I don't think the argument of tech-savviness applies in this case. You don't have to know your tech inside-out to know that multiple charging for the same song is plain wrong. I would even say it makes even less sense to the technically less skilled why a song in RAM or on the network should to treated as a new copy which can be treated - and charged - as a unique file, because, after all, they see no way of "abusing" this fact. They would only see that they are charged several times for purely technical reasons without having any benefit from it, and they will realize this very quickly.
At least, the minority of more skilled people that understand why an.mp3 in RAM is independant of its source file can understand (not necessarily accept) the argument why they are two separate (albeit identical) instances of a piece of information. Of course, in the end it is very appropriate that this story makes/. on the date of 06/06/06.
Wow...you sure completely missed his point. Yes, they'll adapt their business models, to only produce those kind of shows that can make money even when widely pirated. His point is that this class of shows will include fewer, if any, good shows.
I'm not exactly sure he missed the point. The central expression is "good shows". "Good" by what definition? Is he worried that humankind will not see the n+1st season of 24, x years from now? Or that he won't? I just fail to see the link between countable commercial success and some ill-defined, subjective definition of "quality" if applied to entertainment. Just look at what shallow, voyeuristic crap your general-prupose, mind-wasting TV program mostly consists of today. No imaginable change could make that much worse, in my opinion. But maybe someone can tell me why shows that have been designed with ~100% piracy in mind must under any and all circumstances be worse than those today?
TV and movies are not like music, where the artists make most of their money outside of sales of the music
How very shortsighted. Is this another law written into stone, not subjectable to change? An actor's public image is determined mainly by what role(s) he plays and what he says and does in public outside of movies, and not primarily by how much money his movies make. Of course, if an actor doesn't rake in cash with his movies, he won't play in many movies, but if NO movie makes box office money (assuming ~100% piracy), then the playing field is level again. Just think of how much money is made through merchandise. Of course, merchandising does by far not work for any movie, but as a matter of fact, the most succesful movies in term of box office nowadays are all movies with lots of merchandising potential (Star Wars, Matrix, LotR, Harry Potter, Spiderman, X-Men, etc. etc.). The actor can furthermore capitalize on his/her success in various other areas involving public appearance. Think of something, I'm getting tired of laying it down.
Piracy fails the "what if everyone did it?" test.
Examples like Apple's iTunes' success (and most TV consumers' laziness, btw) show that this scenario will remain what it is today: an industry scarecrow far from reality. There are (or could be) just so many more aspects to a movie or music CD than just retail price. If you can't compete on price alone, get ahead on other aspects. It's really simple, and does not even require a fundamental change of business model. This whole war of *AA vs. The World is nothing but the industry's struggle for a price monopoly irretrievably lost to file sharing. Now it's real competition, not just the pseudo-competition of Sony Music vs. Warner Records or Paramount vs. New Line Cinema.
In conlusion: Don't paint the future so bleak, it's just not going to be as bad as you might think. Don't just take current trends and extrapolate them without boundaries, you will almost certainly overshoot. There are too many economic realities which will persist even in the remote future. To change them, a fundamental economic change would have to happen as well.
5) Slashdot sucks, because most people here don't see the immorality of file sharing, and don't see that incredibly expensive shows like 24 and Lost WON'T EXIST if they can't make money. We might actually be seeing the fall of good video programming. It may not exist in 10 years, except for amateur junk.
I see this argument popping up again and again. I can see that it's a pretty intuitive argument - if you download, you don't and won't pay to see/hear the work again - but remember that intuition and reality have always had a less-than-rock-solid relationship. Has Linux, being free and all, killed proprietary OSs, notably Windows? Has FOSS in general, or piracy, killed proprietary software? Of course not, and it won't, for the same reasons that professional entertainment won't be killed by pirating it.
The morality of downloading may or may not be a question, but I won't discuss it, because morality doesn't feed or starve anyone, which, by and large, seems to be what it's about. Besides, as we can see (not only) from the story at hand, the "other side" as represented by the *AAs of the world at least also has some issues with generally accepted morality. So it boils down to whether piracy has a significant negative net impact on sales, i.e., a significantly larger negative than positive effect, and that's what I doubt.
For example, can you cite, say, 3 examples of artists/companies/whatever which had to go out of business because of and only because of piracy? If you can cite such examples, can you show beyond reasonable doubt that the very act of downloading and obtaining the work has killed all incentive to buy the work, and not the insight that the work was of poor quality or simply not of the viewer's taste? What do you think of the positive advertising effect of pirated works? How do you explain that, according to this site, movies of the past ~3 years are over-represented (number of entries in a period divided by length of same period) in basically every box office chart, despite rapidly growing movie piracy in the same period? If you say "inflation", then did you just admit piracy doesn't even make a dent in sales? It would seem unlikely that the hypothetical sales growth *without* piracy had been offset by piracy so exactly that you can fully explain observed sales change by inflation.
So, my layman advice to record labels and movie studios: If your motivation really is to protect the artists, then drop the scare campaigns and the pillory court cases and put the money into higher-quality work, sponsoring more artists instead of fewer high-profile ones; or simply cut your moon prices for a simple and easily understandable change. If people want to have what you offer, they will generally buy it and you will sell it at a profit; the die-hard pirates will not stop pirating anyway; legislative and law enforcement branches can focus on actual crime. Thus everybody can be happy. But as long as the "piracy funds terrorism and eats babies" mindset is hammered into an increasingly criminalized society, things won't change for the better, that's for sure. I very much admire the Swedish people who are protesting against this police raid, because it shows an attitude sorely lacking, at least here in Germany.
I was fully expecting anti-terror units in all black combat suits, with shotguns pointing, flashbangs going off and stuff. But nooo. Also no ninjas cutting peoples' heads off, RoboCops or a horde of battle monkeys. All very boring scenery.
By the way, PLEASE make a/. frontpage story as soon as the Pirate Bay has a torrent of the raid video online.
Obviously, the cost-benefit-analysis, at the current state of technology, does not speak in favor of simulated gravity or the engineers would've done it already. Rocket engineers must justify every pound of mass they want to put into space (which is, by the way, an argument against manned space flight), and, while needless to say, it's just a LOT easier and cheaper to let an astronaut pee into a plastic bag and toss it out the window than designing the rocket with 2 huge rotating discs tens of meters in diameter. Ditto for all other points you mentioned.
If and when our technology has matured enough so we can start designing RAMA-style spaceships or large spacestations with permanent crews of dozens or hundreds, then this or another kind of AG will certainly be included.
Because eBay has something that can't be bought with money: "eBay" is the synonym for "online auction", just like "Google" is synonymous to "web search". That's the Holy Grail of brand recognition.
I highly doubt it. This layer of defense against privacy intrusion is less than paper-thin. If the NSA gets to decide what the NSA may or may not find "suspicious", then what's the point? Checks and Balances, kids, Checks and Balances. That's the only thing that can hope to be interesting and respectful. Get juidical approval or leave me TF alone. (I'm not American, but the point remains the same)
I've always wondered, every now and then we hear about a novel technology to use renewable energy sources, why don't these receive more funding instead of a technology that is, like traditional power plants, inherently centralized? I'm not talking about hydrogen, because it is just a storage medium, not an energy resource. I'm talkng about technologies that are potential replacements for fossil fuel because they do produce oil in some form or another. Example: Thermal Depolymerization, which can turn basically all biomass and even plastic waste into oil at high efficiency, safely removing heavy metal contamination as one side benefit. Why don't we put an end to the travesty of just dumping, burying or even burning plastic waste, all of which have various ecological impacts, instead of turning it back into crude oil? Unless room temperature superconductors are found, energy transport will always mean a significant efficiency loss, and the higher the distance from the plant to the consumer, the larger the loss. Low distances mean low loss, so why not make efforts to de-centralize power plants? I sure as hell wouldn't want to have a fusion reactor in my basement or even in my town (although they're supposedly safer than fission reactors), but where's the problem in having a large Depolymerization plant in the industrial park? Give every city which has the demand such a plant and let them produce at least part of the oil they need, with the waste they produce.
Heavy decentralization might not go well with the energy lobby for whatever reason, but what the heck, for how long will everyone keep thinking we have to prioritize business over ecology? We have those nice big brains which allow us to make assumptions about and plans for the far future, but seemingly, even those in power seem to pretend sometimes that their head is just there to seal their neck from the rain.
There was a small village in rural Germany. A broadcast tower for mobile phones was to be built there, and despite rabid protests from the locals, which were concerned about negative health impacts, the tower was built. Soon after its completion, more than the usual number of locals went to see their doctor, complaining about headaches, nausea, and various other little ailments which they linked to the tower.
The funny part? The tower hasn't even been operational.
The similarity is just too striking. Also note that, if you take the letters S-N-A-K-E and hit them with a roundhouse kick to the neck, they equal N-O-R-R-I-S. Coincidence? I think not.
Don't overestimate people. There were String-to-Integer conversions and some tricky "larger-than?" decisions involved in parsing those sentence and checking them for logical consistency.
Or would it be just another crypto Wunderwaffe suitable for more cronyism in the War on Terrer, Drugs, Boobies, et al.?
FTA: A successful login would only occur when you are able to identify your password by thinking "yes" to the letters or pictures that form it in sequence -- like a mental game of 20 questions.
Or like, I don't know, thinking of the letters and typing them on a keypad? That method sure sounds like a mental equivalent to hunt-and-peck on a keyboard without a backspace key.
And, like other posters have written before me, I believe that passwords would indeed become more simple. The very act of typing in a password is a physical activity that will fasten your password deeper into your memory, because more parts of your brain have to deal with the act, Which in turn means you can memorize stronger passwords, i.e. longer ones and not from a dictionary.
Vidal is more optimistic about a simpler form of mind reading, in which the computer provides a stimulus, then measures the brain's response. Such "event-related responses," or ERPs, to color flashes or specific sounds tend to produce brain signals that are different with each individual, but nearly identical when repeated on the same person. "ERPs could be used for biometric identification," says Vidal.
Was anyone else reminded of a certain N. Stephenson novel when reading this?
And finally, whatever can be measured with digital devices, can in principle be recreated to fool these devices. Faking brainwaves may not be as blunt as cutting off a finger and prying out an eyeball, but there's usually a way to fool the system, no? And if it's just about social engineering or cracking the layer that comes after the actual scanning device.
It's not like anybody with half a brain would want to beat you to the market with that kind of technology, or even run down your doors applying for a license. Anyone willing to bet that Phillips will bring this to the market, as the only manufacturer?
You don't know what is was like, Back In The Days. Ain't had no fancy Duke Nukem Forever announcement, nobody promising us "This decade it'll be released for sure!", and you better damn well believe we ain't had no Phantom console announced. Basically we had to make up our own vapourware! We did have the "Linux ready for Desktop next year", though. Aah, those were the days.
Widely unnoticed by the general public, which is all caught up in Peak Oil yes-or-no discussions, Uranium faces the very same problems as fossil fuels, but they seem to be worse.
From this article:In 2001 the European Commission said that at the current level of uranium consumption, known uranium resources would last 42 years. With military and secondary sources, this life span could be stretched to 72 years. Yet this rate of usage assumes that nuclear power continues to provide only a fraction of the worlds energy supply.
Now if not only China builds dozens of reactors, but the western industrialized world as well, nuclear (i.e. fission) energy stops looking to be very attractive in the long run. Give us fusion (hot or cold), or give us renewable energy as our main source, but don't try to balance two resources which are ultimately limited and might well be seeing their practical end within our century. Don't floor the gas pedal if you know you will have to stop eventually, either by slowing down yourself or by being slowed down by a concrete wall.
it's growing up. I'm not talking about the industry itself, but rather those who actually play the games
You, Sir, have never played Counter-Strike on a public server or followed a fully grown, 3-way free-for-all flame war between Playstation, XBox and Nintendo fanboys. Or did he refer to the Pacman generation?
Slashdot Mirror
I don't think the argument of tech-savviness applies in this case. You don't have to know your tech inside-out to know that multiple charging for the same song is plain wrong. I would even say it makes even less sense to the technically less skilled why a song in RAM or on the network should to treated as a new copy which can be treated - and charged - as a unique file, because, after all, they see no way of "abusing" this fact. They would only see that they are charged several times for purely technical reasons without having any benefit from it, and they will realize this very quickly.
.mp3 in RAM is independant of its source file can understand (not necessarily accept) the argument why they are two separate (albeit identical) instances of a piece of information. Of course, in the end it is very appropriate that this story makes /. on the date of 06/06/06.
At least, the minority of more skilled people that understand why an
Wow...you sure completely missed his point. Yes, they'll adapt their business models, to only produce those kind of shows that can make money even when widely pirated. His point is that this class of shows will include fewer, if any, good shows.
I'm not exactly sure he missed the point. The central expression is "good shows". "Good" by what definition? Is he worried that humankind will not see the n+1st season of 24, x years from now? Or that he won't? I just fail to see the link between countable commercial success and some ill-defined, subjective definition of "quality" if applied to entertainment. Just look at what shallow, voyeuristic crap your general-prupose, mind-wasting TV program mostly consists of today. No imaginable change could make that much worse, in my opinion. But maybe someone can tell me why shows that have been designed with ~100% piracy in mind must under any and all circumstances be worse than those today?
TV and movies are not like music, where the artists make most of their money outside of sales of the music
How very shortsighted. Is this another law written into stone, not subjectable to change? An actor's public image is determined mainly by what role(s) he plays and what he says and does in public outside of movies, and not primarily by how much money his movies make. Of course, if an actor doesn't rake in cash with his movies, he won't play in many movies, but if NO movie makes box office money (assuming ~100% piracy), then the playing field is level again. Just think of how much money is made through merchandise. Of course, merchandising does by far not work for any movie, but as a matter of fact, the most succesful movies in term of box office nowadays are all movies with lots of merchandising potential (Star Wars, Matrix, LotR, Harry Potter, Spiderman, X-Men, etc. etc.). The actor can furthermore capitalize on his/her success in various other areas involving public appearance. Think of something, I'm getting tired of laying it down.
Piracy fails the "what if everyone did it?" test.
Examples like Apple's iTunes' success (and most TV consumers' laziness, btw) show that this scenario will remain what it is today: an industry scarecrow far from reality. There are (or could be) just so many more aspects to a movie or music CD than just retail price. If you can't compete on price alone, get ahead on other aspects. It's really simple, and does not even require a fundamental change of business model. This whole war of *AA vs. The World is nothing but the industry's struggle for a price monopoly irretrievably lost to file sharing. Now it's real competition, not just the pseudo-competition of Sony Music vs. Warner Records or Paramount vs. New Line Cinema.
In conlusion: Don't paint the future so bleak, it's just not going to be as bad as you might think. Don't just take current trends and extrapolate them without boundaries, you will almost certainly overshoot. There are too many economic realities which will persist even in the remote future. To change them, a fundamental economic change would have to happen as well.
5) Slashdot sucks, because most people here don't see the immorality of file sharing, and don't see that incredibly expensive shows like 24 and Lost WON'T EXIST if they can't make money. We might actually be seeing the fall of good video programming. It may not exist in 10 years, except for amateur junk.
I see this argument popping up again and again. I can see that it's a pretty intuitive argument - if you download, you don't and won't pay to see/hear the work again - but remember that intuition and reality have always had a less-than-rock-solid relationship. Has Linux, being free and all, killed proprietary OSs, notably Windows? Has FOSS in general, or piracy, killed proprietary software? Of course not, and it won't, for the same reasons that professional entertainment won't be killed by pirating it.
The morality of downloading may or may not be a question, but I won't discuss it, because morality doesn't feed or starve anyone, which, by and large, seems to be what it's about. Besides, as we can see (not only) from the story at hand, the "other side" as represented by the *AAs of the world at least also has some issues with generally accepted morality. So it boils down to whether piracy has a significant negative net impact on sales, i.e., a significantly larger negative than positive effect, and that's what I doubt.
For example, can you cite, say, 3 examples of artists/companies/whatever which had to go out of business because of and only because of piracy? If you can cite such examples, can you show beyond reasonable doubt that the very act of downloading and obtaining the work has killed all incentive to buy the work, and not the insight that the work was of poor quality or simply not of the viewer's taste? What do you think of the positive advertising effect of pirated works? How do you explain that, according to this site, movies of the past ~3 years are over-represented (number of entries in a period divided by length of same period) in basically every box office chart, despite rapidly growing movie piracy in the same period? If you say "inflation", then did you just admit piracy doesn't even make a dent in sales? It would seem unlikely that the hypothetical sales growth *without* piracy had been offset by piracy so exactly that you can fully explain observed sales change by inflation.
So, my layman advice to record labels and movie studios: If your motivation really is to protect the artists, then drop the scare campaigns and the pillory court cases and put the money into higher-quality work, sponsoring more artists instead of fewer high-profile ones; or simply cut your moon prices for a simple and easily understandable change. If people want to have what you offer, they will generally buy it and you will sell it at a profit; the die-hard pirates will not stop pirating anyway; legislative and law enforcement branches can focus on actual crime. Thus everybody can be happy. But as long as the "piracy funds terrorism and eats babies" mindset is hammered into an increasingly criminalized society, things won't change for the better, that's for sure. I very much admire the Swedish people who are protesting against this police raid, because it shows an attitude sorely lacking, at least here in Germany.
I was fully expecting anti-terror units in all black combat suits, with shotguns pointing, flashbangs going off and stuff. But nooo. Also no ninjas cutting peoples' heads off, RoboCops or a horde of battle monkeys. All very boring scenery.
/. frontpage story as soon as the Pirate Bay has a torrent of the raid video online.
By the way, PLEASE make a
Obviously, the cost-benefit-analysis, at the current state of technology, does not speak in favor of simulated gravity or the engineers would've done it already. Rocket engineers must justify every pound of mass they want to put into space (which is, by the way, an argument against manned space flight), and, while needless to say, it's just a LOT easier and cheaper to let an astronaut pee into a plastic bag and toss it out the window than designing the rocket with 2 huge rotating discs tens of meters in diameter. Ditto for all other points you mentioned.
If and when our technology has matured enough so we can start designing RAMA-style spaceships or large spacestations with permanent crews of dozens or hundreds, then this or another kind of AG will certainly be included.
Because eBay has something that can't be bought with money: "eBay" is the synonym for "online auction", just like "Google" is synonymous to "web search". That's the Holy Grail of brand recognition.
Like, they can TOTALLY FLIP OUT and WRITE GAMES?
I for one dig that.
I highly doubt it. This layer of defense against privacy intrusion is less than paper-thin. If the NSA gets to decide what the NSA may or may not find "suspicious", then what's the point? Checks and Balances, kids, Checks and Balances. That's the only thing that can hope to be interesting and respectful. Get juidical approval or leave me TF alone. (I'm not American, but the point remains the same)
ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
Pong
"Everything tastes more or less like chicken."
I've always wondered, every now and then we hear about a novel technology to use renewable energy sources, why don't these receive more funding instead of a technology that is, like traditional power plants, inherently centralized? I'm not talking about hydrogen, because it is just a storage medium, not an energy resource. I'm talkng about technologies that are potential replacements for fossil fuel because they do produce oil in some form or another.
Example: Thermal Depolymerization, which can turn basically all biomass and even plastic waste into oil at high efficiency, safely removing heavy metal contamination as one side benefit. Why don't we put an end to the travesty of just dumping, burying or even burning plastic waste, all of which have various ecological impacts, instead of turning it back into crude oil? Unless room temperature superconductors are found, energy transport will always mean a significant efficiency loss, and the higher the distance from the plant to the consumer, the larger the loss. Low distances mean low loss, so why not make efforts to de-centralize power plants? I sure as hell wouldn't want to have a fusion reactor in my basement or even in my town (although they're supposedly safer than fission reactors), but where's the problem in having a large Depolymerization plant in the industrial park? Give every city which has the demand such a plant and let them produce at least part of the oil they need, with the waste they produce.
Heavy decentralization might not go well with the energy lobby for whatever reason, but what the heck, for how long will everyone keep thinking we have to prioritize business over ecology? We have those nice big brains which allow us to make assumptions about and plans for the far future, but seemingly, even those in power seem to pretend sometimes that their head is just there to seal their neck from the rain.
Oh, and next Friday... is Hawaiian shirt day... so, you know, if you want to you can go ahead and wear a Hawaiian shirt and jeans.
*embarrassed silence*
There was a small village in rural Germany. A broadcast tower for mobile phones was to be built there, and despite rabid protests from the locals, which were concerned about negative health impacts, the tower was built. Soon after its completion, more than the usual number of locals went to see their doctor, complaining about headaches, nausea, and various other little ailments which they linked to the tower.
The funny part? The tower hasn't even been operational.
Chuck Norris, 'natch.
Snake
Norris
The similarity is just too striking. Also note that, if you take the letters S-N-A-K-E and hit them with a roundhouse kick to the neck, they equal N-O-R-R-I-S. Coincidence? I think not.
Don't overestimate people. There were String-to-Integer conversions and some tricky "larger-than?" decisions involved in parsing those sentence and checking them for logical consistency.
"here's your parts, go fo it."
Need clarification. Was that supposed to mean "go for it" or "go foo it"?
Or would it be just another crypto Wunderwaffe suitable for more cronyism in the War on Terrer, Drugs, Boobies, et al.?
FTA:
A successful login would only occur when you are able to identify your password by thinking "yes" to the letters or pictures that form it in sequence -- like a mental game of 20 questions.
Or like, I don't know, thinking of the letters and typing them on a keypad? That method sure sounds like a mental equivalent to hunt-and-peck on a keyboard without a backspace key.
And, like other posters have written before me, I believe that passwords would indeed become more simple. The very act of typing in a password is a physical activity that will fasten your password deeper into your memory, because more parts of your brain have to deal with the act, Which in turn means you can memorize stronger passwords, i.e. longer ones and not from a dictionary.
Vidal is more optimistic about a simpler form of mind reading, in which the computer provides a stimulus, then measures the brain's response. Such "event-related responses," or ERPs, to color flashes or specific sounds tend to produce brain signals that are different with each individual, but nearly identical when repeated on the same person. "ERPs could be used for biometric identification," says Vidal.
Was anyone else reminded of a certain N. Stephenson novel when reading this?
And finally, whatever can be measured with digital devices, can in principle be recreated to fool these devices. Faking brainwaves may not be as blunt as cutting off a finger and prying out an eyeball, but there's usually a way to fool the system, no? And if it's just about social engineering or cracking the layer that comes after the actual scanning device.
Like in, "I, for one, welcome our new hippo overlords"?
:)
Oooh, you surely meant "hypocrisy"
It's not like anybody with half a brain would want to beat you to the market with that kind of technology, or even run down your doors applying for a license. Anyone willing to bet that Phillips will bring this to the market, as the only manufacturer?
one acronym
You don't know what is was like, Back In The Days. Ain't had no fancy Duke Nukem Forever announcement, nobody promising us "This decade it'll be released for sure!", and you better damn well believe we ain't had no Phantom console announced. Basically we had to make up our own vapourware! We did have the "Linux ready for Desktop next year", though. Aah, those were the days.
There you go.
Widely unnoticed by the general public, which is all caught up in Peak Oil yes-or-no discussions, Uranium faces the very same problems as fossil fuels, but they seem to be worse.
_ history/historical_ux.php(flash required for the small graphic, but the numbers are there in plain text)
From this article: In 2001 the European Commission said that at the current level of uranium consumption, known uranium resources would last 42 years. With military and secondary sources, this life span could be stretched to 72 years. Yet this rate of usage assumes that nuclear power continues to provide only a fraction of the worlds energy supply.
And here is the actual development of Uranium price over the last century:
http://www.uranium.info/prices/monthly.html (note that the peak around '78 about coincides with the peak of the US and Soviet nuclear arsenal during the Cold War)
And here you have, again, the development of Uranium prices over the past 4 years:http://www.cameco.com/investor_relations/ux
Now if not only China builds dozens of reactors, but the western industrialized world as well, nuclear (i.e. fission) energy stops looking to be very attractive in the long run. Give us fusion (hot or cold), or give us renewable energy as our main source, but don't try to balance two resources which are ultimately limited and might well be seeing their practical end within our century. Don't floor the gas pedal if you know you will have to stop eventually, either by slowing down yourself or by being slowed down by a concrete wall.
it's growing up. I'm not talking about the industry itself, but rather those who actually play the games
You, Sir, have never played Counter-Strike on a public server or followed a fully grown, 3-way free-for-all flame war between Playstation, XBox and Nintendo fanboys. Or did he refer to the Pacman generation?