he correct answer, said rudely, still isn't right.
Um... please help me understand this one. Does this mean if you say a truth meanly, it's not true? I think you need to clarify that it is the rudeness, not the factuality, which is in question. The ambiguity of the English language leaves too much room for such things, and often just gets people mad at each other.
Uhh, it's a fuel cell, not combustion, so using heat of combustion doesn't make much sense.
My educated guess is that it's more desirable to strip hydrogen off methanol than ethanol to get hydrogen for the fuel cell operation than ethanol. (Desirable here could be cost, package size, efficiency, whatever - I'm no expert.) I do know that you get *slightly* more hydrogen per mass of ethanol (6/46 vs 4/32) than you do per mass of methanol - so i'm not sure. But, methanol is easier to vaporize, might have different corrosion properties...*shrug*
This is all entirely speculation, but it sure sounds like I know about the topic on which I'm speaking.
I think we ought to worry about how to care for naturally-procreated population first, rather than add to it the "unnatural" (in quotes on purpose) population growth due to cloning.
Also, do we really need to give ourselves another reason for discrimination?
I agree with you that there are many more important issues to discuss on this matter than the ones people seem to bring up.
I have to say - WTF? Who do I write to about this? What the heck are they patenting? The article doesn't really say much.
If they are patenting "hey I figured out what strand GCACTCTGATCTGTCTATATGTGT does" it's garbage.
If, however, they figured out what sequence of nucleotides happens to build a molecular machine that does X (where X is something new) then a patent might be arguable. The *might* comes from the fact that I think they should patent the molecular machine, not the method of making it. After all, DNA is kind of like a programming language - it's a tool set for building molecular machines. You can't patent blueprints or schematics, so why would you be able to patent DNA? (I can't recall if blueprints are copyrightable though - I know that typically blueprints, etc. have a disclaimer that says "you can't build this without permission from the company that generated it" because the value is in *using* the blueprint, not having it. Usually. I'm sure there are caveats.
On the flip side of this, if demand was not as strong as it was, don't you think Apple Computer, Inc. would drop the price? You can't blame a company for a price when that price is selling in super-high volumes. Blame the consumers who are willing to pay that much. That's how supply and demand works.
"I don't blame the sports stars for their obscene salaries, I blame the fans."
Ah, I know this is asking for retribution, but I can't resist:
"per gallon of gas they produce more pollution...They produce WAY less pollution per gallong than a car..."
I assume you meant to say "..WAY less pollution per mile..", not gallon.
Re:I don't see what's wrong here
on
Who Owns The Facts?
·
· Score: 2, Insightful
I happen to agree with this guy to some extent. This law, contrary to what my fellow/.'ers seem to think, is not about the content of the database at all - it is simply about the database. I think the interpretation is you can't use the database as a free source of information and then resell the same information. It doesn't seem to say anything about using the information in other proudcts, et cetera.
Granted, I agree that laws should be written to be far less vague (as this one does indeed leave a lot of room - "to be decided by the courts" and such). They should have to be written so they are *cough* specific and measurable. But that's a side argument.
I guess the point of all this is, if you don't like the way laws are written, become a politician. If you don't like the way they're enforced, become a lawyer. You could also always build, from the ground up, a new worldwide network that isn't the Internet and so would be exempt from all the laws applying to the Internet...
<cynical> My Database of Math: I now own everything!
0+n = n
1*n = n </cynical>
Well, you're right that it's about trust, but I'm not sure in the sense you indicate. 'Security', in my book, is simply preventing someone from doing something you don't want them to be able to do. There are two flavors of this; one relies on trust and the other does not. The trust one is, "hey, please only do the things I tell you you can do." The other is, "I'm going to throw up a bunch of walls and if you try something I didn't explicitly allow you to do, I'm gonna beat you with a stick."
"Security" doesn't have anything to do with anonymity or not. Think of it this way - anonymity doesn't make a bank more or less secure. You could be famous and rob a bank. What recognition gives is not preventative; it is only reactive. It allows you to go after someone after they have done something you don't want them to do.
Some would argue that this is a deterrent to "security violation" since it would be known that if you do something you're more likely to be caught. However, for those apt to try and perform a "security violtation", this just adds to the mystique, honor, whatever. Except for the truly insane, who just don't care. For most people, non-anonymity is just an annoyance because they wouldn't do anything wrong in the first place.
The question for the computing world then needs to become which stance to take. It seems the "don't do things unless I tell you it's OK" is infeasible since we know that people will do things they know aren't OK. Then the question must be what kind of walls to put up. Most "security" issues today are because the walls are insufficient, not because we can't go out and catch the people coming into the barn and stealing the chickens.
And why are the walls insufficient? Well, the fundamental problem is that usually a breach is something that is allowed to happen but by someone who shouldn't be allowed to do it. This is why people are clamoring for identity validation and all that jazz, but we are fast learning that identiy is not even sovereign in this world; at least not in a non-morally-ambiguous way (i.e., biometrics).
I must admit that I don't have answers to the questions of security, because whenever you allow people to do something, there is always a possibility that it will be abused. And in a world where (at least in the USA) people are taught more and more that they are not responsible for their actions (if this were not the case, we would have far fewer lawsuits) security will not be solved by any technical means.
You make part of an interesting observation here. I work for an industry where a large portion of revenues is spent on "marketing" which includes print and other media advertising. One thing I always wonder is how much does advertising really affect purchases? Supposedly there have been studies done on this sort of thing, but I have come to realize that "there was a study done" means "we've been doing this for so long, it must be right."
What the TV advertisers should realize is that perhaps advertising doesn't really do as much as they'd think; personally, ads don't do anything for me since I already have my preferences and buy the same (brand) products anyway. An ad won't make me think, "oh, hey, maybe I'll like this product X that I thought was garbage before."
The best advertising forms are targeted, local opportunities to sample a product (not tell me about it, but let me *sample it!*) and word of mouth. I'd count ads in a magazine closer to targeted offerings, because typically magazine ads are all geared toward the magazine topic. Car magazines have ads for car-related stuff. It's closer to a web-search of the type "I like car stuff, so show me lots of car stuff so I know what's out there." Slightly different than "Hrm. you're watching show X so you must use products P and Q." Print ads (in a magazine) or on some websites are better at aligning the advertisement to the interests of the customer. If TV could do this, they'd be better off. TV advertising placement (with the exception of perhaps SpikeTV and WE or Oh! that have very specific target audiences) is much more seat-of-the-pants since when people don't pay for a commodity, you get everyone looking at it.
I'd wager that more intelligent spending of smaller amounts of advertising dollars would go much farther than more dollars spread out among a larger heterogenous customer base.
Where to begin on this one? Of course people are going to start spouting religious issues with something of this nature. Of course the average joe is going to be like, "uhh... what?" Of course some people are going to be like, "cool! I always lose my change anyway - I doubt I can lose my (body part)." There are so many really large issues with this, so many emotionally charged issues, that we should really step back and figure out what's going on.
First we must ask ourselves why people are even considering such technology? Is it convenience? Is it something else? The proponents of this technology tout things like security and convenience. The security is for those who want power - they want a way to know where the people who can threaten them are. I'm not talking about with weapons, either - I'm talking about with power, with ability. They attempt to get more mechanisms of control into society oh so subtly by making it "convenient" to do things. Think about this though - is it really faster to pay by credit card like the commercials say? They always say you need ID for checks, but I would hope to goodness they check ID with credit cards as well! So personally I think the convenience and security aspect is a farce.
The most secure financial situation, oddly enough, is a physical one - where there is actually hard currency. The reason? You actually have to posess the currency to use it. It's a whole lot more difficult to rob a safe than it is to tell a computer to move some numbers around (part of this difficulty is psychological - the rest is physical. You actually have to go somewhere and transport the currency. You have to get it, have something in which to carry it, and you have to get it to where you want it. Vastly different than computer crime - sit in a remote location, no immediate threats...you see what I'm saying, right?). Sure, with cash, you might get mugged. And if you're obscenely wealthy, you need a good place to store your cash. I think the financial gurus overlook the fact that posession is the most enforcable type of security (assuming, of course, you have a big enough stick to fend off any would-be theives).
I think the concept of sticking something unnatural in my body just to participate in commerce is fundamentally wrong, independent of my religious beliefs. Rather than just complain about this, here are some reasons:
It is segregatory: it automatically divides a population into the "priviledged" and "non-priviledge", the group who "works in the system" and those who "go against it", etc. etc. It's not like humanity needs any more reasons to focus on differences between people.
It is a "rite of passage". It may be arguable that "commerce" is an inherent right of people - if you're born, you have the ability to contribute to society and probably will get the resources and toys you want in exchange for that ability. Requiring some "entry" into this arrangement (either chip, or other form of ID) can only serve to cause more social rifts. Think about the present taboo of "illegitimate children" and how this will be exacerbated by "hey you don't have an ID chip! Why not!?!"
It objectifies people. One major problem I see today is that people forget that relationships are more important than things. The general population today is more and more selfish (I've mentioned this before) - look at all the "it's not my fault, it's theirs!" lawsuits. Look at how everyone is basically saying "let me do my thing how I want - but I'm going to tell you you can't do things how you want". When people are simply consumers and potential threats and all that jazz, we take something away from humanity.
I guess to summarize, and before I get much more too wordy with this, it seems that this is another example of being able to do something and not considering if it should be done. There are far more implications than mere ones of faith, though those may not be least important.
Somehow I feel as if all my deliberations on this have been random thinking, and I almost h
A) you can divide the distance traveled by the swallow by the time it took to travel that distance, or
B) you can use a radar gun to measure speed directly
(Especially when, if you read the article, there is mention that "wind tunnel tests" of swallows showed that their estimates were off (espeically on beat frequency). And they actually used speed measurements to validate their model. Hrm. Seems like an awful lot of work to me...)
Does anyone know what they mean by "ultrasonic motor"? As far as I know, nobody's ever been able to make a motor work off the principles of acoustic wave propagation. Do they simply mean that the motor works at high RPM (over 20kHz)? That's hardly what I think of when I think of "ultrasonic". Call me a stickler for detail, but you should only be allowed to call things "sonic" when they are acoustic waves. After all, visible light is at "ultrasonic" frequencies, too!
If high RPM is the case, I imagine that the device would generate ultrasonic acoustic waves. Which would be kind of amusing to see all kinds of canine lifeforms go nuts trying to chase these things...
I don't understand what open vs. closed source has to do with the fact that someone should be fired for not knowing how to write (or manage) code. The "openness" of the source only matters for catching errors if there are people who are looking at the code to catch errors. My assessment is that, open source or not, there was a failure in the system to adequately define and check the code.
Yes, this issue does again raise the question of "how can you trust institution X in situation Y". The choices are you either trust institution X (and, for the record, I count "the open source movement" as an institution) for data / product Z, or you do it yourself. The big trouble is, if you take this thinking seriously, you can't trust *anything* that you don't experience, and if you go really nuts you don't even trust your experience because you could live in the Matrix. I think we can all agree that's not very constructive.
If you think the voting machines need work, then you should just start your own company to make a voting machine. Offer an alternative, don't just yap about what's there.
"The only way to really ensure something gets done the way you want is to do it yourself. Assuming you don't change your mind, of course."
Now, if you happen to commute with a ton of payload every morning, or need to travel over terrain that would be inpassable by a car[1], the SUV is probably more efficient.
You have observed here something I like to call the "to be truly efficient you need to use the appropriate tool for the task" philosophy. That was why I mentioned that
The more important question is not "can we make SUVs more efficient" because they are already as efficient (if not more so) than cars but "do we really need to move things this big?"
in my original post. The problem is not so much inherent to SUVs or whatever, but in the people who use them for inappropriate reasons. Unfortunately it has been demonstrated throughout history that no amount of technology or legislation can solve that problem.
PS: regarding
[1] Unlikely, given that most sport "utility" vehicles are unstable and lack torque and handling
I'm not sure I agree with you on the "lack torque" thing
"unstable" requires an operating definition of under what conditions stability must be maintained - I can make any vehicle tip over if I have no constraints on what maneuvers through which I can put it. My problem is that people think changing the C.G. of a vehicle will eliminate tipping over, but tipping over is a function of 3 things: speed, radius of turn, and ratio of height of C.G. to the wheel spacing (okay, there is some stuff in the equation about shifting the center of mass, too, but I'm keeping things simple). If I change the height of the C.G, I can still come up with a speed and radius combination that will flip the vehicle. Which combination do we need as a safety specification? I admit that I don't know.
Basically that's a long way of saying that while I agree that cars and SUVs handle differently I don't know that means SUVs "lack handling". There's no way to make them handle the same (well, you could make cars handle *worse* of course), so (dare I say it?) until the public realizes that they have to act appropriately for a given set of conditions, they will still flip vehicles, get in wrecks, etc.
Oh, wait, didn't I already mention "appropriate action" a couple paragraphs ago?
It all depends on the mile bicycled. Is it flat, uphill, or downhill? If it's downhill, you don't burn any more calories than if you were doing nothing. Uphill and you burn a lot more. It also depends on the bike and the rider. I'm a featherweight (75 kg) so I can go a lot farther on a kilocalorie (all else being equal) than someone massing 100 kg.
That's why I don't like "miles per gallon" because while it is a measure of consumption it is NOT a measure of efficiency. Measurements would require something like "pound-miles per gallon" (or "liters per 100 kilogram-kilometers" for our metric friends) to actually compare efficiency. Interestingly enough, SUVs aren't that bad when you look at it that way. Sure moving an SUV takes more fuel, but you are moving more substance, so it may not be less efficient. (Another interesting excersize is looking at how fuel economy changes with payload - adding 6 people to an SUV barely changes its fuel economy, but adding 6 people to a compact car will most likely show a non-negligible effect).
The more important question is not "can we make SUVs more efficient" because they are already as efficient (if not more so) than cars but "do we really need to move things this big?" I think people attack based on "efficiency" because that is seen as a simpler solution.
If you read the fine print, the Nmax for the G5 was 100,000 higher than for the Linux cluster. Now, that's kind of interesting, because the G5 cluster was then only slightly slower doing a much bigger (450,000 Nmax vs 350,000 Nmax on the Xeons) problem. I wonder why they don't somehow scale the FLOPs to reflect this fact.
Anyone know how much merit there is to using Nmax (or N1/2) to compare different systems?
Umm... from what I remember of my compressible fluids course, I'm not sure any shape design can eliminate a sonic boom for a body in supersonic flow. But, since I love compressible fluid mechanics, though, if you have references on shockless flow around bodies immersed in supersonic flows, I'd love to read them!
According to the article you referenced, though, that plane only travels at Mach 0.96 or so, and won't have a shock wave (since you shouldn't have those below Mach 1.0 - there might be some exceptions with trans-sonic phenomena) and so of course you won't have a sonic boom...
I think this analogy is right on - regardless of the existence of a patent or no on the concept of a vending machine, the idea of making an "online vending machine" is (in my mind) obvious (as a natural progression of the concept of vending machine) and therefore should not be patentable. It all goes to how broadly you interpret prior art or other things in existence (after all, if patent people try to get as much as they can through broad claims, shouldn't their review be just as broad?)
"Prior Art" is not the only invalidator for a patent claim, as far as I know. I would think that, in the instance of 1-click, that should not be patentable because how is that different than purchasing something from a vending machine? All you do there is put in a coin/bill, one "click" and presto! you have your purchased item. Why is making a computer program for that patentable? I don't know but, of course, I'm not a patent lawer.
because it slows down the 'production' of the examiner; the most relevant criteria for promotion
Therein lies part of the problem, methinks. And forgive me for thinking we had quit allowing patents for perpetual motion machines, unobtainium and the like. One is entitled to hold on to naive hopes that rationality will someday surface in society, is he not?
Hrm. Perhaps, this is about a server-side scheme. However, how is it unique? Why is this patentable? I'm not arguing the fact that this is what the patent says, but how is this different than any other use of an identifier to obtain information, regardless of where the identifier is stored? (Also, the "persistent client state" the claims mention seems an awful lot like a cookie, which isn't server-side at all.)
The main argument the folks here at/. have is that these patents don't seem to have any inherent unique value, and they appear to be granted long after people have been using the technology (especially in Software Land).
That said, IP legislation and philosophies are quite a touchy matter with this crowd...and they don't even see the patents the auto industry comes up with like "A method of attaching an ingress/egress panel to a vehicle side using a hinge".
In my book this patent fails the Unobviousness test.
Using someone's "Name" to get "customized information". How is this different than using any other unique ID to pull out "custom" health records? School records? Any other "customized" data?
This patent is garbage because it describes what they want to be able to do, not a particular method of doing it, and I don't see any "improvements" that the claims seem to state. This is quite typical of the claims in a software patent. For a hardware patent, as far as I know, you must provide an implementation of the idea.
I've said it before and I say it again: write your congressmen to start a movement to reform patent law!
Benchmarks are more or less useless because they test different things. For instance, testing framerates on a game more tests the graphics card than the main processor, does it not? (Also, who the heck can even see anything over about 60 FPS anyway!?!?! Use those extra clocks for something useful like gameplay PLEASE!)
Also, the benchmarks listed here tested lots of different things for which the system configurations were different, so one could talk about the *system* performance, not the *chip* performance.
I want to see a benchmark of chip performance that uses some algorithm that can fit entirely in on-chip cache and execute, and time that. That way we can eliminate <most> system interaction effects. We can test raw computation type stuff by giving everyone the same amount (and type) of memory and having them solve the SAME math problem entirely in memory.
As for different applications on Mac and PC, well, they may serve the same function but they are not the same application because of the fact that they have different executable code. Different code means they are different, and it's unclear how proficient people are at writing equivalently performing code for different platforms - especially when typically they just port it over and tricks on one system might not be tricks on another one.
That said, I can't say one way or another on the actual relative performance of these chips. Both are aimed at different markets, different design philosophies, et cetera. The question really comes down to, which one do you want, and are you willing to pay for it?
I thought it was per engine too, but the Boeing website didn't specify. I figured I'd be conservative. After all, then the thing would be putting out somewhere around 200 MW. Incidentally, that's why jet engines are rated in thrust, not power...
Slashdot Mirror
Um... please help me understand this one. Does this mean if you say a truth meanly, it's not true? I think you need to clarify that it is the rudeness, not the factuality, which is in question. The ambiguity of the English language leaves too much room for such things, and often just gets people mad at each other.
Say what you mean, and mean what you say.
My educated guess is that it's more desirable to strip hydrogen off methanol than ethanol to get hydrogen for the fuel cell operation than ethanol. (Desirable here could be cost, package size, efficiency, whatever - I'm no expert.) I do know that you get *slightly* more hydrogen per mass of ethanol (6/46 vs 4/32) than you do per mass of methanol - so i'm not sure. But, methanol is easier to vaporize, might have different corrosion properties...*shrug*
This is all entirely speculation, but it sure sounds like I know about the topic on which I'm speaking.
Also, do we really need to give ourselves another reason for discrimination?
I agree with you that there are many more important issues to discuss on this matter than the ones people seem to bring up.
If they are patenting "hey I figured out what strand GCACTCTGATCTGTCTATATGTGT does" it's garbage.
If, however, they figured out what sequence of nucleotides happens to build a molecular machine that does X (where X is something new) then a patent might be arguable. The *might* comes from the fact that I think they should patent the molecular machine, not the method of making it. After all, DNA is kind of like a programming language - it's a tool set for building molecular machines. You can't patent blueprints or schematics, so why would you be able to patent DNA? (I can't recall if blueprints are copyrightable though - I know that typically blueprints, etc. have a disclaimer that says "you can't build this without permission from the company that generated it" because the value is in *using* the blueprint, not having it. Usually. I'm sure there are caveats.
Well, that helped me calm down a little...
"I don't blame the sports stars for their obscene salaries, I blame the fans."
Granted, I agree that laws should be written to be far less vague (as this one does indeed leave a lot of room - "to be decided by the courts" and such). They should have to be written so they are *cough* specific and measurable. But that's a side argument.
I guess the point of all this is, if you don't like the way laws are written, become a politician. If you don't like the way they're enforced, become a lawyer. You could also always build, from the ground up, a new worldwide network that isn't the Internet and so would be exempt from all the laws applying to the Internet...
<cynical>
My Database of Math: I now own everything!
0+n = n
1*n = n
</cynical>
"Security" doesn't have anything to do with anonymity or not. Think of it this way - anonymity doesn't make a bank more or less secure. You could be famous and rob a bank. What recognition gives is not preventative; it is only reactive. It allows you to go after someone after they have done something you don't want them to do.
Some would argue that this is a deterrent to "security violation" since it would be known that if you do something you're more likely to be caught. However, for those apt to try and perform a "security violtation", this just adds to the mystique, honor, whatever. Except for the truly insane, who just don't care. For most people, non-anonymity is just an annoyance because they wouldn't do anything wrong in the first place.
The question for the computing world then needs to become which stance to take. It seems the "don't do things unless I tell you it's OK" is infeasible since we know that people will do things they know aren't OK. Then the question must be what kind of walls to put up. Most "security" issues today are because the walls are insufficient, not because we can't go out and catch the people coming into the barn and stealing the chickens.
And why are the walls insufficient? Well, the fundamental problem is that usually a breach is something that is allowed to happen but by someone who shouldn't be allowed to do it. This is why people are clamoring for identity validation and all that jazz, but we are fast learning that identiy is not even sovereign in this world; at least not in a non-morally-ambiguous way (i.e., biometrics).
I must admit that I don't have answers to the questions of security, because whenever you allow people to do something, there is always a possibility that it will be abused. And in a world where (at least in the USA) people are taught more and more that they are not responsible for their actions (if this were not the case, we would have far fewer lawsuits) security will not be solved by any technical means.
What the TV advertisers should realize is that perhaps advertising doesn't really do as much as they'd think; personally, ads don't do anything for me since I already have my preferences and buy the same (brand) products anyway. An ad won't make me think, "oh, hey, maybe I'll like this product X that I thought was garbage before."
The best advertising forms are targeted, local opportunities to sample a product (not tell me about it, but let me *sample it!*) and word of mouth. I'd count ads in a magazine closer to targeted offerings, because typically magazine ads are all geared toward the magazine topic. Car magazines have ads for car-related stuff. It's closer to a web-search of the type "I like car stuff, so show me lots of car stuff so I know what's out there." Slightly different than "Hrm. you're watching show X so you must use products P and Q." Print ads (in a magazine) or on some websites are better at aligning the advertisement to the interests of the customer. If TV could do this, they'd be better off. TV advertising placement (with the exception of perhaps SpikeTV and WE or Oh! that have very specific target audiences) is much more seat-of-the-pants since when people don't pay for a commodity, you get everyone looking at it.
I'd wager that more intelligent spending of smaller amounts of advertising dollars would go much farther than more dollars spread out among a larger heterogenous customer base.
First we must ask ourselves why people are even considering such technology? Is it convenience? Is it something else? The proponents of this technology tout things like security and convenience. The security is for those who want power - they want a way to know where the people who can threaten them are. I'm not talking about with weapons, either - I'm talking about with power, with ability. They attempt to get more mechanisms of control into society oh so subtly by making it "convenient" to do things. Think about this though - is it really faster to pay by credit card like the commercials say? They always say you need ID for checks, but I would hope to goodness they check ID with credit cards as well! So personally I think the convenience and security aspect is a farce.
The most secure financial situation, oddly enough, is a physical one - where there is actually hard currency. The reason? You actually have to posess the currency to use it. It's a whole lot more difficult to rob a safe than it is to tell a computer to move some numbers around (part of this difficulty is psychological - the rest is physical. You actually have to go somewhere and transport the currency. You have to get it, have something in which to carry it, and you have to get it to where you want it. Vastly different than computer crime - sit in a remote location, no immediate threats...you see what I'm saying, right?). Sure, with cash, you might get mugged. And if you're obscenely wealthy, you need a good place to store your cash. I think the financial gurus overlook the fact that posession is the most enforcable type of security (assuming, of course, you have a big enough stick to fend off any would-be theives).
I think the concept of sticking something unnatural in my body just to participate in commerce is fundamentally wrong, independent of my religious beliefs. Rather than just complain about this, here are some reasons:
It is segregatory: it automatically divides a population into the "priviledged" and "non-priviledge", the group who "works in the system" and those who "go against it", etc. etc. It's not like humanity needs any more reasons to focus on differences between people.
It is a "rite of passage". It may be arguable that "commerce" is an inherent right of people - if you're born, you have the ability to contribute to society and probably will get the resources and toys you want in exchange for that ability. Requiring some "entry" into this arrangement (either chip, or other form of ID) can only serve to cause more social rifts. Think about the present taboo of "illegitimate children" and how this will be exacerbated by "hey you don't have an ID chip! Why not!?!"
It objectifies people. One major problem I see today is that people forget that relationships are more important than things. The general population today is more and more selfish (I've mentioned this before) - look at all the "it's not my fault, it's theirs!" lawsuits. Look at how everyone is basically saying "let me do my thing how I want - but I'm going to tell you you can't do things how you want". When people are simply consumers and potential threats and all that jazz, we take something away from humanity.
I guess to summarize, and before I get much more too wordy with this, it seems that this is another example of being able to do something and not considering if it should be done. There are far more implications than mere ones of faith, though those may not be least important.
Somehow I feel as if all my deliberations on this have been random thinking, and I almost h
A) you can divide the distance traveled by the swallow by the time it took to travel that distance, or
B) you can use a radar gun to measure speed directly
(Especially when, if you read the article, there is mention that "wind tunnel tests" of swallows showed that their estimates were off (espeically on beat frequency). And they actually used speed measurements to validate their model. Hrm. Seems like an awful lot of work to me...)
My apologies. I'm a bit cynical this morning.
If high RPM is the case, I imagine that the device would generate ultrasonic acoustic waves. Which would be kind of amusing to see all kinds of canine lifeforms go nuts trying to chase these things...
Yes, this issue does again raise the question of "how can you trust institution X in situation Y". The choices are you either trust institution X (and, for the record, I count "the open source movement" as an institution) for data / product Z, or you do it yourself. The big trouble is, if you take this thinking seriously, you can't trust *anything* that you don't experience, and if you go really nuts you don't even trust your experience because you could live in the Matrix. I think we can all agree that's not very constructive.
If you think the voting machines need work, then you should just start your own company to make a voting machine. Offer an alternative, don't just yap about what's there.
"The only way to really ensure something gets done the way you want is to do it yourself. Assuming you don't change your mind, of course."
You have observed here something I like to call the "to be truly efficient you need to use the appropriate tool for the task" philosophy. That was why I mentioned that
in my original post. The problem is not so much inherent to SUVs or whatever, but in the people who use them for inappropriate reasons. Unfortunately it has been demonstrated throughout history that no amount of technology or legislation can solve that problem.PS: regarding
That's why I don't like "miles per gallon" because while it is a measure of consumption it is NOT a measure of efficiency. Measurements would require something like "pound-miles per gallon" (or "liters per 100 kilogram-kilometers" for our metric friends) to actually compare efficiency. Interestingly enough, SUVs aren't that bad when you look at it that way. Sure moving an SUV takes more fuel, but you are moving more substance, so it may not be less efficient. (Another interesting excersize is looking at how fuel economy changes with payload - adding 6 people to an SUV barely changes its fuel economy, but adding 6 people to a compact car will most likely show a non-negligible effect).
The more important question is not "can we make SUVs more efficient" because they are already as efficient (if not more so) than cars but "do we really need to move things this big?" I think people attack based on "efficiency" because that is seen as a simpler solution.
Anyone know how much merit there is to using Nmax (or N1/2) to compare different systems?
According to the article you referenced, though, that plane only travels at Mach 0.96 or so, and won't have a shock wave (since you shouldn't have those below Mach 1.0 - there might be some exceptions with trans-sonic phenomena) and so of course you won't have a sonic boom...
I think this analogy is right on - regardless of the existence of a patent or no on the concept of a vending machine, the idea of making an "online vending machine" is (in my mind) obvious (as a natural progression of the concept of vending machine) and therefore should not be patentable. It all goes to how broadly you interpret prior art or other things in existence (after all, if patent people try to get as much as they can through broad claims, shouldn't their review be just as broad?)
"Prior Art" is not the only invalidator for a patent claim, as far as I know. I would think that, in the instance of 1-click, that should not be patentable because how is that different than purchasing something from a vending machine? All you do there is put in a coin/bill, one "click" and presto! you have your purchased item. Why is making a computer program for that patentable? I don't know but, of course, I'm not a patent lawer.
I can imagine the liability lawyers loving this one.
Therein lies part of the problem, methinks. And forgive me for thinking we had quit allowing patents for perpetual motion machines, unobtainium and the like. One is entitled to hold on to naive hopes that rationality will someday surface in society, is he not?
The main argument the folks here at /. have is that these patents don't seem to have any inherent unique value, and they appear to be granted long after people have been using the technology (especially in Software Land).
That said, IP legislation and philosophies are quite a touchy matter with this crowd...and they don't even see the patents the auto industry comes up with like "A method of attaching an ingress/egress panel to a vehicle side using a hinge".
Using someone's "Name" to get "customized information". How is this different than using any other unique ID to pull out "custom" health records? School records? Any other "customized" data?
This patent is garbage because it describes what they want to be able to do, not a particular method of doing it, and I don't see any "improvements" that the claims seem to state. This is quite typical of the claims in a software patent. For a hardware patent, as far as I know, you must provide an implementation of the idea.
I've said it before and I say it again: write your congressmen to start a movement to reform patent law!
Also, the benchmarks listed here tested lots of different things for which the system configurations were different, so one could talk about the *system* performance, not the *chip* performance.
I want to see a benchmark of chip performance that uses some algorithm that can fit entirely in on-chip cache and execute, and time that. That way we can eliminate <most> system interaction effects. We can test raw computation type stuff by giving everyone the same amount (and type) of memory and having them solve the SAME math problem entirely in memory.
As for different applications on Mac and PC, well, they may serve the same function but they are not the same application because of the fact that they have different executable code. Different code means they are different, and it's unclear how proficient people are at writing equivalently performing code for different platforms - especially when typically they just port it over and tricks on one system might not be tricks on another one.
That said, I can't say one way or another on the actual relative performance of these chips. Both are aimed at different markets, different design philosophies, et cetera. The question really comes down to, which one do you want, and are you willing to pay for it?
I thought it was per engine too, but the Boeing website didn't specify. I figured I'd be conservative. After all, then the thing would be putting out somewhere around 200 MW. Incidentally, that's why jet engines are rated in thrust, not power...