Slashdot Mirror
New Science Museum - Now With Real Science!
OpenYourEyes writes "There is a new
science museum, run by the National
Academy of Science, that has opened in DC. So what? Unklike many
museums which simplify their message or use fake data, the exhibits at
the Koshland Science
Museum are all based on real research, real reports, and real
science. Each one contains references to the research reports and
data they are based on. Exhibits on
DNA, for example, use actual (and long!) DNA sequences to help
illustrate how DNA plays a role in disease, agriculture, and
criminology. There are also exhibits on
Global Climate Change and
The Wonders of Science."
I have to wonder why we have SCIENCE museums that are based on anything else...
The Cafeteria includes things like "Bill Nye The Science Rie" sandwhiches.
Finally! I've long outgrown the simplified explanations of the Boston Museum of Science (though it's still a lot of fun to visit) and the various science-related exhibits touring places like the Museum of Natural History in NY. Definitely putting this one down on my list of places to visit. Just because we're not in middle school anymore doesn't mean we lost that same curiosity...
--- "Many of the truths we cling to depend greatly on our own point of view." ~ Ben Kenobi, 'Return of the Jedi'
Unklike many museums which simplify their message
I doubt they do this because they want to, think about it.. joe average would much rather see flashy presentations than boring old research papers. It's sad but true.. and museums have to do this in order to bring people in..
*sniff*, my first /. read of the day (at home sick) and it happens to be the story which you used your Once-Per-Day post in. It's a sign from beyond...
Well I didn't RTFA but I thought I would contribute this little bit...
How's about they stop trying to aim the entire museum [art, science, history] to 8 yr olds? I mean sure it's good to get kids into it but an entire museum that is just "ooh look, some teletubby speaking about physics!" is just pathetic and annoying.
Look, adults have money, kids don't. You want to make money for museum address the money.
As for art museums... STOP BUYING TRASH OF NO VALUE! Just cuz he has a goatee and a french cabaret doesn't mean he's an artist.
Tom
Someday, I'll have a real sig.
April 23rd on Talk of the Nation, Ira Flato spoke to Peter Schultz, the Exhibits and Public Programs Director.
Here's the obligatory link
rumor has it the museum used to be a large pr0n studio, so there are plenty of DNA real-world samples throughout the place. if it falls on the floor, don't eat it.
Most people don't have interest in what's real and actual data. They want it condensed into a 5 minute visit to an exhibit. That condenstation often requires simplifying. Look at any blockbuster movie that has science in it. It's the same thing.
No, we're not laughing. Thanks for coming out though! Give blood and vote Republican! God Bless America.
Isn't the governments position that global warming doesn't exist? That will be interesting, I live in a semi-artic area of Minnesota and I have noticed that it is much warmer now then it was when I was a kid. I remember many mornings waiting out for the bus when it was twenty+ below zero, and now we only see it that cold on alternating years, what gives?
I do have to admit that it got unusually cold for a few days this winter. It was difficult to even get my cigarette lit the day it was 35 below, I give props to the old Toyota though, it started just fine!
Like arts? Like cheesy little Indie mags? Check out www.artwerkmag.com, and don't laugh at the bad coding please.
Good work!
Mod parent up!
Not again...
I'm in the hole of the broadband donut.
I think this is a great idea! [Random_idea] Maybe even have an area dedicated to bleeding edge reports. Change the exhibit every month to keep the subject changing. [/Random_idea] However, I would also hope that they track the validity of such reports. It would suck to have such a valiant effort towards showing REAL science when the report used is falsified. (The guy who falsisfied reports and wasn't exposed until he was up for a nobel nomination is an example that comes to mind. Popular guy to use reports off of, but later proved false.)
I can't wait to see there exhibit on nuclear power, that'd be cool!
Mod +5 Drunk
As a big fan of the St. Louis Science Center, I don't what's wrong with simplifying science for exhibits, especially when they're aimed at kids. I hear alot on Slashdot how America is being dumbed down and losing it's focus on science and industry. If science museums, while maybe slightly flawed, keep kids interested in science and help them gravitate towards science and engineering, what's the problem?
ce n'est pas un Sig.
Which science museums FAKE their data?
(I can understand simplifying it, but outright faking it?)
"I'm not a procrastinator, I'm temporally challenged"
I know. The snow used to be a lot deeper. When I was a 5 year old, snowbanks sometimes came up to the top of my head. Years later, it is hard to find snowbanks much more than knee-deep.
Don't blame Durga. I voted for Centauri.
I do wish that we would spread these pieces all over the US. Right now, we place all the biggest meusums in D.C or Virginia. That means with one clean hit, all gone. Also, many ppl never make it to Washington (nor have a desire to go there), so they never get to see these treasures.
I prefer the "u" in honour as it seems to be missing these days.
Also a lot of fun was the History of Science Museum in Florence.
Here's what I do: Bitty Browser & Andromeda
So many museums have pretty diagrams showing "facts" but not much of the thinking that shows how we discovered and got to those facts (or conclusions or theories as the case may be).
Science is not facts. It's not bullets. It's not a list of terms describing a cross section of the earth. It's problem solving, experimentation, cross examination, peer review, drawing conclusions, making inferences, designing experiements . . . it encompasses higher thought processes than memorization of facts. Why don't most of the museums make an effort to show this?
...would require attendees actually assist in lab experiments or participate in double-blinded medical studies. We simply can't allow a bunch of snot-nosed posers to sit on the sidelines!
No, it'll just be hidden behind the creationism exhibit, by executive order...
Nope. There will be people like Michael Moore and Al Gore warming the exhibit room with their hot air in order to create a to-scale model of the Earth. Ingenious.
I found your post amusing. I consider this /. story to be yet another -1, Troll. I used to work for a science museum. Never ran into any false stuff. If simplification is a crime then it should be reserved for *research institutions*. Science museums, on the other hand, serve only the casual public. Because of the obvious non sequitur and the red flag of "unlike other science museums...", I hope this thread has a quick death.
Laws are for people with no friends.
I'm set to announce a Math museum based on real math. My first exhibit: a video on the calculation of pi. All of it. And none of this 22/7 crap or 3.14 stuff.
If I had something intelligent to say, I would have said it.
good things don't end with eum. They end with mania. Or teria!
Van Gogh, Gaugin, Toulouse-Lautrec, Whistler, Matisse - they were all considered "TRASH OF NO VALUE!" at some time in their career. Good thing the Dr. Gachets of the world don't listen to your ilk. Art is art, science is science. Leave money out of it, it has nothing to do with value.
Everyone will start to cheer when you put on your sailin' shoes.
So, what would you consider evidence of global warming?
I mean, I assume you don't dispute that the global average temperature has been increasing over the past few decades. So would you say that climatologists haven't proven that this is outside the bounds of normal climate variation? If so, what sort of evidence would satisfy you in this regard? Can you offer any data to show that this trend isn't significant?
Of course many do, but the Rochester Museum and Science Center has some of the best hands-on exibits I've seen -- not just a token few but a whole couple a halls. I think you have to simplify to plant ideas in minds that are unable to grasp abstract concepts yet. Like dharma seeds I guess!
You only use 2% of your DNA
here's some "empirical evidence of global warming": http://www.giss.nasa.gov/data/update/gistemp/ and here's more: http://www.gsfc.nasa.gov/topstory/2004/0315skintem p.html
Maybe they will have an Exhibit on network technology and show the server load of a page linked to a slashdotting for all the inspiring network administrators to be.
Is really close! Can you feel it?
Um... sorry, but how interesting is that?
There are 3 billion base pairs in the human genome.. any sequence short enough to be bearable for someone to look at without getting bored is going to be in there somewere.
Oh look at that.. in a normal person it's ATGTAAGTATAGCCTAGACTA and in the mutant it's
ATGTAAGCATAGCCTAGACTA.. how interesting!
Not really.. And I'm not saying biochem isn't fun, but looking at sequences, real or otherwise is about as boring as watching paint dry.
Okay, so maybe it's not "a lot" of time, but it's a significant amount. What I'd like to see is "television for people with three digit IQs." The current fare is distinctly lacking in that area.
The Spoon
Updated 6/28/2011
Most non-scientists don't go to museums because they want to learn what an RNA hairpin structure is, or to read up on the latest advances in quantum physics...they go to see something cool like some tool used by cavemen or a huge ass dinosaur skeleton. They may not learn stuff like how to draw carbon bonding to oxygen, but they do come away with more knowledge they came in with. The general public is more interested in their physical experience at the museum - where they can say "wow I just saw this new painting/fish/mummy and it was really incredible" not "hey I went to XYZ museum and learned the Heisenberg Uncertainty Principle!" Maybe this type of a museum has it's place, but most likely will not draw the huge crowds that most popular museums like the Smithsonian or American Museum of Natural History do.
My life is so sad. I need to be alone now.
Without making an argument about the validity of Global Warming I would point out that there is a difference between correlation and causation. We also do not have enough statistics to make an accurate judgement. That chart looks at 140 yrs out of how many billions of years of earth history. That is like Aliens landing in the middle of Australia and determining that the whole earth is made up of Aborigines.
On the other hand, why must the whole exhibit be geared at the introductory level? A museum is a big place. Surely at least a little bit of room could be spared for some more sophisticated information in parallel with the simplified stuff? 10-year-old and Dad ought to be able to learn something.
(I have a similar criticism of the educational system. Why should we expect every child to 100% master the same math? Instead, set a baseline, and include varying levels of math in the same lessons. Especially as you get into Algebra and beyond, it's increasingly easy to challenge your students while making sure everyone understands the baseline, even in the exact same classroom. The myth that every student should perform 100% on every assignment is one of the worst blocks to educational reform today. We should expect children to get things wrong... because next time they try, they'll do better, and next time, they'll do better, and next time, they'll do better, etc.... and those children end up way ahead of the ones confined to just what they can do ~100% the first time... and as we've seen, 100% perfection has a habit of receding over time, instead of advancing as we need.
It's all the same fallacy, playing out over and over again, museums, schools, college, television shows, everywhere.)
One of the things that always bothers me about so many science and technology museums is all of the exhibits that are skewed by the sponsorship. One example - the Fort Worth Museum of Science & History had an exhibit on the history of computer technology that was sponsored by IBM. The exhibits went into great detail on the technical innovations introduced by IBM. But somehow, the semiconductor just appeared out of nowhere sometime around 1960! There was no mention of Texas Instruments or Fairchild Semi anywhere.
What has been will be again, what has been done will be done again; there is nothing new under the sun.-Ecclesiastes 1:9
O=C=O
I have evidence of Global Cooling. Yesterday it was 66 and today it is only 55. That is 11 degrees in just one day! We better get ready for another Ice Age. In the grand scale of the Earth the observations just a century so of data might as well be one days data. We don't know exactly what cycles the Earth goes through. Any good scientist will tell you that looking at past data and fitting a theory to it is not science.
a: carbon dioxide is increasing in the atmosphere (see the Climate Monitoring and Diagnostics Laboratory)
b: carbon dioxide absorbs infrared radiation (graph)
So an increase in CO2 should lead to an increase in temperature, which we observe. Any questions?
If you find yourself in a museum with false science and pesudoscience, start looking for the ICR/AIG/DrDino logo. Then get out of there.
The creationism exhibit looks a bit sloppy, like it only took six days to design and make.
Mod parent up!
The passive pages in the climate section were excellent. They found exactly the right words to express complex situations in clear, simple language, without skewing the importance in either direction. If you actually understand the situation you will understand how very carefully the words were chosen. Excellent job.
I tried one of their FLASH applets, though, and it was silly.
mt
S.F. reference - "Cycle of Fire" by Hal Clement. A primitive alien wants to better himself and his race, and gets the chance to freely study while associating with humans, with the sad realization that the new knowledge will be wiped before he's returned to his people.
*** SPOILER ***
But he was clever - while all knowledge was wiped, he managed to hang onto *the scientific method*, so he and his race could accelerate progress in the future.
The living have better things to do than to continue hating the dead.
None of that is real science. It is a lot of theories backed into data without actually testing anything. I could just as easily say that the higher population creates more body heat which we would expect to increase the temperature which we observe. Therefore the problem is people and we must kill half the population.
Please tell me there's an exhibit on evolution.
I'm a writer, a poet, a genius, I know it. I don't buy software, I grow it.
There goes your funding! Bush doesn't believe in climate change, or that kooky science thing for that matter.
Since when has this country used intellectual elite as a pejorative term?
damnit... I spelled his name wrong, it's Flatow :)
ok, let's go back 1000 years and then look at some model results. (graph in the middle of the page, the IPCC site is slow at the moment)
True, but on the grand scale of me, or a city, or a civilization, 140 years is quite a long time. And applying theories to data (and data to theories) is what science is all about). If you're doing historical science you can make a prediction about what you expect to see in data obtained from the past. Do you not believe in geology?
would be to have a museum of all things that can run Linux.
I have honestly seen old documentaries about global cooling. If you look at the past few million years the earth has always either been warming or cooling. Congratulations to all the scientists that proved it's currently getting hotter. Now tell me why we should all change our lives for something that has been happening off and on since before humans even existed. That said, less pollution is always a good thing, but enough with the scare tactics.
Personally, I'd like to see an exhibit that makes use of a black rubber sheet and heavy colored balls. The balls represent masses, and the rubber sheet represents spacetime.
I saw something like it briefly in the background on a video in high-school AP Physics class, but I've never seen it in a museum or even as the focus for a scene in a video.
tasks(723) drafts(105) languages(484) examples(29106)
Yes, question: therefore does the increased carbon dioxide in the atmosphere cause Global Climate Change? Be careful how you answer that. If you look at the historical record, increases in temperature PRECEDED the increase in CO2 levels. This is due to CO2 being released into the atmosphere from the oceans as they are warmed. Most likely temperature fluctuations are related to increased solar activity.
The purpose of art is not representation or narration. The purpose of art is to call into being, and then to show you, something outside of historical, empirical, or scientific fact that has not been seen before. I do not use the word 'seen' in the visual sense (and nor is art necessarily auditory, or tactile, etc., either), but 'seen' in the conceptual sense. Art is about showing you something new, something that history, science, or empiricism can't show you. Art is like an ever-growing canon of conceptual poetics that is meant to be encountered and contextualized, and will therefore enrich the body of your schema; it is not there to be understood as mundanely representative or interpretive.
You have just implied that you only have an interest in being shown things that can be grounded in historical, scientific, or empirical fact or in some kind of narrative or interpretive perspective. Thus, you do not like 'art' anyway, so naturally you won't any subset of works of art that others can name. But don't try to take 'art' away from everyone else, simply because you're too narrow-minded to enjoy it. Indeed, western society funds art because the bulk of the populace have decided that it is something that they value; I doubt this will change anytime soon.
STOP . AMERICA . NOW
If anybody else has suffered through the *highly* politicized "Science in American Life" exhibit at the Museum of History in DC, you know what I mean. It featured-- ... nylon stockings.
1) a intricate diorama of two (white, male) 19th century scientists arguing about who got the credit for inventing saccharine,
2) control panel for a nuclear reactor, and some of the flash-ash images from Hiroshima,
3) blamed the invention of birth control pills for the decline of the American family,
4) the ONLY use for nylon they could come up with was
Lots more in that vein. Not a single positive image of science or scientists in the whole thing. American Chemical Society paid 2 million to put that exhibit up, and were so furious with what had been done with their money they insisted their name be removed from it. Plenty of false information in *that* museum exhibit!
So solar physics, cosmology, and geology aren't science, either? (and people are the problem, but killing half of them is likely not a good solution)
I am not sure how you got to that from my conclusion. You are talking about entire disciplines not specific experiments. Give me a specific example and I will tell you whether it follows the scientific process.
This gives a whole new dimension to FIPO-ing.
Sadly we'll never know who's the winner...
Privacy is terrorism.
Big Government and big Corporate bodies lie and lie and lie. Keeping secrets is the name of the game! And who funds such extravagant projects as 'Halls of Science' and 'Museums'? When the Government will only tell you about the fighter jets it was building twenty years ago, and when Corporate America won't tell how it promotes illness through the food it sells with its Left hand, while promoting half-cures with the drugs it sells with the Right. .
Oh, yes. These power bodies are certainly not going to hold anything back when they build a public brain-washing sanctum like a museum! (Sarcasm!)
Science is about the search for truth. So then what greater hypocrisy can you find than the Government/corporate funded 'science' museum?
"But they are not telling lies!"
Oh, but they are! A lie by omission, by inference. . . The most clever of lies work in the most clever of ways. Advertisers understand; The greatest lie sold by an advertiser is that people are not affected by advertising. --And there is no division here! These are the same people who build all the museums.
While a museum may delight us with examples of apple-on-the-head science in all its many glories, the broad picture painted is one of, "Here Is What We Clever Humans Know!" --A severely limited and false picture which so many people go away feeling great comfort and self-satisfaction in believing. Brain washing!
The universe is far more amazing than your keepers want you to know. But that's okay. Nobody can keep knowledge from you if you are determined to go and find it out for yourself.
Get out of the antiseptic halls of the museum and jump into the real world beyond. As the museum brochures claim, "There is so much to see and do, you can't possibly fit it all into one day!"
-FL
yes. we can even quantify how much energy the CO2 traps (radiative forcing): 1.46 W/m^2. (Current Greenhouse Gas Concentrations) A little more than the 1 W/m^2 difference between the max and min of the 11-year solar cycle. Total change in solar radiative solar forcing since the Maunder Minimum (associated with the "little ice age") is estimated at 0.7 W/m^2
The difficult part of this process is figuring out the feedbacks between CO2, water vapor, vegetation, and clouds. And then we have to include the other things humans do to the Earth that have implications for global climate--other greenhouse gasses, aerosol emissions, deforestation, reforestation, etc. Some of these may offset or intensify CO2 induced warming. Of course, the "cure" (stabiliazation mechanisms) could be worse than the disease (a change in monsoon patterns, for instance.)
And your evidence for this ishypothesis: Increasing CO2 in the atmosphere will warm the Earth (first proposed in 1895, by Svante Arrhenius
experiment: measure temperature and carbon dioxide, wait
result> CO2 and temperature both rise
fits your definition of the scientific process, no?
are you with me brothers? lets take back the museums from the bourgeois capitalist pigs!
You can hand out a fucking B.S. when they leave the museum, because they'd spend about 4 years in there learning how to do all that shit. :P
Museums are supposed to be fun, not hard work.
It's rare that you're presented with a knob whose only two positions are Make History and Flee Your Glorious Destiny.
To me, this is clearly an example of real science that people can talk about at home. But then, I'm a science nerd myself, so I have no idea if the general public would appreciate this as much as I did. And, thinking about it, my constant talking about cloud chambers might actually be the reason why girls tend to avoid me at parties; maybe I should give the dinosaurs a shot some time :-)
Now a science museum with real science.
What's next? TV news with real news?
Sounds like America is experiencing a "back to the roots" movement!
Your "experiment" is fundamentally flawed. Back to grade school science class for you. You have no control (like another earth on which you do not raise the CO2 levels), so you have no way to tell if it was increasing heat that caused the rise in CO2 or if increasing CO2 caused rising heat or if one or more confounding variables caused the rise in one or both of the variables in question.
I firmly believe that we ought to live efficiently and that we ought to attempt to alter the atmosphere as little as possible until we really know what we're doing, but bad science and logic aren't going to do any of us any good.
There are many better reasons to worry about pollution from a variety of sources than this vague threat that the earth might warm up.
I do not have a signature
cabaret?
http://www.answersingenesis.org/museum/
They are even going to have a recreation of Methuselah's hands!
I *knew* the rolling ball at Boston Museum of Science couldn't really be doing all those clangs, bells, and chimes! There must have been a squirrel inside the ball to keep it moving, and a drummer at a drum set hidden behind the back wall!
Terrorists can attack freedom, but only Congress can destroy it.
Of course we can sort out whether or not warming lagged CO2 or vice versa. We're burning a large (quantified) amount of fossil fuels. We also have an idea how much CO2 is moving into and out of the atmosphere through biological and geological processes. Therefore we are reasonably certain that the increasing CO2 in the atmosphere is from us. We can also (and do) look into confounding variables (clouds, solar variability, aerosols).
Global climate change research is a very tricky field of science, but it's certainly valid.
"but most likely will not draw the huge crowds"
So?
Uhhh, have you taken your pills? The little yellow ones?
...Buffalo Springfields threads in background...
Relating increasing temperature to the rise in CO2 isn't a single experiment, it's large part of an entire field of study, called climatology. Many arguments used to refute the findings of climatology (non-repeatability and long time scales, for instance) can be applied to the other fields I mentioned.
To refute your rising population=more body heat=warmer Earth hypothesis, I can figure out how much heat the human body puts out, multiply by the number of people (6.0E9) and divide by the surface area of the Earth (2.90E16m^2, if I did my math right) and conclude that they have a negligible effect compared to other heat sources (like the Sun).
I can also quantify the amount of additional heat trapped by anthropogenic CO2 in the atmosphere (1.46 W/m^2) and conclude that it doesn have an effect.
Done good, Rob! Excellent use of, well, science.
There is nothing wrong with yr Internet. Do not attempt to adjust the picture. We are controlling the transmission - NSA
During my last visit to the Exploratorium (about 5 years ago), I remember seeing a display in which they had (behind a "closed casket" I guess so as not to scare little children) a complete human skeleton. In prominent letters it stated clearly that women have one pair less of ribs than men.
I'm not sure what medical textbook they are using, but I hope that my doctor doesn't use it.
I boycott the museum whenever I can since
The first exhibit to go in should be this one, entitled "Electron Band Structure In Germanium, My Ass."
The Right Reverend K. Reid Wightman,
How favorably, I'm left to wonder, is this science center compared to the one that's practically in my back yard? I've been meaning to get there in the last five years that I've been living in Hudson County, NJ. An old geek friend I used to work with recommended it highly, stating emphatically to "bring your inner child" to this place.
My geek friend, was not a scientist, by the way. But she did tell me about a rather fascinating fact. It'd been a childhood dream of mine to attend spacecamp (having been inspired by the schocky movie of the same name). And, yeah, I had the hotts for Lea Thompson! (hey, whaddya want? I was an 80's kid!). So, I wanted to go. It's my fave type of vacation...a learning vacation! BUT when I called, I was 16 years old. I was told (rather rudely, btw) that 15 was the cutoff age! NO SOUP FOR YOU!!! I was crestfallen.
But I was very glad when Camille (my geek friend's name) told me that SpaceCamp now has adult programs that you can attend either with or without the kids in tow. It tends to attract brighter than average, professional adults, I'm told. Once I learned that, this venture DEFINITELY made my adult "to-do list".
Has anyone had experience with either of these learning programs, or insights to offer? I would love to know how complete and erudite either/both are. I see from the website, that SpaceCamp now has an "advanced" spacecamp for the returning adult! (seemingly!) TOO COOL!
Quod scripsi, scripsi.
Some suggestions have already been posted but what science museum is worth taking a trip to a city just to see?
I grew up in Toronto and the Ontario Science Center was a favourite haunt.
Sadly I now live in Vancouver with only the pathetic Science World and the ungodfully overpriced Space Museuem.
If you don't want to repeat the past, stop living in it.
well on this page of thiers http://www.koshland-science-museum.org/background/ volunteer.jsp
They suggest that you volenteer if you have
"Sincere interest and/or background in science".
So apparently they don't care wether you have sincere interest or not as long as you have a background in science.
> Unklike many museums which simplify their message
> or use fake data
Unk like free hookers and coke even better.
Give Unk a cookie.
-I like my women like I like my tea: green-
These arguments are made without looking at known ecological effects. The ecological disaster in the Mediterranean Sea caused by common algae (Caulerpa taxifolia) from aquariums could not have happened ten years ago. The subtle difference in temperature of 3 degrees was enough to allow a tropical plant thrive and now dominate.
The issue where these conditions are man-made or not is also a valid one. How much is caused by fluorocarbons and how much from changes in the earth's magnetic field. We only have measurements going back 300 years, in that period the earth's magnetic field has decreased by 10% as part of a natural changes at the core. How much it has actually decreased is unknown as is how much of the atmosphere has eroded because of this.
Natural causes does not mean no cause for concern.
Well thats fine, I doubt anyone can dispute global warming (I never did). What I doubt is human involvement in any of it. Would anyone like to look at sun output charts over the past few year, rather informing (can't find data chart, but it has been increasing in the past few years). My only wish is that people would consider that global warming can exist without human involvement.
It's corporate sponsorships. Nothing worse than a bunch of exhibits that have been designed to embellish Lockheed Martin, Microsoft, et al.'s image. And you have to pay for your ticket, on top of that..
Do you see my point?
Perhaps not. That much brain mass requires a spine strong enough to support it. Irony is not a dish for the weak.
-FL
Ha ha. Yeah, I did write a little over-extravagantly. But that doesn't do anything to diminish my point.
I hope you are not the sort who thinks that a little ridicule will make uncomfortable ideas go away. It doesn't work that way, I'm afraid. Wish it did!
-FL
Holy crap! It's the ghost of Charles Forte!
/.!
:)
I KNEW he would hang around on
I'm honored to meet your acquaintance, Mr. Forte's Ghost. I've got a first edition of Lo! around here somewhere, maybe you can corporealize enough to sign it?
They're not merely chunks of rock -- they're imaginary chunks of rock!
Whence? Hence. Whither? Thither.
Due to the fact that glaciers are retreating.
What these "pure scientists" apparently forgot to mention was that glaciers do not sit still. They either advance, or retreat.
There is a technical term for a period of time in which a glacier does not retreat; its called an ice age.
We are not currently in an ice age. Ergo, glaciers are going to be retreating.
(And these exhibits are always showing pictures of the glacier in 1890, and then 1910, 1930, 1950, etc. etc. etc. Why don't they show us pictures (or, obviously, projections) of what they looked like in 1850, 1810, 1750, 1680, and the likes? Even the most crazed enviro-nut doesn't think humans were influencing global temperatures in the 18th century. So why is it that the glacier isn't in the same place in 1850 as it was in 1650? Could it be that we're out of an ice age now, and the glacier is backing up as its supposed to?)
So? So if you can't get enough people to go to the museum, that museum probably won't be sustainable for very long. Either that or make it pretty expensive to go to the museum, which is a surefire way to turn away potential patrons/customers.
I was actually just put on the spot half an hour ago in such a ridiculous manner that my head is still spinning. (A so-called friend asking for help in ways I am not entirely sure were friendly.) I'm sitting here trying to work out how to deal with this puzzle without betraying a loyalty and while not playing the chump. Your point that questions are a subtle form of command is quite timely, and indeed, illuminating! Thanks!
It strikes me that no matter how clever or skilled one becomes, in Life there will always be found puzzles which provide tests specifically tailored to challenge at one's relevant skill level.
Cheers!
-FL