fixed quickly and fixes are released often.
  Do not mistake stable branch and development branch.
  For both the "Release early, release often" is valid philosophy.
12. Re:OMG guys by Anonymous Coward · 2012-02-02 08:27 · Score: 0
  
  That's Flash, and it's a bloated bag of poop. Kill the process and reload any page that complained to reboot Flash, and I guarantee the result will be a much smaller plugin_container.exe. For a while.
Forward button missing, UI items jump around. by Anonymous Coward · 2012-02-01 08:46 · Score: 1

The forward button disappears unless you press the back button. -1 for making the UI items jump around. I'm getting tired of things changing around every six weeks. I'm looking forward to using the entended support release when it's out.
Then again, this comes with web developer tools. I'm not a web developer. How do I remove this bloat? Why weren't these tools offered as an add-on rather than built-in?
1. Re:Forward button missing, UI items jump around. by Anonymous Coward · 2012-02-01 08:56 · Score: 0
  
  The sad thing is that already have that. Its called Firefox 3.6. It has been out for a long time and is very consistent. Personally, I'll stand away from the bleeding edge as long as I have a usable and consistent UI, a consistent experience, and a lot of the crud added by addons rather than in the core (the one that put me over the side was the built in facebook support, rather than as an addon).
2. Re:Forward button missing, UI items jump around. by Anonymous Coward · 2012-02-01 11:36 · Score: 0
  
  You don't remove the web tools, just like you can't remove them on Chrome, and you can't remove them on IE. First because quite frankly, nobody gives a shit except chucklefucks like you, and second because it's not bloat, it's a set of useful features that do not slow the browser down. Do you honestly think the download size is gonna be cut in half if they remove the web tools? Or that your performance will increase by more than 0.1%? Or that your memory usage will drop by even one megabyte? Have you ever programmed software before? Do you not know about Lazy Loading?
  Honestly, people whine about stupid fucking shit just because they can. Firefox is now Microsoft, literally no reason to whine but do it anyway because it's fun even when they're doing the right thing. Oh and whine more when they do the wrong thing.
3. Re:Forward button missing, UI items jump around. by tibit · 2012-02-02 06:38 · Score: 1
  
  It's out already, make sure you download the binary that has ESR in its filename, it's not the regular binary!
  
  --
  A successful API design takes a mixture of software design and pedagogy.
It's all new! by Anonymous Coward · 2012-02-01 08:46 · Score: 0, Insightful

We don't fix bugs, we release new versions! This time we put a '10' on the box on Flynn OS I mean FireFox.
lolwut by Anonymous Coward · 2012-02-01 08:49 · Score: 2, Insightful

Chromium gets updated as frequently, if not more.
It just doesn't prompt you, and ask for your permission.
Firefox actually started this rapid release schedule in response to Chrome's process. A large factor in the adoption of this process was likely due to Google's heavy involvement in Firefox and it's primary sponsor funding an assload of Firefox's cash flow. In fact a lot of what Firefox does not, seems like an active pursuit to become more like Chrome, whereas when Chrome started out, it essentially seemed to be a version of Firefox staple gunned on top of WebKit.
Chrome is up to like version 18. I bet you started using it somewhere between 4 and 9.
1. Re:lolwut by Anonymous Coward · 2012-02-01 09:17 · Score: 0
  
  Chromium gets updated as frequently, if not more.
  It just doesn't prompt you, and ask for your permission.
  Actually, I believe only Chrome auto-updates. Chromium does not.
2. Re:lolwut by Grishnakh · 2012-02-01 09:48 · Score: 4, Informative
  
  Wrong. Chromium doesn't auto-update at all. You're thinking of Chrome.
  Chromium also doesn't have a lot of the built-in BS that Chrome has, such as a PDF reader (Okular works just fine, thank you), and stats reporting.
3. Re:lolwut by kangsterizer · 2012-02-01 11:44 · Score: 1
  
  Well, you could use Firefox ESR then, unless updating once a year is still too much.
4. Re:lolwut by asa · 2012-02-01 13:29 · Score: 1
  
  ESR will update every 6 weeks just like Firefox. The difference will be that you'll get no new features with your ESR updates, just security patches.
  - A
5. Re:lolwut by mcrbids · 2012-02-01 20:34 · Score: 1
  
  Okular's not bad, and makes adobe acrobat look like a pregnant redneck with down syndrome and a half-dozen beers in its gut, but doesn't hold a candle to Chrome's build-in PDF viewer, which is so good it's barely distinguishable from any other web page, at least in speed.
  
  --
  I have no problem with your religion until you decide it's reason to deprive others of the truth.
6. Re:lolwut by Anonymous Coward · 2012-02-02 02:46 · Score: 0
  
  How about you guys patch your browser the second Tuesday of every month?
7. Re:lolwut by treeves · 2012-02-03 06:36 · Score: 1
  
  Hmmm. Maybe GGP *wasn't joking*.
  
  --
  ...the future crusty old bastards are already drinking the Kool-Aid.
Still no Flash in mobile ... by MacTO · 2012-02-01 08:52 · Score: 2

I realize that it isn't a very popular around these parts, but quite a few websites still use this critter and are unlikely to stop using it in the near future. Meanwhile they're implementing antialiasing for WebGL and OpenGL ES acceleration, features that aren't in common use yet.
Hum ...
This is the web we're talking about. It should be access to content first, then the frills.
1. Re:Still no Flash in mobile ... by jcreus · 2012-02-01 08:56 · Score: 4, Insightful
  
  But Flash must die; if we continue feeding it with updates it will not die. Web developers must realize that the future is HTML5.
2. Re:Still no Flash in mobile ... by Anonymous Coward · 2012-02-01 09:00 · Score: 3, Informative
  
  Adobe have discontinued Flash for mobile browsers. Those technologies you mention make up its replacement.
3. Re:Still no Flash in mobile ... by Anonymous Coward · 2012-02-01 09:01 · Score: 0
  
  This is the web we're talking about. It should be access to content first, then the frills.
  You do realise this is the best argument against flash don't you?
4. Re:Still no Flash in mobile ... by idontgno · 2012-02-01 09:20 · Score: 5, Funny
  
  Web developers must realize that the future is HTML5.
  And IPV6. And "Strong" Artificial Intelligence. And maybe The Singularity. Or the Eschaton.
  
  --
  Welcome to the Panopticon. Used to be a prison, now it's your home.
5. Re:Still no Flash in mobile ... by Anonymous Coward · 2012-02-01 09:25 · Score: 4, Funny
  
  Steve, is that you...?
6. Re:Still no Flash in mobile ... by Millennium · 2012-02-01 09:32 · Score: 4, Informative
  
  Flash is a plugin. Bug the people who make it -Adobe, not Mozilla- if you want to use it on mobile devices.
7. Re:Still no Flash in mobile ... by MacTO · 2012-02-01 09:59 · Score: 1
  
  Here's a newsflash: Flash is going to be harder to kill than IE6 because too many people depend upon it. In case you've failed to notice this, Firefox has been trending in the same direction as IE lately. Also in case you haven't noticed this: mobile browsing has been trending upwards for a while.
  I guess what I'm saying is this: Firefox is losing it's market due to unpopular decisions. Failing to recognise an emerging market that will probably end up replacing most desktop computer use is another way to lose market share.
  Taking care of your users, rather than prattling on about ideology, is one way to reverse that trend and ensure a place in a changing world.
8. Re:Still no Flash in mobile ... by Anonymous Coward · 2012-02-01 10:07 · Score: 0
  
  Those technologies you mention make up its replacement.
  If they can't be used to view existing Flash content then they're not a replacement for Flash.
9. Re:Still no Flash in mobile ... by Spigot+the+Bear · 2012-02-01 10:44 · Score: 1
  
  Flash is a plugin. Bug the people who make it -Adobe, not Mozilla- if you want to use it on mobile devices.
  Flash is already supported on Android, but the browser itself, in this case Firefox, has to actually implement support for the plugin. To date, Mozilla hasn't done this for the Android version of Firefox.
10. Re:Still no Flash in mobile ... by Anonymous Coward · 2012-02-01 11:08 · Score: 0
  
  So Opera, Dolphin, the stock Android Browser and many others can use flash on my tablet, but Fifrefox won't. Who's fault is this again?
11. Re:Still no Flash in mobile ... by kbrosnan · 2012-02-01 11:46 · Score: 4, Interesting
  
  This is working fairly well on Nightly and Aurora. On Beta (11) soon.
  Adding Flash to Firefox was a considerable amount of work. Adobe and Google rather drastically re-wrote NPAPI. The only documentation on how Flash worked on Android is the Android source. This work represents several hundred person hours to get it working.
  TBH Flash support is in the current release version has a pref for flash on 2.2 and 2.3 but the experience is rather poor, hence it being disabled with no UI to enable it. about:config change plugin.disable to false. Judge Flash progress against the Nighty or Aurora builds. The Beta 10 or release 10 builds are not representative of the Flash experience for 11+.
  
  --
  These people look deep within my soul and assign me a number based upon the order I joined. -Homer Simpson
12. Re:Still no Flash in mobile ... by Trogre · 2012-02-01 13:48 · Score: 1
  
  Web developers will realise that the future is HTML5 when HTML5 performs better than flash. We have not yet reached this point yet.
  Web developers will realise that HTML5 is at least an option when HTML5 performs nearly as well as flash. We also have not yet reached this point.
  
  --
  "Nine times out of ten, starting a fire is not the best way to solve the problem." - my wife
13. Re:Still no Flash in mobile ... by Anonymous Coward · 2012-02-01 14:32 · Score: 0
  
  It's scheduled for the next release for certain mobile devices. Presumably others will follow.
  https://wiki.mozilla.org/Features/Release_Tracking
  https://wiki.mozilla.org/Fennec/Features/Plugins
14. Re:Still no Flash in mobile ... by thePowerOfGrayskull · 2012-02-01 16:45 · Score: 1
  
  Whose HTML5 implementation are you referring to?
  Microsoft's? Firefox's? Google's? Safari's?
  Because they're all just a bit different from each other, and they all support differing amounts of capabilities. HTML5 isn't a final standard yet and this is made apparent by these discrepancies..
  I'd love to see HTML5 become a stable, reliable and consistent standard that is applied across browsers. what we have now isn't it - instead we have to develop for three major engines. Remember the good old days when there were only two to consider?
15. Re:Still no Flash in mobile ... by Lennie · 2012-02-02 00:29 · Score: 1
  
  Looks to me like it is ready and scheduled for Firefox 11:
  https://wiki.mozilla.org/Features/Release_Tracking#Firefox_11:_Mobile
  Good thing is, you don't have to wait a year, but it will be available to you in 6 weeks ;-)
  
  --
  New things are always on the horizon
16. Re:Still no Flash in mobile ... by Asic+Eng · 2012-02-02 02:40 · Score: 1
  
  It's a shame Flash is not ready yet, because with the sync feature I can access my desktop bookmarks on my smartphone which is really useful. Also the way firefox mobile handles tabs (swipe the main window to the right to see the list of tabs) is quite nice - with the stock browser I need to select Menu -> Tabs and only then can I choose between windows.
  According to this Flash is targeted for Firefox 11 though.
17. Re:Still no Flash in mobile ... by Anonymous Coward · 2012-02-02 05:25 · Score: 0
  
  Or the Eschaton.
  That is my favorite ride at Disney World!
18. Re:Still no Flash in mobile ... by evilviper · 2012-02-07 05:16 · Score: 1
  
  Firefox mobile is also slow as hell, has a lousy interface that doesn't match the rest of the platform, and is built as ARMv7 native, cutting out compatibility with a lot of Android devices, even new ones like LG Optimus Slider. Not to mention Chinas $100 MIPS tablets.
  
  --
  Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
Webapps for everything? by Anonymous Coward · 2012-02-01 08:54 · Score: 1

With browsers being released every 3 months, can we really trust webapps to work in 2 years?
Best explained here: HTML5 for everything?
And FF10 also makes addons compatible by default by kripkenstein · 2012-02-01 09:00 · Score: 5, Informative

Firefox has launched a new version release system, creating an ESR for enterprises, organizations, etc. which is released once in 7 Firefox usual releases (Firefox 10, 17, 24, etc.), so that they don't have so much trouble (it must be horrible to find that two new versions have appeared as you are updating...). See a submission which didn't get to the front page for more details.
In addition to the ESR Firefox (which is basically like an Ubuntu LTS in how it works), Firefox 10 also marks addons as compatible by default. These two things solve much of the update annoyances.

FF11 will remove the UAC prompt on Windows, which will be a further improvement in 6 weeks from now.
Under actual news, IE 6 market share grows. by Baloroth · 2012-02-01 09:03 · Score: 3, Informative

I wish I was joking. IE 6 as a precent of desktop web browser views went up by 0.72% last month. FF as a whole went down, as did Chrome.

--
"None can love freedom heartily, but good men; the rest love not freedom, but license." --John Milton
1. Re:Under actual news, IE 6 market share grows. by nzac · 2012-02-01 13:18 · Score: 1
  
  Thats because people who use IE 6 used their browsers more. Unless its from XP priracy, I would check to see if it happends every Jan.
2. Re:Under actual news, IE 6 market share grows. by Anonymous Coward · 2012-02-01 17:38 · Score: 0
  
  People installing 2k/xp to escape the vista/7 garbage.
3. Re:Under actual news, IE 6 market share grows. by Kjella · 2012-02-01 18:31 · Score: 2
  
  Not sure where they got their figures from, but I imagine it's something to do with country figures etc. being updated, which can lead to such odd jumps. At StatCounter IE6 continued down from 1.78% to 1.56% and Chrome grew a lot. Firefox is on the downward trend though, though not as bad as IE. In fact at last month's rate of change (with all the dangers of extrapolation) Chrome would overtake IE as the world's #1 web browser in four months, at least according to StatCounter. They seem to disagree with 10-15% percentage points now.
  
  --
  Live today, because you never know what tomorrow brings
4. Re:Under actual news, IE 6 market share grows. by Insightfill · 2012-02-02 02:16 · Score: 1
  
  I wish I was joking. IE 6 as a precent of desktop web browser views went up [arstechnica.com] by 0.72% last month. FF as a whole went down, as did Chrome.
  The link indicates that percent of users on IE 6 went from 7.66 to 8.38%. While this is an increase of 0.72% against the whole user base, this can be looked at as a much larger percentage growth in the whole IE population of (8.38/7.66-1)*100 = 9.4%.
  For a browser that was replaced by IE 7 in 2006 - six years ago - that's a pretty impressive growth. What I always find more interesting is that IE 6 usage is about 25% in China!
Not compiled for 64-bit by Anonymous Coward · 2012-02-01 09:03 · Score: 0

Win32k.sys called, those security vulnerabilities are still present!
1. Re:Not compiled for 64-bit by nanoflower · 2012-02-01 09:21 · Score: 1
  
  If you really wanted a 64 bit version of Firefox you woud have already found and downloaded it since they've been building one for a while. Don't blame them for not walking up to you and handing it to you on a silver platter.
2. Re:Not compiled for 64-bit by jfern · 2012-02-01 15:07 · Score: 1
  
  Waterfox is a 64-bit Windows build. They don't have 10.0 yet, though.
  http://waterfoxproject.org/
Too slow by Chemisor · 2012-02-01 09:03 · Score: 4, Funny

That's way too slow to keep up with firefox. ESRs should have been 4,8,16,32,...
I like it by Barefoot+Monkey · 2012-02-01 09:04 · Score: 4, Informative

A version bump doesn't mean much these days, but this version is a big improvement. It's suddenly much more responsive and there's a very stylish built-in inspect tool if you press Ctrl+Shift+i. Also, Safari-style 3D transforms are implemented at last!
1. Re:I like it by icebrain · 2012-02-01 09:21 · Score: 0, Flamebait
  
  The question is, though, what did they break? What did they disable? What functionality did they decide their users didn't need to be using any more? What nonsensical, unjustified, flavor-of-the-week changes did they make to the UI? And how long will it take me to fix everything back and regain all the things I lost with the "upgrade"?
  
  --
  The meek may inherit the earth, but the strong shall take the stars.
2. Re:I like it by ae1294 · 2012-02-01 09:43 · Score: 1
  
  The question is, though, what did they break? What did they disable? What functionality did they decide their users didn't need to be using any more? What nonsensical, unjustified, flavor-of-the-week changes did they make to the UI? And how long will it take me to fix everything back and regain all the things I lost with the "upgrade"?
  TWO WEEKS
3. Re:I like it by JimboTheProgrammer · 2012-02-01 12:29 · Score: 1
  
  I like the new element inspector as well. The mode where you hover over elements to hunt them down is extremely crisp. Extra points for the way they hi-light and bubble tag the element, really sharp look and feel with that one. One more really smart move is to peg the CSS to the right and the html to the bottom. Just a fantastic upgrade for Firefox.
This is lazy by Anonymous Coward · 2012-02-01 09:04 · Score: 0

Slashdot I expect more out of you. What a lazy post.
Incomplete summary by revealingheart · 2012-02-01 09:04 · Score: 5, Informative

Could a Slashdot editor please add to the summary info about the Extended Support Release for organizations released at the same time, and the new built-in web developer tools? Even a link to a website with coverage about the new changes to Firefox would do.
1. Re:Incomplete summary by slapout · 2012-02-01 09:14 · Score: 2
  
  Summary with important info? You must be new here.
  
  --
  Coder's Stone: The programming language quick ref for iPad
2. Re:Incomplete summary by Blue+Stone · 2012-02-01 10:36 · Score: 4, Funny
  
  I'm sorry but if you want a slashdot editor to do that, you ned to phrase it in a way that allows them to hit the right combination of buttons for the banana to drop.
  
  --
  Corporation, n. An ingenious device for obtaining individual profit without individual responsibility. - Ambrose Bierce
3. Re:Incomplete summary by sco08y · 2012-02-01 12:10 · Score: 4, Insightful
  
  Could a Slashdot editor please add to the summary info about teh Koch brothers payola for organizations relased at the same time, and the new built-in government tracking software? Even a link too a website with coverage about the Apple iPad vs. Google Android would do.
  Fixed your post to meet slashdot editorial standards.
4. Re:Incomplete summary by iggymanz · 2012-02-01 12:41 · Score: 0
  
  I can do that right here. The ESR is also an enterprise-hostile version that changes way too fast for organizations that actually QA the browser interface for their mission critical applications, because the Firefox project has run off the rails with pointless version churning hysteria, lost functionality, and random rearrangement of controls. There. Happy?
5. Re:Incomplete summary by Nimey · 2012-02-01 14:55 · Score: 1
  
  Whoo, if you think ESR Firefox is enterprise-hostile, wait until you see RMS Firefox.
  
  --
  Hail Eris, full of mischief...
  
  E pluribus sanguinem
Mod parent up. by Anonymous Coward · 2012-02-01 09:08 · Score: 1, Insightful

This.
It's Google's fault; a stupid version number arms race.
Windows 2000 support ending soon by Anonymous Coward · 2012-02-01 09:08 · Score: 1

From Firefox 13 onwards there will be no more Windows 2000 support. So for the minorty of systems still using it they should make upgrade plans. Microsoft left you behind with IE6 there, and Safari and Chrome never supported it.
1. Re:Windows 2000 support ending soon by Grishnakh · 2012-02-01 09:52 · Score: 1
  
  It's really rather pathetic that anyone's still using Win2000 after all this time. It might make sense if it's embedded into some piece of industrial equipment, but it'd be idiotic to use such a thing for web-surfing anyway. For regular desktop usage, the Win2000 users should have been left behind ages ago.
2. Re:Windows 2000 support ending soon by Anonymous Coward · 2012-02-01 21:00 · Score: 0
  
  Windows 2000 still is probably the best OS Microsoft has released.
  (I understand a lot of people like to say "meh, who cares" for Win2k, but I guess that they have never used it, just started with XP or jumped straight to XP from 98. It was never marketed to consumers.)
3. Re:Windows 2000 support ending soon by Ash-Fox · 2012-02-02 04:04 · Score: 1
  
  Windows 2000 still is probably the best OS Microsoft has released.
  It isn't, because it lacks many APIs that applications use in newer versions of Windows. The lack of API support is not the developer's fault, it's the operating system's fault.
  
  --
  Change is certain; progress is not obligatory.
4. Re:Windows 2000 support ending soon by Anonymous Coward · 2012-02-02 05:33 · Score: 0
  
  By that logic, Windows Vista must be better than XP since it has more API methods.
  Yes, it is unfortunate that Microsoft implemented these things only in a later version, but I don't think it depreciates the value of the OS at the time of release (or SP4).
Addons now compatible by default by InvisiBill · 2012-02-01 09:11 · Score: 3, Interesting

Personally, it hasn't been an issue for me (with my old, highly-customized profile), but one of the new features listed in the not-so-technical release notes is "Most add-ons are now compatible with new versions of Firefox by default". This seems to be the major issue most people have with their quicker release cycle, so hopefully it'll alleviate some pain there.
Older versions of Firefox (Firebird? Phoenix?) had a separate version number just for extensions, which would've avoided these issues. However, it would create a confusing second version number completely unrelated to the browser version, and they always seemed to set it to the same number as the browser version anyway.
As for my personal upgrade anecdote, I set "extensions.checkCompatibility.10.0" to False just to be safe. When I restarted Firefox, I got the box asking which addons I wanted to enable and disable (with my current settings pre-selected). I clicked OK and Firefox 10 opened up, looking exactly the same as 9.0.1 (which I have customized to look and act almost exactly the same as 3.6).
Firefox 4.10 by vga_init · 2012-02-01 09:12 · Score: 2, Insightful

I prefer to think of this as Firefox 4.10 (or 3.10?)
1. Re:Firefox 4.10 by Anonymous Coward · 2012-02-01 10:00 · Score: 0
  
  Actually, it's Firefox 2.6.
  Look at the version numbers of <= Gecko 2.0.
  4.0 = 2.0, 3.0 = 1.9, 1.5 = 1.8, 1.0 = 1.7, 1.5 = 0.7, ...
  Now it all makes sense. (Actually, the original Mozilla and now SeaMonkey ones made sense the whole time.)
2. Re:Firefox 4.10 by Anonymous Coward · 2012-02-01 11:23 · Score: 0
  
  Given that 4 was their last "major" release with months of planning, testing, and overall development (at least a dozen betas, too,) you can grant them that.
  I prefer 4.6 myself, and it's at least reasonable if you consider the amount of time and stuff between 4.0 and now (10 months) and 3.6 and now (about 2 years.)
  Overall the idiocy of the version numbering could have been avoided but if that's the only problem (and for me, it is, never had any plugin issues) then great. But it would have been nice if Mozilla didn't shoot themselves in the foot. Still does not make sense why they didn't start just using the minor version number more instead of trying to shift paradigms.
3. Re:Firefox 4.10 by arose · 2012-02-02 00:07 · Score: 1
  
  Internal changes in a dot version? Your versioning system is actively broken, at least theirs doesn't pretend to be meaningful.
  
  --
  Analogies don't equal equalities, they are merely somewhat analogous.
Your welcome everyone by Osgeld · 2012-02-01 09:12 · Score: 1

I just upgraded everything to firefox 9 last night ...
1. Re:Your welcome everyone by synapse7 · 2012-02-01 09:20 · Score: 1
  
  With Firefox 11 nearing beta, you could hold off(what, a few months) and upgrade on the odd number releases.
idiocy by bigbangnet · 2012-02-01 09:12 · Score: 0

Releasing a software with bugs and publicly display those bugs is stupid...and freak'n annoying too. Version 10... really ???
Looking forward to Seamonkey 2.7 by janeil · 2012-02-01 09:13 · Score: 1

At least Seamonkey isn't doing the version number jumps, and also seems to be leaving the interface alone for the time being. And, I still appreciate being given a choice to upgrade or not, if I happen to check. Seamonkey just feels more "mozilla-ish" to me than firefox does any more.
1. Re:Looking forward to Seamonkey 2.7 by Anonymous Coward · 2012-02-01 10:11 · Score: 0
  
  Seamonkey just feels more "mozilla-ish" to me than firefox does any more.
  That's because Seamonkey is Mozilla rebranded.
one more step to silent upgrades by Anonymous Coward · 2012-02-01 09:14 · Score: 0

This release helps with the already-improved add-on compatibility problem with upgrading (I haven't had any add-ons disabled during an upgrade since v7, but YMMV). The rest of the silent upgrade features are tentatively scheduled for FF13 in June. Hopefully everyone will stop complaining about the fast release pace after that; you won't know what version you're on anymore, just like with Chrome.
Oh for crying out loud... by Anonymous Coward · 2012-02-01 09:15 · Score: 2, Funny

Fuck off with the crazy versioning already. Otherwise, we're going to have to start using scientific notation to represent Firefox's version # in a few years. They'll just start skipping to the next 1000-level release # whenever there's a major update - "Firefox 2E3 ?! What the hell happened to 1.78E3 thru 1.99E3?!
Tomorrow's News by Anonymous Coward · 2012-02-01 09:17 · Score: 0

Firefox 11 Released.
Is this an improvement? by dsgrntlxmply · 2012-02-01 09:23 · Score: 1

Slow-to-download PDF documents can still hang all tabs and windows. This is likely to be bad behavior in Adobe's plug-in, but one is left wondering whether Acrobat reader's terrible behavior could be encapsulated so as not to freeze everything.
Startup time seems excruciating on older machines with New remember-password query pops up on the left side (not good when mouse attention is on the right side) uses a pull-down that is too hair-trigger toward remembering the password when you don't want to.
The about:memory screen is a fun toy. As someone who began writing code on 1970s machines, I am left wondering how anything could be using such massive amounts of memory. At least it's interesting to see the memory use categorized, even if I do not understand the categories.
1. Re:Is this an improvement? by Vegemeister · 2012-02-01 09:57 · Score: 1
  
  Don't use an in-browser PDF viewer.
2. Re:Is this an improvement? by iggymanz · 2012-02-01 12:45 · Score: 0
  
  I have a better idea, use one, with a browser that hasn't become a pile of broken down shit exacerbated by version pumping / release hysteria. Shun Firefox, it's jumped the shark
3. Re:Is this an improvement? by shutdown+-p+now · 2012-02-01 12:59 · Score: 2
  
  Why not, if e.g. Chrome does it right? Why should I care if the online document I'm viewing is HTML or PDF? I just want to see it, I don't care about minute implementation details.
4. Re:Is this an improvement? by marcello_dl · 2012-02-01 14:31 · Score: 1
  
  >I have a better idea, use one, with a browser that hasn't become a pile of blah blah
  the better idea involves keeping the possibly faulty plug-in and make a program sandbox a plugin instead of letting an OS do the work with 2 applications? I have a better idea of better ideas...
  
  --
  ---- MISSING MISCELLANEOUS DATA SEGMENT --- [sigdash] trolololol
5. Re:Is this an improvement? by BZ · 2012-02-01 16:00 · Score: 1
  
  Using memory is easy. You just have to want to trade it for performance. ;)
  For example, a typical 10MP digital camera image, once you decode it to RGBA so that you can paint it fast, is about 40MB in memory. If you skimp on the "fast" and only store it in RGB, it's 30MB. If you want it to take less space, you have to store it compressed and decompress on every paint. And finding a web page with a bunch of such images on it is not hard at all.
  The other large user of memory is the JS execution environment. All you need here are badly-written scripts that create tons of objects and hang on to them. Oh, and your typical website nowadays comes with hundreds of kilobytes of source JS (which then needs to be compiled and actually executed, which takes a lot more memory than just storing the text).
  The upside is that you can put together a webpage in hours to do something that would take a lot of development time in the 70s, of course.
6. Re:Is this an improvement? by CharlyFoxtrot · 2012-02-01 16:43 · Score: 1
  
  Someone should build a new GUI around the Gecko-engine to replace the bloated mess Firefox has become. We could call it Phoenix ...
  
  --
  If all else fails, immortality can always be assured by spectacular error.
7. Re:Is this an improvement? by dsgrntlxmply · 2012-02-01 17:08 · Score: 1
  
  Yes, in the 70s we had great difficulty constructing popup gray-over ad annoyances on character displays that had only dim and blink enhancement bits available.
  Given that a system build required an overnight batch run, and arrived on a large roll of paper tape...
Re:And FF10 also makes addons compatible by defaul by trunicated · 2012-02-01 09:23 · Score: 5, Insightful

FF11 will remove the UAC prompt on Windows, which will be a further improvement in 6 weeks from now.
That actually missed FF11, and is slated for FF12.

--
There's a reason there is no "Disagree" mod...
List of bugs fixed... by VinylPusher · 2012-02-01 09:25 · Score: 0

...is IMMENSELY LONG!
Which just tells me that Firefox is a really, really buggy piece of software.
1. Re:List of bugs fixed... by jmac_the_man · 2012-02-01 09:35 · Score: 4, Insightful
  
  Or at least that it used to be...
2. Re:List of bugs fixed... by RebelWebmaster · 2012-02-01 12:12 · Score: 2
  
  Your opinion would probably be different if other browsers (or software projects in general) shared their full bug fix list between every release.
3. Re:List of bugs fixed... by Anonymous Coward · 2012-02-01 21:09 · Score: 0
  
  You do realise Mozilla requires a bug number for every commit? No bug (or feature) filed, no commit.
date-time version system by Anonymous Coward · 2012-02-01 09:26 · Score: 2, Interesting

can we all just please move to a date-time version system for software?
to me, firefox is just firefox, not firefox [number]. any software with the same name but a different version number is still just the same software to me, because it generally has the same overall basic function - even if it's found better ways or interfaces for doing so. it's not like firefox 9 was a browser but 10 came out and was all like "being a multi-tool web interface is lame, I'm gonna be an auto-cad clone now, so I need a new number!"
I'd much rather see "firefox v.2012.02.01.14.57.05" (YYYY-MM-DD-hh(24hr)-mm-ss of the final build's file time-stamp.) as it would not only tell me that this version is newer than the last version (which is all mere version numbers do), but it would also tell me WHEN it was last updated (+1 minor level of usefulness).
arbitrary version numbers just don't mean much to me anymore. especially not when mozilla and others are just going to randomly assign them based on a feeling of inferiority when compared to microsoft's IE version number or whatever.
Re:youtube by Anonymous Coward · 2012-02-01 09:28 · Score: 5, Funny

Youtube only exists in Firefox?
So, no 9.1 then? by SkimTony · 2012-02-01 09:29 · Score: 1, Insightful

Major version numbers should be for major features, not for bug fixes.
1. Re:So, no 9.1 then? by Anonymous Coward · 2012-02-01 10:25 · Score: 0
  
  But next release we get to say "This one goes to 11!"
  Think of the karma!
2. Re:So, no 9.1 then? by Rockoon · 2012-02-01 12:15 · Score: 1
  
  From the FF 10 release notes:
  
  o Fixed the bug which caused the major version number to be incremented instead of the minor version number.
  
  --
  "His name was James Damore."
Sadly so by Corson · 2012-02-01 09:31 · Score: 0

I am sick and tired of upgrading to new FF releases that disable the add-ons I use most often. How is it possible that an add-on remain compatible with IE over succesive Windows updates but not with FF?
1. Re:Sadly so by Anonymous Coward · 2012-02-01 09:56 · Score: 1
  
  Addons for IE are viruses usually.
2. Re:Sadly so by Anonymous Coward · 2012-02-01 10:32 · Score: 0
  
  Firefox 10 won't disable your add-ons.
  http://www.h-online.com/open/news/item/Firefox-10-arrives-bringing-CSS-3D-transformations-Update-1425611.html
  > Mozilla's plans for silent updates are still in the works, so the user will still need to interact with the browser to update. One change with updates is that add-ons and themes are assumed to function, rather than not function as assumed by previous Firefox versions, meaning that the update process won't leave a user with familiar extensions disabled and needing updates. Silent updates are currently expected to arrive mid-year with Firefox 13.
  After Firefox 13 with silent updates, people won't even be aware if the version number changes, just as is the case with Google Chrome which is up to version 18 or thereabouts by now.
  The level of misinformation about Firfoxe in this thread is astounding. Has Slashdot been completely taken over by MS astroturfers or something?
3. Re:Sadly so by Toonol · 2012-02-01 11:18 · Score: 1
  
  After Firefox 13 with silent updates, people won't even be aware if the version number changes
  
  This should be communicated far and wide, so that slashdot users... nay, the WHOLE WORLD... are warned to never upgrade past 12.
4. Re:Sadly so by gparent · 2012-02-01 11:45 · Score: 1
  
  You accidentally added 'never' to that sentence.
5. Re:Sadly so by Corson · 2012-02-04 06:40 · Score: 1
  
  It did, otherwise I wouldn't have posted my rant.
Just Installed a plugin... by Anonymous Coward · 2012-02-01 09:31 · Score: 1

I just installed Cooliris, I restarted Firefox, Firefox updated and broke the plugin.
I'm losing more and more control over my own system as time goes on, I think its time to go back to 3.6 and Windows XP, FUCK THE FUTURE!
I am waiting for FF XIII.2 by WillAffleckUW · 2012-02-01 09:32 · Score: 1

I'm waiting until they release Firefox 13 release 2.
It's a bit twee, but the graphics are very cool.
And it handles Kanji like a pro!

--
-- Tigger warning: This post may contain tiggers! --
Re:And FF10 also makes addons compatible by defaul by PReDiToR · 2012-02-01 09:33 · Score: 1

Firefox 10 also marks addons as compatible by default.
Actually, when I dropped out of the sandbox and attempted an upgrade the most useful addon I have was declared incompatible.
Password Hasher.

I'm just going to take a look now that I've been reminded and see if it will update without moaning.

--

Do not meddle in the affairs of geeks for they are subtle and quick to anger
Re:And FF10 also makes addons compatible by defaul by _xeno_ · 2012-02-01 09:34 · Score: 1

FF11 will remove the UAC prompt on Windows, which will be a further improvement in 6 weeks from now.
How the hell do they intend to do that?
No, wait, let me guess - they intend to install it in the user directory like Chrome does. I have to guess, because the feature description sure doesn't explain how it would work.
Oh, but the bug reports do. Apparently they're going to "work around" UAC by running yet another background updater. Just what I need. Another background updater running at startup, slowing Windows boot, just to "work around" Windows security.
Somehow, the idea of "working around" security features built into the OS sounds like a horrible idea to me.

--
You are in a maze of twisty little relative jumps, all alike.
But what about the memory leaks?! by griego · 2012-02-01 09:36 · Score: 0

Can't have a Firefox thread without some bleating & yammering about memory leaks...
Also by Sycraft-fu · 2012-02-01 09:42 · Score: 4, Insightful

With releases, keeping version numbers, you know, USEFUL is something we'd all like.
I'm ok with software updating often. However I'd like to have some easy idea of how large an update it is and version numbers are supposed to do that. Firefox used to do the multi-dot system of major.minor.fix. So if something went from say, 3.5.8 to 3.5.9 I knew it was just bug fixes, no testing needed just deploy it. However going from 3.5.9 to 4.0 tells me there could be some major changes and I need to look at it.
Now I have no fucking idea. There's a new "major" version like once a month, some which seem to be changed not at all, this one which seems to have made some non-trivial changes. Rather a pain in the ass to deal with in a large deployment setting, and confusing to users either way.
Imagine if MS did this with Windows, if every patch Tuesday brought a "new" Windows version out. However sometimes a new product would ship and be totally different. So you have a situation where Windows 3652 to 3653 is just a patch for XP but 3654 is Vista and is totally different.
FF's versioning is nonsensical and is just number envy as far as I can tell. "Let's do really big numbers so we look all new and shit!"
1. Re:Also by Alternate+Interior · 2012-02-01 10:09 · Score: 1
  
  That is the most brief and coherent explanation of Firefox's versioning failure I've seen.
  
  --
  Implicit Evaluation with PHP
2. Re:Also by Drinking+Bleach · 2012-02-01 11:12 · Score: 4, Insightful
  
  I'm going to quote myself from another forum; it's slightly old so the version numbers don't match what is current, but the idea is still the same. I'll also have you note that nowhere was there a guarentee that 3.5.x or 3.6.x releases were bug-fix-only releases; there were some rather significant feature changes and additions in both lines' "minor" versions.
  
  Meanwhile I have Chromium 15 installed, which sounds just as bad. The rapid release schedule is desirable for progress of web technologies. Keeping traditional versioning schemes doesn't really work with that. Otherwise it'll be 4.1, 4.2, 4.3, 4.4, etc... until what? 4.32? By then 4.32 might seem like a big enough step from 4.0 to have warranted several "major" version bumps, even though the change will seem minor compared to 4.31, and that minor compared to 4.30, and so on. (Emacs predates the browsers... it skipped from version 1.12 to version 13 when the authors realized they may never leave 1.x otherwise, essentally that first number became meaningless)
  To both Google and Mozilla's credit, they have seriously downplayed the prevalance of the version number. What matters now is that users are up to date, and by most common installation modes, that happens fairly automatic for both of them. How many people can really tell that they're on Firefox 8 without having to open Help>About, or that they're on Chrome/Chromium 15 without opening its about dialog? Probably not many.
  tl;dr: the old versioning system doesn't work. To top it off, Mozilla doesn't actively advertise version numbers either. Much of the hate seems to be generated by Slashdot feeling compelled to note that Firefox got an update.
3. Re:Also by Anonymous Coward · 2012-02-01 11:14 · Score: 0
  
  That is the most brief and coherent explanation of Firefox's versioning failure I've seen.
  Meh, there even isn't a single car analogy.
4. Re:Also by elashish14 · 2012-02-01 12:47 · Score: 4, Insightful
  
  On the other hand, if they just kept the same version, you'd have something like Linux where all the changes between 2.6.0 and 2.6.40 were incremental enough not to merit a major version change, yet the differences between versions 2.4 and 2.6 were completely dwarfed by the differences between 2.6.0 and 2.6.40.
  I'm not a software engineer, but from what I've noticed, it seems that once a product becomes mature enough (ie. once it does pretty much everything you expect), the version numbers become less significant as at that point as each revision is mostly just changing things under the hood, tweaking performance/security/stability/etc.
  
  --
  I have left slashdot and am now on Soylent News. FUCK YOU DICE.
5. Re:Also by Anonymous Coward · 2012-02-01 12:47 · Score: 0
  
  Sooooo instead of one 'big' release and lots of little patches. You get lots of little releases with an occasional 'big' feature. I am as an end user getting things faster. I am *NOT* seeing a problem with this.
  The version is easy now. x > y. No more do I need 4.0.3 or 3.6.20? I just snag latest and if its bigger than what I have its better. Im sorry it is MUCH simpler.
  You probably bitch about linux using 3.x.x now instead of 2.6.x.x
  Want something that releases every 2-3 years? Pick IE.
6. Re:Also by BZ · 2012-02-01 15:53 · Score: 1
  
  > So if something went from say, 3.5.8 to 3.5.9 I knew
  > it was just bug fixes, no testing needed just deploy it.
  And then going from 3.6.3 to 3.6.4 totally changed how NPAPI plug-ins were run.
  Oh, and "just bugfixes" can still break things, especially security bugfixes.
  Seriously, what you mostly had before was the illusion that you could push a change out without testing.
  > There's a new "major" version like once a month,
  > some which seem to be changed not at all
  Every one of the releases since Firefox 4 has contained significant changes and new feature additions.
  You're right that in a large deployment setting this is a problem; this is why the ESR was created.
  I'm not sure what's confusing to users, though. Users just get an update.
7. Re:Also by thePowerOfGrayskull · 2012-02-01 16:36 · Score: 1
  
  You're not any safer in deploying a dot release in an enterprise without testing; however it did give you the *illusion* of being safer. (After all it's a dot-release - so we "know" it couldn't be major right?)
  Version numbers are arbitrary - they mean different things to different projects. Just look at all the OSS projects that use 0.x releases for some reason - stable projects that have been around for years.
  Frankly, I'm all in favor of a versioning schema that makes me look at the content of the version rather than making assumptions based on a numbering sequence that varies from software package to software package.
8. Re:Also by Anonymous Coward · 2012-02-01 17:35 · Score: 4, Insightful
  
  So... your argument is that because Mozilla failed to post the major updates with a correct increment to the major version number sometimes that it is reasonable to move to a system that always fails to increment the major version number correctly?
9. Re:Also by Kjella · 2012-02-01 18:17 · Score: 2
  
  I think that works well for the kernel, which isn't actually a end-user visible system, plus it's a cumulative system where you can expect that if you have a kernel bigger than x.y.z then all is well. For GUI software I'd very much recommend a "redesign.features.patch" pattern where
  "redesign" means we've moved things around, no guarantees about anything
  "features" means we may have added some menu items, expanded some dialogs and such, but if you knew how to use the old functionality you should still be able to do it
  "patch" will only change bugs, not the interface
  For example taking away the status bar I think qualified for a 4.0 release. This functionality used to be here, now it's not and if you want it look elsewhere. Many of the other changes seem lesser, some you practically don't notice. Perhaps you should keep a separate plugin interface version number, I don't know. From the user side it just looks a bit random.
  
  --
  Live today, because you never know what tomorrow brings
10. Re:Also by Anonymous Coward · 2012-02-01 19:01 · Score: 0
  
  "You're right that in a large deployment setting this is a problem; this is why the ESR was created."
  Not "a problem", a death sentence. Perhaps commuted, but still a death sentence.
11. Re:Also by Lennie · 2012-02-02 00:26 · Score: 1
  
  I think you got that wrong.
  It still is true.
  There was a 9.0.1 or something of Firefox it fixed a few things that causes problems for some people.
  It just is, they want to push out new features to users more rapidly/regularly.
  So you'll mostly see Firefox 10, Firefox 11 and so on.
  
  --
  New things are always on the horizon
12. Re:Also by Drinking+Bleach · 2012-02-02 04:53 · Score: 1
  
  Past failures aside, what is it that you consider a "major" version anyway? Mozilla is now rolling out updates on a regular basis, all of which consist of some rather significant changes to the browser albeit most of them are never user-visible. These updates are rather tiny and smaller than what historic 2-years-between-releases updates have been, but are you seriously expecting 2 years of work every 6 weeks?
  Would you rather have every release to be prefixed with a useless "4." at the beginning of it? When would they upgrade it to 5.x? After a year, after 4.9, what? All the other options just put an arbitrary useless number at the beginning of it, much like how every Linux 2.6.x was major; even in the current Linux 3.x series, every release is major, the "3." is still a rather useless number, though possibly to be incremented to 4.x in about 10 years (4th decade of development). I just don't understand what you really are expecting other than peace-of-mind in old and faulty expectations of versioning systems.
13. Re:Also by SockPuppetOfTheWeek · 2012-02-02 05:10 · Score: 1
  
  The car analogy is any one of the dozens of models of car which underwent little-to-no change from year to year for long periods of time and then abruptly introduced a fancy new feature that requires completely different knowledge, perhaps even completely different tools, to work on. Mechanics constantly have to figure out problems such as "when was whiz-bang-zip introduced? is a '97 model going have it?"
  I don't hear them moaning and bitching about it.
14. Re:Also by tibit · 2012-02-02 06:36 · Score: 1
  
  They basically went to "full-hack" mode where nothing is off-limits, and that's what they call "releases". If an add-on or extension breaks -- tough luck. :(
  
  --
  A successful API design takes a mixture of software design and pedagogy.
Re:And FF10 also makes addons compatible by defaul by claar · 2012-02-01 09:44 · Score: 4, Informative

Actually, there are links to two bugzilla issues in that link of yours that explain how they intend to do it (I won't link them here so /. doesn't drive bugzilla down).
It appears they intend to create a Windows service that runs as Administrator that will perform the updates, thus bypassing UAC.

--
I'd give my right arm to be ambidextrous...
Re:And FF10 also makes addons compatible by defaul by ferongr · 2012-02-01 09:48 · Score: 5, Informative

The Maintenance Service does not run at startup, but only when Firefox itself instructs it to do. It's installed with Startup type set to "Manual".
Seriously, before you whine at least take the time to read the damn bug.
Re:And FF10 also makes addons compatible by defaul by Grishnakh · 2012-02-01 09:50 · Score: 0

Are they going to make a RMS Firefox too?
Great, FF 9.x has been unstable as heck! by HouseOfMisterE · 2012-02-01 09:50 · Score: 1

I have never had problems with Firefox's stability until version 9 was released, and this damb thing crashes on me several times a day. It's real bad on my 64-bit Windows 7 Pro machine, and crashes occasionally on my 32-bit Windows 7 Pro laptop. I really hope that they have fixed whatever is causing this.
Whatever by MonsterTrimble · 2012-02-01 09:55 · Score: 1

*looks at the slashdot article on Opera 11.60*

So good for them...

--
I call it 'The Aristocrats'
Re:And FF10 also makes addons compatible by defaul by viperidaenz · 2012-02-01 10:13 · Score: 1

So they can offer support to the 0 enterprises using Firefox as their browser?
Re:Wow thats a lot of bugs fixed in this version by ColdWetDog · 2012-02-01 10:18 · Score: 5, Funny

Where is the list of bugs introduced with this upgrade?
In the "What's New" Section of Firefox 11.

--
Faster! Faster! Faster would be better!
They broke add-on compatability by Animats · 2012-02-01 10:19 · Score: 1

At least for one of my add-ons, they broke compatibility. That one shows "Not available for Firefox 10.0". Mozilla announced "All add-ons will be made compatible by default in the upcoming Firefox 10 release", but it didn't work.
(The add-on works fine under Firefox 10. It's Mozilla's download/upgrade/update/approve system, "AMO", that's broken. I have some of the same add-ons for both Firefox and Google Chrome, and the Google Chrome store system works much better than Mozilla's. This reflects Mozilla's focus on the browser being in control, rather than being a slave to the "cloud". Firefox updating and their "AMO" try to slave their browser to their servers. Mozilla isn't very good at that.)
1. Re:They broke add-on compatability by Destructo-Bot · 2012-02-01 10:26 · Score: 2
  
  For some reason the FF10 update completely removed ADBLOCK+ from my PC. Even reinstalling the plugin doesn't get it to show up. It's not in the list as "incompatible", it's just gone. Weird.
Re:And FF10 also makes addons compatible by defaul by Anonymous Coward · 2012-02-01 10:21 · Score: 0

Oh, but the bug reports do. Apparently they're going to "work around" UAC by running yet another background updater. Just what I need. Another background updater running at startup, slowing Windows boot, just to "work around" Windows security.
You mean just like how Chrome does it for a non-user install?
Too late by billybob_jcv · 2012-02-01 11:36 · Score: 1

I went to Chrome when FF decided to become IE.
1. Re:Too late by Ash-Fox · 2012-02-02 03:12 · Score: 1
  
  I went to Chrome when FF decided to become IE.
  Explain.
  
  --
  Change is certain; progress is not obligatory.
Get off the roller coaster.. by iridium213 · 2012-02-01 11:57 · Score: 2

Just use Firefox 3.6.26 (http://www.mozilla.org/en-US/firefox/all-older.html) until Firefox and Mozilla figure out what the hell is going on and stop the insanity..
1. Re:Get off the roller coaster.. by Ash-Fox · 2012-02-02 03:10 · Score: 1
  
  Just use Firefox 3.6.26 (http://www.mozilla.org/en-US/firefox/all-older.html) until Firefox and Mozilla figure out what the hell is going on and stop the insanity..
  What insanity? I upgraded to 10 and it works fine?
  
  --
  Change is certain; progress is not obligatory.
Version Wars of the 90s by EmagGeek · 2012-02-01 12:03 · Score: 1

This reminds me of the Linux version wars of the 90s... bigger version number MUST mean better software... right...
Re:And FF10 also makes addons compatible by defaul by elashish14 · 2012-02-01 12:30 · Score: 1

Enough of this praise for Firefox, that was sooo 14 versions ago

--
I have left slashdot and am now on Soylent News. FUCK YOU DICE.
10? I just got 13a by chromaexcursion · 2012-02-01 12:32 · Score: 1

Those of us on the Nightly channel got 13a today. 10? I got that a few months ago. Nightly still seems to be the only easy way to get a 64 bit build.
Re:And FF10 also makes addons compatible by defaul by Anonymous Coward · 2012-02-01 14:22 · Score: 0

Wouldn't we rather just have the UAC prompt?
Things missing from 10 ESR for web developers by Anonymous Coward · 2012-02-01 16:27 · Score: 0

that will be here within a couple versions, but those choosing not to update because of the ESR will miss out on:
3D view of pages - for anyone that has struggled to with figuring out what should be visible in nested layers.
Responsiveness indicator - by setting the about:config pref nglayout.debug.paint_flashing to true.
built-in style editor - so the right-click -> Inspect item is now immediately more useful.
Javascript debugger with better info on finding errors within js libraries like jquery, and integrated into the built-in source editor.
Websockets has been unprefixed
Hell, I say skip Firefox 10 and get Aurora right now!
Re:And FF10 also makes addons compatible by defaul by bill_mcgonigle · 2012-02-01 17:18 · Score: 1

Somehow, the idea of "working around" security features built into the OS sounds like a horrible idea to me.
If they were proposing running a daemon on Linux to work around the Unix permissions model, I'd agree with you.
But they don't have to do that on Linux because the distros provide an update mechanism, which updates firefox. Or the apps can provide their own repository, and the OS infrastructure will handle the updates (e.g. Adobe updates my Flash for me via yum).
Supposedly Windows 8 will finally have this. They're calling it an app store, I think.

--
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
1403 issues resolved by bill_mcgonigle · 2012-02-01 17:23 · Score: 2

From their release page, I count 1403 issues resolved for this release.
That's a hell of an engineering effort for a six-week release. Kudos, Firefox devs.

--
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
Version numbers gone by bill_mcgonigle · 2012-02-01 17:25 · Score: 2

Major version numbers should be for major features, not for bug fixes.
For better or worse, Firefox doesn't use versions numbers anymore. They're only numbering releases now - versioning is gone.
I personally like version numbers, but we can't complain about Firefox doing version numbers wrong when they're not longer using version numbers.

--
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
Re: should be a story on abandoning Firefox by Phoinix · 2012-02-01 17:29 · Score: 0

It became a hassle to have to deal with addon incompatibility that I removed it when they updated to version 8. Opera works much better on mobile platforms anyway. On my PC I stopped updating it for the addon issues too. I had to hack the addons every time specially Aardvark, and it is a hassle when you have it on several PCs including coworkers and friends. The story should be how many people are planning to leave or left Firefox for Chrome, Opera or other browsers due to the annoying version issue...
Xbox by mykos · 2012-02-01 18:30 · Score: 1

Microsoft has a habit of doing this. They skipped 359 numbers going from their first console to their second.
Higher version number not always better by Anonymous Coward · 2012-02-01 20:30 · Score: 0

There is little use of these higher version numbers, if the whole framework is a bit flawed. Lots of media-oriented websites use Microsoft-based streaming techniques (e.g. Italian RAI) and in Linux one needs Mono Moonlight. But the last Firefox version supporting Moonlight is 4.0.1. So I can download and introduce myself with Firefox 10, but the real working version is still FF = 4.0.1 . By the way, similar arguments are also valid for Fedora - since Gnome 3 is completely inacceptable, the last usable Fedora version is 14 (now some months without updates).
Re:And FF10 also makes addons compatible by defaul by Anonymous Coward · 2012-02-01 21:13 · Score: 0

Yes I saw the "addons compatible by default" so I chose to try it, the first box appears saying "scrapbook plus is not compatible" and I backed off. FF is really getting large slow and irritating, and basically I will apply updates only if they make incompatible addons a bug that MUST be fixed before "shipping".
Re:And FF10 also makes addons compatible by defaul by Waccoon · 2012-02-01 23:37 · Score: 1

I think having software that automatically runs as admin is the problem.
Re:Wow thats a lot of bugs fixed in this version by Anonymous Coward · 2012-02-02 00:23 · Score: 0

I think I'm going to keep my current FF version and wait until FF 20 comes out. In a couple of months.
Seriously, I had started the process of using FF as my primary browser until these frequent updates started. Each update breaks a handful of add-ons that I have, most notably the password manager that I use. I'm more attached to my password manager (which always works with IE) than I am to FF.
how did this bug get into FF9 in the first place.. by dr_blurb · 2012-02-02 01:18 · Score: 1

Alright, it's in there:
"696020 onkeypress attribute on no longer gets events happening on the window"
How did that bug get introduced into Firefox 9 anyway?
How many sites process key events? Tens of thousands, hundreds of thousands?
Wonderful of course that this update simply gets pushed to users. For my puzzle site, and others like this Italian crosswords site this meant dealing with lots of complaints from users, and no information on what was causing the problem.
Now on to test with Firefox 10... (and of course I have to leave in the special case code for FF9)
Re:And FF10 also makes addons compatible by defaul by tenco · 2012-02-02 03:02 · Score: 1

(...) basically I will apply updates only if they make incompatible addons a bug that MUST be fixed before "shipping".
Simple: just use iceweasel with via debian distributed addons.
Re:how did this bug get into FF9 in the first plac by LeadSongDog · 2012-02-02 04:22 · Score: 1

How did that bug get introduced into Firefox 9 anyway?
Someone on the interwebs typed it?

--
Oh, I'm sorry sir, I thought you were referring to me, Mr. Wensleydale.
How come no one mentions Seamonkey? by Rexdude · 2012-02-02 05:18 · Score: 1

Seamonkey uses the same code as Firefox/Thunderbird for rendering the browser/mail functions, and provides a pretty suite experience (pun intended). They've been forced to keep up with FF's faster release schedule, but they do the sensible thing and only increment minor version numbers.
So the latest version of SM corresponding to FF 10 is 2.7.
Seamonkey is aimed at power users and is the successor of Netscape 4 and the Mozilla Suite, for those who miss the idea of a single 'internet suite. It comes with a browser, email/news/RSS client, HTML editor and Chatzilla for IRC.
There are many features built in that would otherwise require separate extensions on Firefox - for eg - 3rd party image blocking, mouse wheel behavior customization, a sidebar for searching and HTTP pipelining options.
There's a 'Data Manager' that lets you customize preferences for cookies,stored form data/passwords and other privacy options on a per site basis.
Most of the popular FF extensions have been ported over to it, and running SM with the mail/news component consumes less RAM than running FF and Thunderbird together. It also works with Firefox Sync, so you can keep bookmarks synchronized between different installations (or even between FF and SM if you use both).
I use the 'Classic default' skin that has the old Netscape style icons for nostalgia's sake.
I primarily use a HP netbook with 1 GB RAM and an Atom processor - and memory usage for SM, while moderate, is still lower than FF from what I've observed.
It's a pretty good browser suite and they don't dick around with the UI, so I'm surprised to see no one talks about it on Slashdot.

--
"..One hosts to look them up, one DNS to find them, and in the darkness BIND them."
ah... by Anonymous Coward · 2012-02-02 06:03 · Score: 0

Every RPG fan knows that Firefox 9 is the best
ah... by Anonymous Coward · 2012-02-02 06:14 · Score: 0

Every RPG fan knows that Firefox 7 is the best
Re:And FF10 also makes addons compatible by defaul by tibit · 2012-02-02 06:29 · Score: 1

That updater could be, for all I care, a 50 kilobyte winapi application written in pure C. Its startup overhead would be negligible (a single disk read). Now if they intend the updater to be something that pulls in tens of meabytes of crap just to load and go to sleep, then that's another story...

--
A successful API design takes a mixture of software design and pedagogy.
Re:And FF10 also makes addons compatible by defaul by treeves · 2012-02-03 06:34 · Score: 1

"FF11 will remove the UAC prompt on Windows, which will be a further improvement in 6 weeks from now."
And FF13 will install Linux on a new partition and reboot the computer using the new OS.

--
...the future crusty old bastards are already drinking the Kool-Aid.
Re:how did this bug get into FF9 in the first plac by Anonymous Coward · 2012-02-06 01:31 · Score: 0

huh...I don't appear to have any problem with getting window.onkeypress events in FF 9/10...