Slashdot Mirror

It's open source and then some. You'll be able to pick it up from the NIH and a number of other places, on government tabs no less.

Good luck compiling it though.

By the way, here's a more official press release.

Do you work for a big pharm company?

No, and I have never had any sort of connection with any of them. I'm a programmer affiliated with the med school of a very large private university, doing computational biology (I was a molecular bio major). I do not work on anything remotely AIDS-related, nor does the group I'm in receive any AIDS-related funding, but quite a few other scientists here do.

(Actually, my university does make some money off AIDS therapies developed here too, but this pisses off a lot us anyway. It doesn't indicate ulterior motives, because like most universities they try to commercialize anything they can, and AIDS research is only a small part of that.)

even though you don't provide any evidence that Duesberg believes such a thing, so you could be making it up

It says so on that page you quoted, fairly close to the top- Duesberg tried to claim the award. This is one of the things that bugs me; the HIV-is-bogus lobby can't even agree on this. And you didn't read the page before posting it, either. Shame.

As for the genome, protein structures, etc., you could always do a Google search, but that would require an open mind. HIV-RT is (indirectly) of interest in my line of work, so I do actually know a little bit about it (and the people down the hall know quite a bit more). A few of the many, many structures are this, this,
or this, and you can find many more by simply going here and doing a search for "HIV" or "reverse transcriptase". The genomes of HIV1 and HIV2 can be found, like almost every other genome, at the NCBI here and here.

Yes, the nasty side-effects are obvious, but trying to cloud them with language such as "brute force attack on reverse transcription" only makes your argument more suspicious, particularly in light of the questions that you've failed to answer. What, exactly, are the side effects of AZT?

I don't see how that's clouding the language; you're making a big deal about the side effects but you don't appear to know much about pharmaceuticals or molecular biology. AZT is a nucleoside analogue chain terminator, meaning it replaces thymidine in nascent DNA chains but prevents further addition to the chain. I believe the problem is that it fucks with normal transcription too, and it was originally intended as an anticancer drug. I don't know anything about the actual external side effects, only the molecular ones, but I seem to recall it involves some sort of anemia. (Okay, other pages say it basically just makes you feel horribly ill.)

I'll agree AZT is a nasty drug. But you didn't answer my question: what about other therapies that do appear to be successful? Some of these can't be taken in combination with AZT, so you have to leave that out of your argument.

How do you explain it under your belief system, you know, the one that dictates that HIV==AIDS?

"Belief system"? Um, well, the evidence doesn't necessarily dictate anything- medical science isn't advanced enough. I would argue that "AIDS is (usually) cause by HIV", which is a good bit different, and I don't have an answer for what happened to those children. There are plenty of weird examples like that involving AIDS, but they don't mean existing hypotheses about the role of HIV are wrong, only that disease resistance and molecular biology are very complicated. And we knew that already. You can't use anecdotal evidence as proof of a broad generalization; it's just not statistically valid.

As a counter-example, how do you explain the 2.2 million Africans who died from AIDS last year, where they can't afford AZT and certainly aren't doing many poppers? And, for that matter, I'm not clear on how you can cite the children as an example when you believe they were misdiagnosed in the first place. Did they have HIV and not get AIDS- either because of weird biology (my argument) or HIV's harmlessness (Duesberg's argument)- or did they not have HIV in the first place? If the latter, does this mean everyone who's tested positive for HIV does not have any such virus in them?

So, the first problem here is that all you're able to do is nitpick. The second problem is that your hypotheses, to be correct, require that there be a vast conspiracy on the part of the news media, the medical establishment, and the pharmaceutical companies to fabricate AIDS so that GlaxoSmithKline can boost its revenues. It's one thing to claim that Gallo acted inappropriately, but to extend this to accuse a vast number of AIDS researchers of falsifying data is sort of absurd. You clearly haven't even bothered to do the most cursory sort of investigation, and you seem to have virtually no knowledge of biology beyond what you've read on the Virus Myth web page. And I'm a bit peeved that you keep accusing everyone of working for pharmaceutical companies- heck, the assholes didn't even read my resume when I sent it to them last spring.

Here's a challenge: read this from beginning to end and see if you understand it.

Do you work for a big pharm company?

No, and I have never had any sort of connection with any of them. I'm a programmer affiliated with the med school of a very large private university, doing computational biology (I was a molecular bio major). I do not work on anything remotely AIDS-related, nor does the group I'm in receive any AIDS-related funding, but quite a few other scientists here do.

(Actually, my university does make some money off AIDS therapies developed here too, but this pisses off a lot us anyway. It doesn't indicate ulterior motives, because like most universities they try to commercialize anything they can, and AIDS research is only a small part of that.)

even though you don't provide any evidence that Duesberg believes such a thing, so you could be making it up

It says so on that page you quoted, fairly close to the top- Duesberg tried to claim the award. This is one of the things that bugs me; the HIV-is-bogus lobby can't even agree on this. And you didn't read the page before posting it, either. Shame.

As for the genome, protein structures, etc., you could always do a Google search, but that would require an open mind. HIV-RT is (indirectly) of interest in my line of work, so I do actually know a little bit about it (and the people down the hall know quite a bit more). A few of the many, many structures are this, this,
or this, and you can find many more by simply going here and doing a search for "HIV" or "reverse transcriptase". The genomes of HIV1 and HIV2 can be found, like almost every other genome, at the NCBI here and here.

Yes, the nasty side-effects are obvious, but trying to cloud them with language such as "brute force attack on reverse transcription" only makes your argument more suspicious, particularly in light of the questions that you've failed to answer. What, exactly, are the side effects of AZT?

I don't see how that's clouding the language; you're making a big deal about the side effects but you don't appear to know much about pharmaceuticals or molecular biology. AZT is a nucleoside analogue chain terminator, meaning it replaces thymidine in nascent DNA chains but prevents further addition to the chain. I believe the problem is that it fucks with normal transcription too, and it was originally intended as an anticancer drug. I don't know anything about the actual external side effects, only the molecular ones, but I seem to recall it involves some sort of anemia. (Okay, other pages say it basically just makes you feel horribly ill.)

I'll agree AZT is a nasty drug. But you didn't answer my question: what about other therapies that do appear to be successful? Some of these can't be taken in combination with AZT, so you have to leave that out of your argument.

How do you explain it under your belief system, you know, the one that dictates that HIV==AIDS?

"Belief system"? Um, well, the evidence doesn't necessarily dictate anything- medical science isn't advanced enough. I would argue that "AIDS is (usually) cause by HIV", which is a good bit different, and I don't have an answer for what happened to those children. There are plenty of weird examples like that involving AIDS, but they don't mean existing hypotheses about the role of HIV are wrong, only that disease resistance and molecular biology are very complicated. And we knew that already. You can't use anecdotal evidence as proof of a broad generalization; it's just not statistically valid.

As a counter-example, how do you explain the 2.2 million Africans who died from AIDS last year, where they can't afford AZT and certainly aren't doing many poppers? And, for that matter, I'm not clear on how you can cite the children as an example when you believe they were misdiagnosed in the first place. Did they have HIV and not get AIDS- either because of weird biology (my argument) or HIV's harmlessness (Duesberg's argument)- or did they not have HIV in the first place? If the latter, does this mean everyone who's tested positive for HIV does not have any such virus in them?

So, the first problem here is that all you're able to do is nitpick. The second problem is that your hypotheses, to be correct, require that there be a vast conspiracy on the part of the news media, the medical establishment, and the pharmaceutical companies to fabricate AIDS so that GlaxoSmithKline can boost its revenues. It's one thing to claim that Gallo acted inappropriately, but to extend this to accuse a vast number of AIDS researchers of falsifying data is sort of absurd. You clearly haven't even bothered to do the most cursory sort of investigation, and you seem to have virtually no knowledge of biology beyond what you've read on the Virus Myth web page. And I'm a bit peeved that you keep accusing everyone of working for pharmaceutical companies- heck, the assholes didn't even read my resume when I sent it to them last spring.

Here's a challenge: read this from beginning to end and see if you understand it.

Do you work for a big pharm company?

No, and I have never had any sort of connection with any of them. I'm a programmer affiliated with the med school of a very large private university, doing computational biology (I was a molecular bio major). I do not work on anything remotely AIDS-related, nor does the group I'm in receive any AIDS-related funding, but quite a few other scientists here do.

(Actually, my university does make some money off AIDS therapies developed here too, but this pisses off a lot us anyway. It doesn't indicate ulterior motives, because like most universities they try to commercialize anything they can, and AIDS research is only a small part of that.)

even though you don't provide any evidence that Duesberg believes such a thing, so you could be making it up

It says so on that page you quoted, fairly close to the top- Duesberg tried to claim the award. This is one of the things that bugs me; the HIV-is-bogus lobby can't even agree on this. And you didn't read the page before posting it, either. Shame.

As for the genome, protein structures, etc., you could always do a Google search, but that would require an open mind. HIV-RT is (indirectly) of interest in my line of work, so I do actually know a little bit about it (and the people down the hall know quite a bit more). A few of the many, many structures are this, this,
or this, and you can find many more by simply going here and doing a search for "HIV" or "reverse transcriptase". The genomes of HIV1 and HIV2 can be found, like almost every other genome, at the NCBI here and here.

Yes, the nasty side-effects are obvious, but trying to cloud them with language such as "brute force attack on reverse transcription" only makes your argument more suspicious, particularly in light of the questions that you've failed to answer. What, exactly, are the side effects of AZT?

I don't see how that's clouding the language; you're making a big deal about the side effects but you don't appear to know much about pharmaceuticals or molecular biology. AZT is a nucleoside analogue chain terminator, meaning it replaces thymidine in nascent DNA chains but prevents further addition to the chain. I believe the problem is that it fucks with normal transcription too, and it was originally intended as an anticancer drug. I don't know anything about the actual external side effects, only the molecular ones, but I seem to recall it involves some sort of anemia. (Okay, other pages say it basically just makes you feel horribly ill.)

I'll agree AZT is a nasty drug. But you didn't answer my question: what about other therapies that do appear to be successful? Some of these can't be taken in combination with AZT, so you have to leave that out of your argument.

How do you explain it under your belief system, you know, the one that dictates that HIV==AIDS?

"Belief system"? Um, well, the evidence doesn't necessarily dictate anything- medical science isn't advanced enough. I would argue that "AIDS is (usually) cause by HIV", which is a good bit different, and I don't have an answer for what happened to those children. There are plenty of weird examples like that involving AIDS, but they don't mean existing hypotheses about the role of HIV are wrong, only that disease resistance and molecular biology are very complicated. And we knew that already. You can't use anecdotal evidence as proof of a broad generalization; it's just not statistically valid.

As a counter-example, how do you explain the 2.2 million Africans who died from AIDS last year, where they can't afford AZT and certainly aren't doing many poppers? And, for that matter, I'm not clear on how you can cite the children as an example when you believe they were misdiagnosed in the first place. Did they have HIV and not get AIDS- either because of weird biology (my argument) or HIV's harmlessness (Duesberg's argument)- or did they not have HIV in the first place? If the latter, does this mean everyone who's tested positive for HIV does not have any such virus in them?

So, the first problem here is that all you're able to do is nitpick. The second problem is that your hypotheses, to be correct, require that there be a vast conspiracy on the part of the news media, the medical establishment, and the pharmaceutical companies to fabricate AIDS so that GlaxoSmithKline can boost its revenues. It's one thing to claim that Gallo acted inappropriately, but to extend this to accuse a vast number of AIDS researchers of falsifying data is sort of absurd. You clearly haven't even bothered to do the most cursory sort of investigation, and you seem to have virtually no knowledge of biology beyond what you've read on the Virus Myth web page. And I'm a bit peeved that you keep accusing everyone of working for pharmaceutical companies- heck, the assholes didn't even read my resume when I sent it to them last spring.

Here's a challenge: read this from beginning to end and see if you understand it.

Yes, Celera did do a genome. But the public consortium also did one which is equivalent or better in most scientific terms and vastly superior in one important respect: it is public domain.

While non-profit researchers can obtain free access to Celera's genome data, it is a pain in the ass to deal with their legal department, and the data is viewable in a sub-optimal interface. The public genome is easily and readily available to anyone and everyone with a web browser.

I had nothing to do with the public human genome project, but I use their data every day in my research as do thousands of other researchers. To suggest that the government pissed away money on that project is simply wrong.

It seems clear to me that everyone benefits from the public genome project in particular, and public science in general. Why should we enrich a private company for basic scientific information which is needed by all researchers (both for-profit and non-profit)?

Now here's the [possible?] added benefits: Loss of bone density, and Loss of hair, I'm sure there's plenty of others not listen on the manufacturer's leaflet. Here's some Q+A thingy, a petition, and a Wired article.

Thankfully, my girl seems fine so far. :)

Happy bonking people!

Ali

mhack

Its been two years since Clinton & Venter & Collins announced the human genome had been "sequenced" yet they dont even have a firm gene count yet. Of course that was just the "first draft", with the final draft now about 94% completed. I know its a very complex problem. These MicroSoftian "vaporware" announcements make me very skeptical about bold claims by other researchers.

AIDS research is the single most well-funded disease research in human history.

I find this dubious, and the NIH spends vastly more on cancer research: see their official funding page.

HIV has not been isolated.

Even Duesberg contends that HIV exists. The genome has been sequenced, the structures of the protease and reverse transcriptase have beeen solved. You people are more interested in dogma than science- just as bad as the creationists.

As for AZT, everyone with more than a basic knowledge of biology and chemistry understands how dangerous it is- a brute force attack on reverse transcription (and, unfortunately, normal DNA replication). It's a particularly poor example, because the nasty side effects are obvious; why don't you try arguing against the therapeutic power of, say, Crixivan or d4t instead?

My question is, does the DNA encoding the conterclockwise proteins overlap with the DNA encoding the clockwise proteins? If so, then you can't rip out one without damaging the other. I randomly looked at a few by clicking on the aforementioned link and I did see some overlaps; for example, MG264 and MG265 overlap.

According to GeneQuiz, the entire genome of this creature is only 0.58 Mb (which I presume stands for mega-bases). About 3/4 of the genes have guesses about their function, to varying degrees of certainty.

It's also interesting that this bacterium uses a non-standard transcription. The latter reference above says "UGA, normally a stop codon, in this organism encodes for the amino acid tryptophan.". Does anyone know how common this is?

Don't worry, be happy.

Actually, I had in mind the far less sinister but very annoying lyrics to a hit song by Bobby Mcferin. (I'm unclear why this is on an NIH site, or what therapeutic effect they think the synthesized tune could have on any but the already insane.)

But go with your gut reaction to discover within. :)

Thanks for the spelling corrections, fuckwad. As is typical of those who have little to offer, bullshit is the method of choice for argument. Have you ever even read the book you ignorant tool? I didn't think so. You just think I am making up this bullshit about republicans? Why don't you don't you read the book.

Also, thanks for posting some rather pointless quotes, certaintly nothing from a respectable medical journal. For those who might read something from this twit, I will post a couple of journal citations from the National Library of Medicine University of Sunderland. You are a goddamn british fuck, and you are commenting to me about politics?

As a side note, wheat opioid peptides are called opioid peptides because they bind to the same opioid receptors in the brain as all naturally occuring opiates, such as morphine. Any simple medical guide, including a nurse's pharmaceutical reference will make it quite clear that opioids ultimately kill you by suppressing your respiratory system to the point of failure. Note, thats what happens when someone dies of asthma (duhhh!). If you read the Merck Manul, a common medical reference, you will find one of the chief side effects of long term narcotic pain management is respiratory suppression manifested as asthma. But seriously, how the fuck can you claim to know anything about this subject when you didn't even know this. Seriously, why the fuck do you think so many plants have opioid peptides in them, to get us high? They kill things, especially bugs. Hey, since your british, why don't you drink down a couple bottles of codeine cough syrup and tell me how you feel. I don't think you will be breathing too well.

(1) Fukudome, S. et al, Release of opioid peptides, gluten exorphins by the action of pancreatic elastase. FEBS Lett. 1997 / 412 (3) / 475-479.

(2) Fukudome, S. et al, Gluten exorphin C : a novel opioid peptide derived from wheat gluten. FEBS Lett. 1993 / 316 (1) / 17-19.

(3) Max ,B., This and that : an artefactual alkaloid and its peptide analogs. Trends Pharmacol. Sci. 1992 / 13 (9) / 341-345.

(4) Fukodome, S. et al, Opioid peptides derived from wheat gluten : their isolation and characterization. FEBS lett. 1992 / 296 (1) / 107-111.

(5) Dohan, F.C. ,Genetics and idiopathic schizophrenia. Am. J. Psychiatry 1989 / 146 (11) / 1522-1523. , Dohan, F.C. ,Genetic hypothesis of idiopathic schizophrenia : its exorphin connection. Schizophr. Bull. 1988 / 14 (4) / 489-494. , Paroli, E. et al, Opioid peptides from food (the exorphins). World Rev. Nutr. Diet. 1988 / 55 / 58-97. , Morley, J.E., Food peptides. A new class of hormones ? J. Am. Med. Assoc. 1982 / 247 (17) / 2379-2380 , Ross-Smith, P. et al, Diet (gluten) and Schizophrenia. J. Hum. Nutr. 1980 / 34 (2) / 107-112.

• In most systems, we don't know what the code is. If a cortical neuron is firing at approx 1 Hz, plus or minus some jitter in the action potential time, what is the bandwidth of that channel? If I now tell you that the times of the action potentials are precise to a sub millisecond or even microsecond scale, how does that change your answer? If the code is the pulse rate, fine, we can quantify the information capacity in the presence of noise using information theory. If it is the precise time of the action potentials, it depends on the 'reliability and precision' of that neuron's firing. If it depends on the degree to which that neuron is synchronized with N other neurons, we need to know N and the degree of synchrony, as well as how well the downstream processors respond to the synchrony. But I can tell you, we generally don't know which of these possibilities hold for a given system: sometimes all, sometimes none, sometimes a mix. We just don't know.
• This idea that a synapse has so many bits of information -- give me a break. Welcome to synaptic physiology. Thousands of people are working on the question. We are still deeply in the dark. Many synapses release tens of neurotransmitters counting modulators and neuropeptides. These are mostly ignored by the quantitiative types adding up the processing power of the brain. The quantity of each neurotransmitter released depends deeply and intimately on the previous history of that synapse and other synapses in the neuron, on almost every time scale measurable (definitely milliseconds to years). How many orders of magnitude is that, friend?
• We have not yet discovered many neurotransmitters.
• We don't have a very good idea how the system works. We know tons about many things, but are in the dark about a lot of the deeper questions.
• Most of the neurons in the brain are astrocytes. They regulate many aspects of neuronal computation, from excitability to synaptic function. The are very poorly understood, and virtually ignored by the computational neuroscience community.

John Hunter

My publications relevant to claims above

• Synaptic dynamics
• Action potential timing

• In most systems, we don't know what the code is. If a cortical neuron is firing at approx 1 Hz, plus or minus some jitter in the action potential time, what is the bandwidth of that channel? If I now tell you that the times of the action potentials are precise to a sub millisecond or even microsecond scale, how does that change your answer? If the code is the pulse rate, fine, we can quantify the information capacity in the presence of noise using information theory. If it is the precise time of the action potentials, it depends on the 'reliability and precision' of that neuron's firing. If it depends on the degree to which that neuron is synchronized with N other neurons, we need to know N and the degree of synchrony, as well as how well the downstream processors respond to the synchrony. But I can tell you, we generally don't know which of these possibilities hold for a given system: sometimes all, sometimes none, sometimes a mix. We just don't know.
• This idea that a synapse has so many bits of information -- give me a break. Welcome to synaptic physiology. Thousands of people are working on the question. We are still deeply in the dark. Many synapses release tens of neurotransmitters counting modulators and neuropeptides. These are mostly ignored by the quantitiative types adding up the processing power of the brain. The quantity of each neurotransmitter released depends deeply and intimately on the previous history of that synapse and other synapses in the neuron, on almost every time scale measurable (definitely milliseconds to years). How many orders of magnitude is that, friend?
• We have not yet discovered many neurotransmitters.
• We don't have a very good idea how the system works. We know tons about many things, but are in the dark about a lot of the deeper questions.
• Most of the neurons in the brain are astrocytes. They regulate many aspects of neuronal computation, from excitability to synaptic function. The are very poorly understood, and virtually ignored by the computational neuroscience community.

John Hunter

My publications relevant to claims above

• Synaptic dynamics
• Action potential timing

Also, why bother with the copious quantities of tools?

In this case I would guess the guy feels two things. (1) need for clean. He said he needs to brush off his surroundings before he goes to sleep. (2) need to have tools 'just in case', which may be another anxiety problem. The comment about not needing a pedometer any more shows he may be helped by REBT (Rational Emotive Behavioural Therapy) where finding rational reasons for the compuslions can help defeat them.

Personally, I feel sorry for the guy.

Honestly do you use a brush when you sleep someone not at home or just pass out wherever.

And for my own favorite test, just like chiropractric, colloidal silver users make some wide, sweeping, and exagerated claims for what silver "can cure". I mean crap, that's a huge list of things it will cure or alleviate. You just have to wonder when you see that many claims of a miracle medicine/tonic.

I'm a medical writer so I can comment on the medical content of the sites in the Consumer Webwatch reports. I don't think they're good enough.

(Since I write for the web, I found the programmer comments very useful. OK, I'll change that code in my site RSN).

I agree completely that (my) content doesn't matter if you can't find it, and without good graphic design, backed up by good programming (thanks guys), you can't find anything on those web sites (which have thousands of pages). Everything you want to know about medicine is on the Internet many times over, but the problem is (1) finding it (2) in a form that you can understand and (3)evaluating its accuracy and validity.

Here's a good example: I went to a doctor for a checkup, and he didn't perform a digital rectal examination, although he did give me a guiac test. A DRE is a way of screening for prostate cancer and rectal cancer, and the American Cancer Society among other well-known organizations recommends it for everyone above 50, like me. A guiac test samples the stool for blood, which is often a symptom of colon cancer. Various organizations also recommend sigmoidoscopy (a fiber optic scope that goes through the rectum and up the colon about a foot) and colonoscopy (which goes up the colon even farther) as screening for colon cancer. My medical textbooks were either out of date or ambiguous on these issues.

So, here's my question for the medical web sites:

Should my doctor have performed a DRE on a 50-year-old man in a routine physical?

My first stop was the web site rated No. 1 by the experts National Institutes of Health. Once I got there, I realized that I had to refine the question. What I really wanted to know is,

would a DRE have lowered my chances of dying of cancer?

As it turned out, there are scientific studies with control groups that found that there was no good evidence that patients who had screening DRE, sigmoidoscopy or colonoscopy lived longer than patients who did not. However, patients screened with guiac tests did live longer (endpoint of death, they call it). I found this on the professional side of the site, not the consumer side, couched in technical language. Not easily accessible or understandable -- for something that your life depends on.

So when I read the Consumer WebWatch report, I decided to see how the expert's No. 2, MayoClinic.com handled it. To my surprise and dismay, the Mayo Clinic web site, in its extensive discussion of screening for colon cancer, did not make the point that only guiac testing had been shown to save lives. There is criticism in the medical literature that doctors don't provide enough hard information to their patients to enable patients to make an intelligent decision. I think the fact that the life-saving ability of 3 of those 4 screening tests is not supported by evidence-based medicine is an important fact for patients that the Mayo clinic should have provided for patients who are trying to decide whether to take an uncomfortable and (for the scopes) expensive test with a risk of perforating the bowel.

Evidence-based medicine, BTW, is a term of the art, and a good Google search. It means practicing medicine on the basis of scientific evidence, when it exists (the catch: you wind up saying, "science doesn't know" too much of the time).

EBM started when 2 doctors in Canada were having trouble keeping up with all their reading, and said, "Hey, let's just read the stuff that's supported by scientific evidence." That cut down the pile significantly.

A good explanation is on the Bandolier web site, from Oxford, UK. This will reduce medicine to the rationality that engineers and other geeks are used to thinking in.

What is series:
Evidence-based Medicine

Bandolier

Forms of evidence
Evidence is presented in many forms, and it is
important to understand the basis on which it
is stated. The value of evidence can be ranked
according to the following classification in
descending order of credibility:

I. Strong evidence from at least one
systematic review of multiple well-designed
randomised controlled trials.

II. Strong evidence from at least one properly
designed randomised controlled trial of
appropriate size.

III. Evidence from well-designed trials such as
non-randomised trials, cohort studies, time
series or matched case-controlled studies.

IV. Evidence from well-designed
non-experimental studies from more than
one centre or research group.

V. Opinions of respected authorities, based on
clinical evidence, descriptive studies or
reports of expert committees.

BTW, when people ask me where to find medical information on the Internet, I recommend peer-reviewed sources, starting with the Merck Manual Home Edition , then British Medical Journal, then Medicalstudent.com.

But you can't do it on the Internet alone without professional guidance -- medical librarians explained to me how to search the medical literature. And very often what you want to know is only available on paper.

I went into this in more detail when I taught a class in medical journalism. I interviewed a medical librarian and posted her explanation in an article on my web site. That's why brick libraries are so valuable -- they don't just have paper, they have librarians.

Note that computers will never, ever be able to figure out a protein structre ab initio. (i.e. without any info except the sequence)

Gluten intolerance is not the issue. Gluten is decomposed into glutomorphine molecules in the intestine. Many, many plants contain opiod peptides because all animals mediate respiration through the opiod peptides. Plants have evolved this trait so as to prevent their consumption by insects. Wheat contains particularly powerful opiod peptides, which is one of the reasons it is so resilient to insect infestation (but not molds).

For some reading on this info try these articles:

1. Fukudome, S. et al, Release of opioid peptides, gluten exorphins by the action of pancreatic elastase. FEBS Lett. 1997 / 412 (3) / 475-479. , Fukudome, S. et al, Gluten exorphin C : a novel opioid peptide derived from wheat gluten. FEBS Lett. 1993 / 316 (1) / 17-19.

2. Max ,B., This and that : an artefactual alkaloid and its peptide analogs. Trends Pharmacol. Sci. 1992 / 13 (9) / 341-345.

Note: Exorphins are opiod peptides which are exogenous in origin, as opposed to the endrogenous opiods (endorphins) created by your body.

Capsule summaries of these journal articles can be found at The National Library of Medicine.

I will attempt to summarize.

Opiods are used by the body to condition social behavior. Sex, human contact, listening to others speak, all of these activities cause measureable increases in endorphin levels in the brain. This occurs to condition humans to continue that behavior, it is a classic reward conditioning system. I don't want to get into WHY respiration and feelings of well being are related, but it is due to ancient evolution which is not completely understood. Social behavior of ants is mediated in a similar fashion for instance.

Glutan affects all people like all opiod peptides do. Is it any wonder that Asthma has also increased at an alarming rate, as rapid of an increase as autism? Not at all, because autism is the behavioral result of opiod consumption. As an adult, its not that big of a deal. A junkie can still speak, but it is the childs desire to be with his mother, that drives him to learn to speak from her. Without that initial drive, he never learns correctly. Asthma is ALWAYS the result of respiratory suppresion due to kappa-opiod receptor agonists. Constipation is another major problem. How many people here always know chicks who pop laxatives like mad? It is also because of eating glutan.

The other primary reason why glutan is added to foods is because it is addictive. More glutan, means mor profits. Why would glutan, a protein from wheat, be added to junk food like Doritos or Slim Jims, or instant soup, or TV dinners... It is to make people eat more.

Today, the pricessing of wheat has allowed extremely concentrated forms of gluten. Many are chemically decomposed such that they are nearly PURE gluto-morphine molecules, so that they are even MORE addictive.

And this is the way companies want it. Haven't you ever thought its crazy that people overeat on cookies, and they say its the sugar. But no one overeats on bananas, even though they have MORE Sugar per gram than cookies? Or they say its the starch, but no one gets fat eating 10 pounds of potatoes a day, even though potatoes contain a HUGE quantity of starch, more per gram than cookies? Its the opiod peptide content of these foods which causing overeating.

The government has known this for years. The first example of finding these effects of wheat go back to 1980, of you do the research. The government doesn't care, because they know just as the Roman emperors knew 2000 years ago that a population jacked up on wheat products all day will be less likely to rebel.

Hasn't anyone wondered why the popularus party at the end of the Republic gave away ONLY bread? Not any other kind of food? Or why prisoners are usually given bread? It keeps them apathetic and complacent.

Is it also any wonder that the narcosis effect commonly called ADHD is also countered by CNS drugs? Or better yet, that Amphetamine was until 10-15 years ago also the only drug used for Asthma? Respiration is stimulated through activation of the Alpha-2 adrenal receptors in the brain.

As far as WHEAT and Autism, for MANY mild cases of autism, administration of an opiod antagonist drug, such as nalextrone, can easily reverse much of the behavior (or lack thereof) exhibited by such patients.

What is the problem? In the past, natural wheat was used, and many population groups evolved to resistant to small doses of gluto-morphine peptides. But through modern chemistry, new kinds of glutan is being added to foods which is far more powerful. The end result is a population that is prone to asthma, apathy, antisocial behavior, constipation, and addicted to stimulants such as caffeine, nicotine, amphetamine, or cocaine.

The number of people who do not consume any of those drugs is very, very small.

I will be honest, there is a way out. Your body does adjust. I was even on prescription dextroamphetamine for a long time, smoked for 10 years, drank coffee every day. Not consuming wheat sounds like its impossible, but its SOO easy. It is hard at first, you will crave these foods, but like all addictions, it will past. It just takes time.

The end result is you will think more clearly, breath more deeply, be more awake, and have more of a will to live. Its also nice to have regular bowel movements. Anyway, its been a long weekend for me, and its time to go to sleep. I encourage anyone who reads this far to think before you eat, especially if you give food to children. Wheat products and junk food containing wheat is just not suitable for human consumption, and harms children in the long run.

Type II diabetes is directly linked to poor diet, especially those diets high in fats and sugars. These type of diets reduce the body's ability to process sugar, resulting in Type II diabetes.

Increased incidence of Big Mac and Frosty consumption is responsible for the increase in diabetes, not some mysterious environmental hazard.

Type II diabetes is directly linked to poor diet, especially those diets high in fats and sugars. These type of diets reduce the body's ability to process sugar, resulting in Type II diabetes.

Increased incidence of Big Mac and Frosty consumption is responsible for the increase in diabetes, not some mysterious environmental hazard.

I did a BLAST comparison of your chromosome 1 with a large database of known sequences on the NCBI website, and this is the best hit:

>gi|19848325|gb|AC021755.9| Download subject sequence spanning the HSP Homo sapiens chromosome 15 clone RP11-521C20 map 15q15, complete
sequence
Length = 161794

Score = 44.1 bits (22), Expect = 0.15
Identities = 22/22 (100%)

Query: 402 tggtggatggtctggtctgatg 423
||||||||||||||||||||||
Sbjct: 80217 tggtggatggtctggtctgatg 80238

Sorry about that.

I did a BLAST comparison of your chromosome 1 with a large database of known sequences on the NCBI website, and this is the best hit:

>gi|19848325|gb|AC021755.9| Download subject sequence spanning the HSP Homo sapiens chromosome 15 clone RP11-521C20 map 15q15, complete
sequence
Length = 161794

Score = 44.1 bits (22), Expect = 0.15
Identities = 22/22 (100%)

Query: 402 tggtggatggtctggtctgatg 423
||||||||||||||||||||||
Sbjct: 80217 tggtggatggtctggtctgatg 80238

Sorry about that.

As another person who replied to this, I'd like to reiterate that the chemical composition of DNA is known. Composed of four different nucloside triphosphates (GATC) in an dynamically ordered structure.

If I follow your train of thought, than all of genomes that are sequenced are worthless to me and the scientific community because we aren't "the same company who made the CD".

Look here at the National Center for Biotechnology Infortaion's Genomic Database. I'd assume you would receive something similar to this from Venter's group.

Also one can FREELY browse the human genome and look for differences between your genome and those used to construct this draft of the genome.

As another person who replied to this, I'd like to reiterate that the chemical composition of DNA is known. Composed of four different nucloside triphosphates (GATC) in an dynamically ordered structure.

If I follow your train of thought, than all of genomes that are sequenced are worthless to me and the scientific community because we aren't "the same company who made the CD".

Look here at the National Center for Biotechnology Infortaion's Genomic Database. I'd assume you would receive something similar to this from Venter's group.

Also one can FREELY browse the human genome and look for differences between your genome and those used to construct this draft of the genome.

FUD! You didn't actually read what I wrote did you?

Geezus, calm down. I misread your post. Sorry already. Nowhere did I attempt to spread "fear, uncertainty, and doubt." Too much coffee today?

As far as the comfort of the procedures, it's well documented that LASIK is less painful that PRK. There are plenty of studies, here is one. Here is another. I could find more, but that would really add nothing to the conversation.

FUD! You didn't actually read what I wrote did you?

Geezus, calm down. I misread your post. Sorry already. Nowhere did I attempt to spread "fear, uncertainty, and doubt." Too much coffee today?

As far as the comfort of the procedures, it's well documented that LASIK is less painful that PRK. There are plenty of studies, here is one. Here is another. I could find more, but that would really add nothing to the conversation.

there is zero evidence to link resistance to
vancomycin (an extremely rare antibiotic, used only
in cases of desperation) to the use of hand soap.

One interesting thing to note about dietary issues in general is the evolution of man vs. the evolution of our diet.

For a moment, toss out everything any diet "expert" has ever told you. Toss out the USDA's damn pyramid. Look at biology. Add up these few, relatively simple facts.

Step in the WayBack Machine(tm) and look at much more simple times. The human body and its metabolism is geared towards periods of relative "feast" and "famine." Seeing as the primary use for fats is fatty acid precursors, the sources of energy are protein and carbohydrates. Carbs are really effecient foods, but are usually scavenged. (fruits, berries, tubers, etc.) Sources of protein are usually hunted.

The way the body's metabolism flips between a glucose-centric pathway to a ketone-centric pathway makes perfect sense. In times of feast (abundant carbohydrates), use the carbs, storing everything away that is in excess. In times of famine, catabolize the fats into their building blocks and get energy from them (while looking for more berries.)

Homo sapiens and its relatives have existed for thousands of years on this metabolic model. Evolution would have it that it is the most successful model for the given environment. Things stay pretty matched while things follow the format of:
Humans hunt the tiger.
Humans catch the tiger.
Tiger eats a human.
Humans go look for smaller tigers and potatoes.
(ie. food chain struggle, varied diet)

Fast forward to today: Humans hunt McDonalds. A Big Mac gives little struggle (unless you try to fit the entire thing in your mouth at once).

Our food has evolved into a carbohydrate-rich diet because that's what the USDA said was good for us. On that note, carbohydrates are also the cheapest form of food, so when the Gub'ment is handing out subsidized food to everyone (public schools, hospitals, army bases, FBI cafeterias, etc), it would make sense to hand out carbohydrates. Abundant, cheap, energy-rich? C'mon. It makes perfect economic sense. But it doesn't follow nature. Nature would have us eat fewer carbohydrates and more protein, like our ancestors did.

The Atkins diet is simply putting things back into a biological perspective. Most criticisims of the diet focus too much on the induction part of it. Getting the person with a fistfull of twinkies back on the proper metabolic path is an awesome feat of biochemistry and cell biology, but it happens when you go low/no carbs. No one, including Dr. Atkins, says that the induction part of the diet is The Proper Diet.

One need only look at the effect of morbid obesity on life span to say that any negative effects of the induction phase of the diet are minute in comparison to the effects of hauling an extra 100 lbs of fat. Perspective is needed. It's like worrying about whether your 8-character root password has suffecient random characters in it, when you're running the La735t 57@ck 0v3rflo\/\/ on your apache server.

Finally, why rely on other people to digest all of this information (even me) and put their own (perhaps political) spin on it?

For those who wish to delve into the more archane, I suggest you go to NCBI and do some literature searches on the ketogenic diet. You'll see that there are some positive neurobiological and hormonal impacts that it has.

National Center for Biotechnology Information (Medline)

Search for some of these keywords (each line together):
ketosis ketogenic
ketosis epilepsy
ketosis protein sparing

TiFox

If you want free, head on over to the National Library of Medicine's DocMorph page. You can upload TIFF files, and have them converted to plain text in about 15 seconds. Not bad for 'free', I think.

I'm very curious where you got the belief that carbohydrate consumption causes obesity. I've heard this before, but never seen proof of it. In fact, a quick search on the web shows the National Institute of Health and American Obesity Association not mentioning a single thing about carbohydrates causing obesity, but mentioning plenty about fat intake and exercise. Also, other websites in fact repudiate the claim that carbohydrates cause obesity. Could you please give us some scientific sources for this claim?

It is immoral to ask the public to fund research with their tax dollars and then ask them to pay for it again if they want to see its results, via subscription costs.

It is immoral to ask the public to fund research with their tax dollars and then ask them to pay for it again if they want to see its results, via subscription costs.

Genetically modified chimpanzee, with a down-regulated CMAH gene says "nature pretty".

A Month ago I was reading an article in a newspaper talking about a research from Harvard University stating that waking-up late in the morning favorise learning of new elements and that taking a nap after six hours of study boosts the amount of knowledge you can acquire... This study can easily been applied to the context of producing work. It was pinpointing the fact that the brain activity is better functioning when the sleep cycle is completely ended, instead of breaking it - waking-up early. And that this brain activity progressively slow down after 6 hours of strait work. Taking a nap was helping people to return to a normal state and continue to stimulate brain activity. I know my english isn't good today... I've been working 24 hours in the past 2 days... Really, in my own opinion... working more than 10 hours a day slow my performance... going over that limit more than 2 days in a row and your work output will be less in a week (I mean good work output) than if you have made a regular 10 hours a day 5 days a week. And Btw, working on weekends destroy people moral.... ! Here are some references : "Power Nap" Prevents Burnout; Morning Sleep Perfects a Skill, Snooze Power: Midday nap may awaken learning potential... anyway I have to sleep... good reading !!! peace... and continue to tell you boss that more resources make better software and that later or sooner he will face problems in the code that will cost him much more than spending a little bit more earlier !!!

How much you wanna bet CCR5 is in the cluster they found?

What this really tells us, though, is that HIV arose in Africa.

If you don't have a subscription to Nature, the absract is here If the link is busted, go to NCBI and search for "Dumesic glucose" under Pubmed.

If you don't have a subscription to Nature, the absract is here If the link is busted, go to NCBI and search for "Dumesic glucose" under Pubmed.

One has to be careful not to confuse Duesberg's extreme views with the widely-held and far more reasonable suspicion that there are cofactors in addition to HIV that contribute to development of AIDS.

This paper sorta contradicts what I'd been hearing about simian models for HIV transmission. I'd understood that infection & incorporation of the retroviral sequences into the host genome takes place, but CD4 cell apoptosis is somehow avoided. nb: Dalgleish, O'Byrne: AdvCanRes 84:231-76 (2002)

Virology is admittedly not my area of research, but I'd think that there seem to be two divergent opinions here on simian resistance. Anyone here working in the area care to explain the (seeming) contradiction?

Please cite one.

Here's one for migraine sufferers.

And one in combination with morphine

How about one for cold-induced pain?

And this one for post-operative pain.

In short, any doctors that have been telling you that acetaminophen is no more effective than placebo have been giving you false information. It is a very effective analgesic for mild to moderate pain. I know from my own experience that my patients often receive very good pain relief from plain old Tylenol, sometimes when other pain medications have failed.

Please cite one.

Here's one for migraine sufferers.

And one in combination with morphine

How about one for cold-induced pain?

And this one for post-operative pain.

In short, any doctors that have been telling you that acetaminophen is no more effective than placebo have been giving you false information. It is a very effective analgesic for mild to moderate pain. I know from my own experience that my patients often receive very good pain relief from plain old Tylenol, sometimes when other pain medications have failed.

Please cite one.

Here's one for migraine sufferers.

And one in combination with morphine

How about one for cold-induced pain?

And this one for post-operative pain.

In short, any doctors that have been telling you that acetaminophen is no more effective than placebo have been giving you false information. It is a very effective analgesic for mild to moderate pain. I know from my own experience that my patients often receive very good pain relief from plain old Tylenol, sometimes when other pain medications have failed.

Please cite one.

Here's one for migraine sufferers.

And one in combination with morphine

How about one for cold-induced pain?

And this one for post-operative pain.

In short, any doctors that have been telling you that acetaminophen is no more effective than placebo have been giving you false information. It is a very effective analgesic for mild to moderate pain. I know from my own experience that my patients often receive very good pain relief from plain old Tylenol, sometimes when other pain medications have failed.

You can start with this which explains the effects of THC on the memory and learning portions of the brain, and then move along to this which tells us (among other things) that marijuana use restricts blood flow to the brain. Then, if you're still with us, check out this. The fourth paragraph details lab experiments where it was found that giving THC to rats caused a loss of brain cells. If you have any further questions, post them here or check your favourite search engine.

You realize you've also just said, people holding conversations while driving can't pay attention to the road, therefore having passengers is just as dangerous. You are correct. There was a peer-reviewed paper, "Carrying passengers as a risk factor for crashes fatal to 16- and 17-year-old drivers," published in the Journal of the American Medical Association (Mar 22/29 2000, pp.1617-8) that did indeed conclude that conversations between the driver and passengers dramatically increased the risk of a fatal accident for newly-licensed drivers.

oh, is the "back" gene this one or this one by any chance?

oh, is the "back" gene this one or this one by any chance?

Maybe it is time to include some text clustering algorithms into the /. engine.

The medline database, for example, contains millions of abstracts from scientific articles that have been clustered using this relatively simple method. It works very well. In this way editors would be able to find related posts. The 3 most similar posts could be interesting for us readers as well.