"Linux makes it so easy to create a supercomputer.""
In an unrelated happening,1000 Slashdot readers were found dead today in their homes, having choked on their ego after reading a certain article...
There are no pirates.They are not downloading songs. We are not violating their privacy or doing anything remotely illegal to try to scare them. There is no non-pirated music- it was all burned.
So basically all that really means is whatever parts of the space elevator we make out of nanotubes will have to be coated in a light-refracting and/or absorbing substance?
"Paint" would not,I think, suffice Still,it doesn't sound too overly complicated.
Everyone knows God's creation sits at the center of the Universe and it is the universe that rotates! Foul heatens deny it but they have been blinded by Satan!
ggcacatcgacgatcgtacgtagcgcattatatttttcgatatcgtgcta gtcgtacgtatcgatgctgatgctagctagtcgatgctagtgctacgtag agtacgcatctcgatcgtagtgatctagctagctagtcgtgctagtcagc ttcgatgctagctaggcagtagcatctcgtagcacggattcgatgctagc tacgcatcgatgatcgatagtcgctcgctagatgatcgagcagcagctag a
If you burn this to a cd,send a check for 20$ to DNA,po box 23234,california
Maybe the lowering of global temperature this caused led the bacteria to evolve into more advanced life forms to survive?Maybe it made *possible* the developpment of plants,and the bacterias decided "Hey cool we could become that!Let's do so"
I know its nowhere as near as siple as that,but just my 2 cents
Removing the only reason NOT to vote?
That'd be encouraging morons to vote,which can't possibly be good!Seriously,how hard is it o drive down to a building every 4 years to push a friggin button?
Slashdot Mirror
"Linux makes it so easy to create a supercomputer."" In an unrelated happening,1000 Slashdot readers were found dead today in their homes, having choked on their ego after reading a certain article...
Interesting to see geeks fight back
FP (?)
There are no pirates.They are not downloading songs. We are not violating their privacy or doing anything remotely illegal to try to scare them. There is no non-pirated music- it was all burned.
So basically all that really means is whatever parts of the space elevator we make out of nanotubes will have to be coated in a light-refracting and/or absorbing substance?
"Paint" would not,I think, suffice
Still,it doesn't sound too overly complicated.
Yes,I've heard of houses in Africa being built by benevolate workgroup using that materiel.Seemed sturdy enough,and its mighty cheap.
Everyone knows God's creation sits at the center of the Universe and it is the universe that rotates! Foul heatens deny it but they have been blinded by Satan!
3,500 times faster than a typical home broadband connection.
Yummy,porn 3500 times faster!
A beowulf cluster of those swarms.
Ooooh.
or sharks with 10 to 20 times more effient lasers on them!
I could say the same thing of Americans,with 9/11....cept it would be deathbeds..
me.Women weep and children cry when I go by already,no need for a stinkin' costume.
ggcacatcgacgatcgtacgtagcgcattatatttttcgatatcgtgcta gtcgtacgtatcgatgctgatgctagctagtcgatgctagtgctacgtag agtacgcatctcgatcgtagtgatctagctagctagtcgtgctagtcagc ttcgatgctagctaggcagtagcatctcgtagcacggattcgatgctagc tacgcatcgatgatcgatagtcgctcgctagatgatcgagcagcagctag a
If you burn this to a cd,send a check for 20$ to DNA,po box 23234,california
It's Linguo. Homer:"Linguo..dead?" Linguo:"Linguo IS dead!"
Wouldnt that be *photons*? They allow to see and perceive the world around us. Protons just keep the electrons in orbit.....
Mind-numbing "news"....
I assume that by "good" you mean "so horribly deformed,twisted and crushed you wont be able to remember it's orginial" In that case,sure....
You get Haxx0rs who give themselves a "5 byte discount" by injecting a virus into it to get everything free.
Maybe the lowering of global temperature this caused led the bacteria to evolve into more advanced life forms to survive?Maybe it made *possible* the developpment of plants,and the bacterias decided "Hey cool we could become that!Let's do so" I know its nowhere as near as siple as that,but just my 2 cents
Removing the only reason NOT to vote? That'd be encouraging morons to vote,which can't possibly be good!Seriously,how hard is it o drive down to a building every 4 years to push a friggin button?
It's all a big joke anyways,I'm sure you must have found that out by now...
of taxpayer money,"Flying out the window"....
they keep going,and going,and going....
I don't know where you live but if you're being force-fed 6-year old music against your will,i'd write your local congressman.
"Credit card approval maybe take up to 60 seconds" "Aww......"
until it can allow h@x0r5 and non-"l33t"s to communicate?