Slashdot Mirror


User: k98sven

k98sven's activity in the archive.

Stories
0
Comments
1,267
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 1,267

  1. Wow! Actual DNA sequences! on New Science Museum - Now With Real Science! · · Score: 1

    Um... sorry, but how interesting is that?

    There are 3 billion base pairs in the human genome.. any sequence short enough to be bearable for someone to look at without getting bored is going to be in there somewere.

    Oh look at that.. in a normal person it's ATGTAAGTATAGCCTAGACTA and in the mutant it's
    ATGTAAGCATAGCCTAGACTA.. how interesting!

    Not really.. And I'm not saying biochem isn't fun, but looking at sequences, real or otherwise is about as boring as watching paint dry.

  2. Re:Attempt at an answer on "Missing Link" In Windows Emulation Unveiled? · · Score: 2, Informative

    Well receiving stolen property is illegal, so I wouldn't be too sure.

    It's hard to be sure when you don't know what you're talking about. The equating of copyright infringment with theft is something which is done in RIAA press releases. It has nothing to do with legal reality.

    "Intellectual property" is not property in the legal sense. It is not governed by property laws.

    Patents, trade secrets, trademarks and copyrights, (which constitute what is commonly known as 'IP') are all governed by their own respective laws and international conventions.

  3. Attempt at an answer on "Missing Link" In Windows Emulation Unveiled? · · Score: 4, Interesting

    If the codebase was stolen in the US, looked at in the phillipines and a program written based on that looking, would the program be legal in the US or not?

    Well, for one, looking at a stolen codebase is not in itself illegal. Copying it is, so whoever gave them a copy has committed a crime. But that's beside the point.

    The question is: Is the program itself a derivative work?
    By looking at the codebase, it does make it more difficult to claim this, but it doesn't automatically make it a derivative work either. In the same way as reading a book and then writing your own on the same issue does not automatically make it plagiarized.

    Ok, so this issue notwithstanding, "legal in the US" is a strange term. Legal how?

    Redistribution?
    If it is an illegal derivative work, then they have no right to distribute it, and thus noone can have the right to redistribute it either. Redistribution is illegal.

    To own and use?
    Well, with the possible exception of breaking a Microsoft EULA (the enforcability of which is questionable), the mere possession of a plagiarized work is NOT illegal.
    (Although a cunning lawyer may argument that using it could be, since by running a program you are indeed copying it (to memory). But I doubt that'll fly in the real world.)

    As for the USA:s DMCA laws. This is clearly not a copyright-circumvention device. None of that applies here.

    IANALBITSCH
    (I am not a lawyer, but I've taken some courses, haha.)

  4. Oh come on.. stop worrying already. on JPEG Patent Could Impact The Gimp · · Score: 5, Insightful

    Number one: Noone seems to think this patent is applicable, we've been over this already. The JPEG group says (in diplomatic terms) that they have prior art.

    Number two: What is to be gained by going after the Gimp? Want to becoming the next SCO? Only there is even less money in the Gimp than in Linux.

  5. Re:My parents used to do this on Shifting From P2P To Stream Ripping · · Score: 1

    or go really high tech and get a fm transmitter!

    AFAIK, there are portable MP3 players that actually do have low-powered FM transmitters for the exact purpose of being able to listen in your car without any cables or adapters.

  6. Re:More infighting? on XOrg Foundation Opens Membership and Elections · · Score: 1

    Consider the dozens of distributions, forks, and delays caused by a licence not being "free enough."

    To begin with, you're playing down the issue here. Many or even most linux distribution refuse to carry
    XFree86 under the new license. Not because it's not 'free enough', but because they see it as difficult and/or impractical to be compliant with it.

    I suppose your clients also want to have software which is well-known and well-supported? Well, then you should also be concerned about the consequences of XFree86s license switch.

    Apart from downplaying the issue, you have to realize that this license issue is only the latest in many disputes over the management of XFree86.

    Nobody likes fragmentation. But the XFree86 group has had this coming for a long time.

    The end result is that one fork is rapidly going to take it's place as the #1 implementation of X11R6, and once that has happened, we will all be better off.

    And apart from all that, I don't see any of this having much impact on users. The protocol is the same, no matter which implementation you run. The implementations are compatible. User-impact is small for everything except device-drivers.

  7. Re:The thing that makes it obviously a scam... on 419er Lost in Space · · Score: 1

    I think it's just wonderful! They're actually trying to get people to belive that they can spend $15 million on back pay, but can't afford to bring the guy back, although THAT allegedly costs only $3 million!

  8. Re:picture of disc on Sony Develops 25 GB Paper Disc · · Score: 1

    Just to put the analogies into scale:
    A paper mill roll has about a kilometer of paper on it, and is usually about 4 meters wide.

    Storing 25Gb on it would mean over 5000 bits per square centimeter!

    So, even a piece of paper that big would still need to be a heck of a lot more dense than a punchcard!

  9. Re:Of course the question that comes to mind is... on Sony Develops 25 GB Paper Disc · · Score: 4, Informative

    exactly how long will this paper last before it starts decomposing in some way?

    Paper doesn't really decompose unless it's subjected to bacteria, air, water, dirt and stuff.
    High quality paper, such as wood-free paper doesn't even yellow much in sunlight.
    (Wood-free? You say.. that's paper which is 100% cellulose, with no lignin in it.. lignin is the stuff that separates trees from plants.. without lignin, it's not wood, hence 'wood-free' paper.)

    In a good environment (as one could expect for this kind of purpose) paper should have a far greater life-span than any hard drive I've ever owned.
    (and I've held on to some of mine for quite some time)

  10. Re:Threats Alone on Contractors to Bear Burden if SCO Chases AU Govt · · Score: 2, Insightful

    It is truely quite amazing how far a good (by good I mean good at his/her job) lawyer can get on threats alone. I am really quite in awe.

    Just remember: You can fool some people all the time, and all the people some of the time, but you can not fool all the people all the time.

    SCO has managed to fool some of the people. But their time has started to run out.

  11. Re:Obligatory "not GPL" rant on Microsoft WiX Code Released to SourceForge.Net · · Score: 5, Insightful
    This license reads more like the BSD license, with all its "the code is out for everybody to grab and hide" kefussles.

    Not true.
    From the CPL version 1.0:

    A Contributor may choose to distribute the Program in object code form under its own license agreement, provided that:

    [..]
    iv) states that source code for the Program is available from such Contributor, and informs licensees how to obtain it in a reasonable manner on or through a medium customarily used for software exchange.


    The CPL is a 'copyleft' license, just like the GPL. The main point of difference is that the CPL has a software-patent protection clause, which the GPL does not.

    (However, Eben Moglen has indicated that this may be included in the next version of the GPL, which would make it compatible)
  12. Re:Linux Changelog Email Publishing on Linux 2.6.5 is Released · · Score: 2, Funny

    I make many thousand dollars a year filtering spam for other people and building new systems to house bigger and better spam filters.

    Perhaps you should send out some e-mails advertising your services. :-)

  13. Re:I am a trained professional... on Death by Coffee? · · Score: 1

    Well, your story isn't very uncommon.. It's how addiction works.

    There are plenty of heroin junkies out there who routinely take doses which would be lethal to most non-users.

    And by the same analogy: that this does not mean you're not harming your body, or that that kind of doses are safe.

  14. Re:Depends on how much you weigh.. on Death by Coffee? · · Score: 1

    That means the lowest lethal dose reported in the literature was 192 mg of caffine per 1 kilogram of weight of the victim.

    Actually, I don't think that the human LDLO value being the exact same (192 mg/kg) as the rat LD-50 is a coincidence.

    It seems to me more likely that they took the rat LD50 as a low estimate instead.
    There are probably too few cases of caffine fatalities in humans to get a good LD50 number.

    With rats being so much smaller, they should be more sensitive even accounting for the body weight, so taking that as a low estimate seems to make good sense.

  15. Easy one: Maybe! on Death by Coffee? · · Score: 3, Informative

    A cup of coffee has about 150 mg of caffeine in it.
    Hence, 100 cups of coffee is about 10-15 grams of pure caffeine.

    The lethal dose varies.. different people react diffferently. That's why there are LD50's.. which is the value which statistically kills half the subjects. (or, you could view that as a 50%/50% chance)

    The LD50 for caffeine in rats (orally) is 192 mg/(kg body mass)..

    A typical male human weighs about 80 kg.. 15 grams of caffeine divided by that is 187 mg/kg.

    So, yes that amount of caffine can definitely kill someone. I wouldn't take my chances.

  16. Re:Just hope they don't do it in Switzerland, too. on Political Pop-ups, and Follow the Money · · Score: 1

    Hey! Some of us do try to follow the Swiss referendums.

    How did that one on the carrier-pigeons back in 1996 end?

    I kind of forgot to follow-up that one.

  17. Re:"hazards and risks are poorly understood" on Buckyballs Kill Fish · · Score: 1

    That actually depends on what you mean by 'quantum effects'.

    All of chemistry is really a quantum effect. The aromatic property of buckyballs is a typical quantum effect.
    (the carbon electrons are delocalized across the entire molecule)

    Why they can work well as oxidants/reductants, if you add or subtract an electron, the charge will be distributed over the whole giant molecule, making it a very stable ion.

  18. Re:"hazards and risks are poorly understood" on Buckyballs Kill Fish · · Score: 1

    The question is, are the buckyballs being consumed in the process, or are they acting as catalytic agents?

    Probably both.. 'Steal' an electron here.. donate it there.. going back to the starting point and busting two molecules in the process. Biological systems are too complex to know.. that's why these kinds of studies are needed.

    I'm thinking buckyballs have to be consumed at some point

    That they probably are. But it's hard to say where.. Saying the 'physics are wierd' at that scale is a bit of hand-waving. What it's about is that we basically have this unusually big molecule. Other big molecules like DNA and proteins have been studied.. we know how they act. But this is a big aromatic (fatty) ring-structure thing.

    It's definitely NOT capable of being broken down by the enzymes in our bodies. They're usually fine-tuned to a particular molecule, buckyballs won't fit. There are little things called lysosomes and peroxisomes in the cell for breaking down stuff.. But I'm not certain if they'd work on buckys either.

    But I wouldn't worry about another CFC fiasco. We haven't seen any industrial use of buckyballs in a big scale yet. And before there is, the environmental risks will be known. Believe it or not, the chem industry has learned (however slowly), to take environmental issues seriously.

  19. Note the previous run! on Boolean Logic : George Boole's The Laws of Thought · · Score: 1

    0800 - Arctan started
    1000 - Arctan stopped

    arctan(1.2700) = 0.9037847025 (actual value 0.9037846992)

    You've got to appreciate that.. 2 hours of work on a huge machine gave 5 decimals of precision. Today, any pocket calculator can do that in milliseconds!

  20. Re:George Mason on George Mason University Speech Accent Archive · · Score: 1

    Not to mention being the only founding father who was uncompromising in his stance against slavery.

    "Every master of slaves is born a petty tyrant."

    A deeply underrated man.

  21. Making hay out of straw-men on The Web Won't Topple Tyranny · · Score: 4, Interesting

    I don't get this guy.. He's pointing out that he visited an internet cafe in Laos, and despite its existence, their oppressive regime still stands!

    How strange. Or?

    Most people in Laos can't afford to go to an internet cafe and read the censored news - or possibly gain access to the uncensored ones. How could it possibly make a difference?

    The internet is a medium, not a means. You need to have an organized opposition to effect change. You need support. You need a lot of things other than just the means of communication.

    Instead, he should be looking at the places were these kinds of things are in place. Such as Iran. And you will also see the use of the internet. And these places are progressing*.

    (*Although I'll be the first to admit to the recent setbacks in Iran. But on the other hand, the Ayatollahs wouldn't be acting if they weren't threated, would they?)

  22. Re:What's wrong with Firefox? on Firefox Extension Lets You Pick the Name · · Score: 1

    Sorry, but I just have no sympathy. I find the only thing more difficult than a Nordic language to pronounce is a Slavic one. I mean really, how many consonants can one string together in one word.

    I don't think you know what you're talking about. Scandinavian languages have the same vowel-to-consonant ratio as english. (about 1:2)
    Or were you thinking about finnish? It's not a nordic language. And it's not terribly consonant-rich either. They just make more frequent uses of double-consonants to mark short and long vowel sounds. (hungarian uses accents instead)

    You're wrong about slavic languages as well. They may be lower than english, but probably by not as much as you think.

    One reason is that not all vowel sounds which are pronounced are written. The second is that on translitteration, certain consonants are approximated using several ones. Such as 'ts', 'ch' and 'sh', but they're still a single consonant sound.

    If you want a language that really doesn't have many vowels, and which is actually prounounced without vowels. Check out Georgian. (not the southern accent, the central-asian language)

    "gvbrdgvnis" is a real georgian phrase. And yes, it is actually pronounced without "filling in" the vowels.
    (it apparently means 'he is tearing us apart')

  23. Re:Let's have a little poll. on Testing Relativity · · Score: 2, Insightful
    As an avid physics buff, you should know better.

    It's not a question of "String theory vs. Relativity". String theory is -designed- to postdict (opposite of predict) relativity and quantum physics as limiting cases.

    In the same way relativity postdicts Newton's theory of gravity, or how quantum mechanics gives classical mech as a limiting case.

    So the alternatives here are really:

    Relativity is disproved but not String theory

    Relativity -and- String theory are disproved

    Or the most likely outcome:

    a result which is inconclusive and doesn't disprove either theory.

  24. Huh? on Why You Should Choose MS Office Over OO.org · · Score: 2, Informative

    Apparently the "Open office" trademark is owned by the "E-mail incorporated corporation of California", and has been classed as 'dead' since 1993.

    Interestingly enough, the Openoffice.org trademark is also dead since last year, being considered "Abandoned: Applicant failed to respond to an Office action.".
    Sun owns this trademark.. what are they up to?

  25. A friendly tip.. on Why You Should Choose MS Office Over OO.org · · Score: 1

    By removing the trailing part in the link, including your search terms, like this
    you get the cache without the search terms highlighted.