Slashdot Mirror

It's remarkable discoveries like the collapse of toilets in Glasgow that make me proud to be a student at Glasgow University... :)
At least I know my (read: parents') money is being put to good use!

Tech support is your key into higher paying jobs, they love to promote from within.

What the fuck ever. Neither of the two places I've done tech support for gave a damn about anybody in tech support. As far as the company was concerned, we weren't worth the time of day. I saw an awful lot of really talented people leave because there was no hope of advancement, or even a side-grade into an interesting field that doesn't burn you out. Forget tech support, it is a dead-end career path that only teaches you to hate your fellow man and loathe all known computer software.

I'd kill myself if I could muster up the self-confidence to know I wouldn't screw it up, but my 3.5 years of tech support have robbed me of even that.

Yes, with emphasis on the "+". It's 12 years old "news".

See what Wagner writes himself in an article in Am. J. Pediatr. Hematol. Oncol. 15(2):169-74.
That article doesn't cover the genetic screening of MHC/HLA types, but that's everyday procedure at any clinical lab at any hospital in the civilised world.

Still, I suppose this article appeals to tabloids like /. and their readers who get extatic when they see words like "genes" and "DNA".
If /. necessarily must cover "Science", make more categories. This would be fitting in such a general category as "Medicine", though I'd like to see it in "Clinical Immunology", "Clinical Hematology" or "Oncology"... ;)

.-. .- -.. .. --- -....- .- -.- - .. ...- .. - .-.- - ...-.-

I sincerely hope whoever moderated this comment up as "funny" never has to experience a close relative (or worse, him/herself) having Parkinson's disease. Michael J. Fox as "that guy who shakes a lot" .. yeah, that's a real knee-slapper. I suppose Magic Johnson is "that guy with the busted immune system", huh? I know at least one Slashdot reader who is afflicted by this disease.

For people who are really interested in Parkinson's disease and would rather help those that suffer from it than make childish jokes about their condition, here are some links:

NIH's Parkinson's Disease Research Agenda

The Morris K. Udall Parkinson's Disease Research Center

National Parkinson Foundation

Computers for People With Parkinson's Disease Project

From my sources, this was done a long time ago. There's a Caltech press release entitled "The DNA Double Helix Conducts Current as a Molecular Wire" that was released 11/11/1993. You can go to Caltech's site and search for 'DNA conduct' and you'll see it's there.

Further, there's an research brief at the National Institute of General Medical Sciences (who knew we had such an institute?) from 1997 talking about the same thing.

Been there, done that, got the t-shirt.

The Life Extension Foundation Forum is a good place to go for science-based discussions of supplements. The main LEF website isn't so helpful. Either go to the main LEF website and click on "Forums" or simply go straight to the forums.

Please register and log in before posting.

The two best places to purchase supplements (something you shouldn't do until you have done substantial research at the LEF Forum and especially on MEDLINE) I have found are Beyond-a-Century (as in "live and be healthy over 100 years") and iherb.

There's an intersting ambiguity in your question.

Yes, 'hardware' gene banks exist, where the actual molecules are stored in solution for posterity. This isn't my area, but it looks like some other posts cover this.

Also online are 'software' databases of the actual basepair sequence, mostly searchable via web, Xwindows interfaces, and often downloadable as SQL or other DBs. For instance, GenBank has increasingly complete coverage of organisms ranging from Yeast through Fugu to Yo Mamma. I guess that sounds kinda bad.

Of course, if you're interested in Yo or Any Mamma, or humans in general, you can download the current 'draft freeze' from the public Human Genome Project via UC Santa Cruz.

Remember, when using the new GNU Genome Cross Compiler, to Save Early and Often...

more info can be found here.

First Off, Caffeine Faq. Needless to say, this story sort of threw me. From my understanding, caffeine works by inhibiting cAMP phosphodiesterase, a protein which degrades cAMP, also known as cyclic adenosine monophosphate. Now, cAMP has various functions in the body, including acting as a second messenger for various hormones, including epinephrine. Abnormally high levels of cAMP isn't something one wishes to have all of the time, and the idea of a 'caffeine gene' sounds wreckless and irresponsible. This suggestion is on par with suggesting the insertion of genes, which code for proteins capable of synthesizing rat poison. Both are laughable. The insertion of such genes, or a "pharmacy" organ don't really make any sense. Just thought I'd share what I know with you, and bitch at you in the process. If you are at all interested in learning more about caffeine, cAMP, or pretty much anything medically related, go to the NIH and follow the link to PubMED. There you will find a search engine which will search nearly all of the abstracts(summaries) of articles in the national library of medicine. sorry if I was rude.

No offense, but this article didn't really have anything new to add to the discussion of why it's better to have access to source code. For the record, I'm in favor of access to source, and I don't particularly care what license it's under as long as I can use it legally to learn something new and interesting (which is why I refer to it as source access rather than the politicalized terms "free software" or "open source"). I do want to reply to two comments he made, though:

In the hands of countless developers, what can be done with an Open Source project is unlimited. It simply takes time to add whatever functionality you (or the boss, customer, etc.) wish were there.

Not every free software developer can work on every free software project. I see a lot of postings on /. whenever somebody complains about missing functionality in an application, or a utility that doesn't work on their system. Invariably there are several comments along the lines of "you have the source, fix it yourself." That's great if the problem lies within my skillset. Should a Perlmonk need to learn OpenGL to fix a graphic utility he or she uses? Should a GNOME guru need to learn m68k assembly to write an installer for OpenBSD? OK, those are sort of contrived. But the point is that not everybody knows everything about everything, and sometimes you just want to get work done. Apple didn't sell 4 million iMacs on their looks alone, at least not the ones in use where I work. Some very smart people use them to do all kinds of smart scientific things (perhaps you've heard of one or two?), and some of those people do write their own code because nothing else does what they need it to do. But by and large, they're using off the shelf products to get their real work done. Nothing wrong with that.

Contrast this bureaucratic model with Open Source. If I want to add a feature to an Open Source project, I simply download the source code and add the feature. (Actually, it's a little more complicated than that, but you get the idea).

This might be true for smaller projects with only a few coders and easy-to-navigate license terms, but it doesn't hold up for projects like Mozilla, StarOffice, or the Linux kernel. Many projects have specific coding rules, accept changes from specific users only, and are simply too damn big to just go in and add one or two features. I'm not saying it's impossible; clearly it's not. Just look at how far Mozilla came in two years (a relatively short time for such a large project, one that had to start over from scratch no less). I just feel it's important to stress to newcomers to the various source access movements that it's more than just downloading the code, rewriting it, and making history. There's publishing it afterwards (depending on the license/project), integrating it with other code, testing it (optional, sadly, in too many cases), and the like. Getting involved in a medium-to-large project can be a serious investment of braintrust, just as it is with sequestered-source projects.

I can definitely agree about the tech-support thing, though. It's what I do for money while I try to go back to school to learn all the things I should have been paying attention to before going out into the real world, and let me tell you: he was lucky to be considered a step above the slugs....

I don't know anything about the distributed computinfg effort, but I do know about the microarray data and the NCI Lab. of Molecular Pharmacology. You can find out more about the microarray effort at the Brown-Botstein group at Stanford or at the Weinstein group at NCI. This work is part of a larger effort to characterize the cell lines in the NCI cell line screen. For more information about the cell screen, see the DTP web site. A real quick summary is that >35,000 compounds and >15,000 natural product extracts have been tested for their ability to inhbit the growth of 60 human tumor cell lines in culture. There has been a lot of work that shows the usefulness of analysing correlations in this data. The latest effort is to use the microarray data to look at the correlation between gene expression and ability of compounds to inhbit cell growth. I contrast to the above poster, I think this is going to be a very valuable tool and I could expand on that if anyone is interested. Also, all this data is available for download at the DTP site, so any of you that think they have a nifty idea on how to mine the data are quite welcome to download and have at it.

I don't know anything about the distributed computinfg effort, but I do know about the microarray data and the NCI Lab. of Molecular Pharmacology. You can find out more about the microarray effort at the Brown-Botstein group at Stanford or at the Weinstein group at NCI. This work is part of a larger effort to characterize the cell lines in the NCI cell line screen. For more information about the cell screen, see the DTP web site. A real quick summary is that >35,000 compounds and >15,000 natural product extracts have been tested for their ability to inhbit the growth of 60 human tumor cell lines in culture. There has been a lot of work that shows the usefulness of analysing correlations in this data. The latest effort is to use the microarray data to look at the correlation between gene expression and ability of compounds to inhbit cell growth. I contrast to the above poster, I think this is going to be a very valuable tool and I could expand on that if anyone is interested. Also, all this data is available for download at the DTP site, so any of you that think they have a nifty idea on how to mine the data are quite welcome to download and have at it.

Obviously text processing of a 33MB data stream is pretty intensive. A simple project might just take a subset of the data. A more complex programming exercise might be to make it a beowulf-aware application.

SuperID

There is no such thing as a "phisical gene", the genes only describe how to sintesize a given peptid, and usually changing the gene affects many things. You can change a gene and change skin color and give the subject some tendency to have short fingers, you can change another and make him process less efficiently fat acids, and you can change BOTH and have him grow a new nose in the armpit, and if you change a third one, that one would inhibit the former changes. Not to mention that many genes overlap between them, so you can't change one without changing the other.

The final results of the project which I was talking about (if you actually understood my post) was that if you have a sequence of DNA pairs and put those into a chromosome and put it into an egg cell, you get out a unique individual. For example, here's the beginning of the first sequence on chromosome 21 according to National Institute of Health.

>gi|8134251|ref|NT_001035|Hs21_443| Homo sapiens 21q sequence /len=219256 GATCTTAGCAGAGTCCTGAAGATGAAGTCCTGGATGAGAGGAAAGCAAGG AAATGGCATC GTGGAAAATATCCTGAAGGATGTTTCGTGGGGGTTGTCCTGGGCAGCACC ATGCTACTGG GAGTGCCACTCACCTGGACAGGTCACCTGGCAGGTGGGCAGCTCTGCACA CCACATACCA CACACACCACATCCCATCCCATCCCATCCCACCCTCATCCCATCCCACCA CTTTTGCTGT

The map doesn't describe a particular gene set, but rather it describes the locus(positions) of the different genes(there's a difference between the position, which is invariable on the same species, and the genes that occupy it, which can be many on any given species).

Of course, people actually downloading the whole human genome probable wouldn't worry about this, but couldn't they use a better compression format than .zip? I bet using bzip2 or rar would shave a couple of hundred MBs off of that 753MB file. Also, the differences in compression techniques would be interesting to see on a large group of files mainly consisting of G, A, C, and T. -- demiurge You find a file that appears important and obliterate it from memory!!! Score one for the downtrodden hacker!

• G -- 00
• A -- 01
• T -- 10
• C -- 11

This would only work for the .fa files, but .fa files can contain "N"s also. If you just want to browse the Genome, look through the pieces directory. .

Of course, people actually downloading the whole human genome probable wouldn't worry about this, but couldn't they use a better compression format than .zip? I bet using bzip2 or rar would shave a couple of hundred MBs off of that 753MB file. Also, the differences in compression techniques would be interesting to see on a large group of files mainly consisting of G, A, C, and T. -- demiurge You find a file that appears important and obliterate it from memory!!! Score one for the downtrodden hacker!

• G -- 00
• A -- 01
• T -- 10
• C -- 11

This would only work for the .fa files, but .fa files can contain "N"s also. If you just want to browse the Genome, look through the pieces directory. .

Disclaimer: I don't know genetics, and never took biology
It appears to be a matter of taking DNA strands, breaking them up into smaller pieces, getting the individual genomes and then mapping everything back into a picture of the original. I didn't realize it until reading on the site that it's very possible to have read the codes backwards, which makes for an interesting twist on things(No pun intended).
The Human Genome Sequencing Progress page shows that they have 21.1% complete data. I assume this means they are relatively certain everything fit right. (Imagine a puzzle with many pieces that fit in more than one place)
I don't know how long until they get it all, but it seems to be paying off already. Of course, once done, they will have a map for one person, not everyone. (As I understand it)
--Mike--

This is a very complete list of security software for UNIX machines.

I was wondering about the changes to Tripwire, so I scrubbed the FAQ and found the following gem:

Will the open source version of Linux Tripwire be as secure as other versions of Tripwire? Explain the risks and advantages for an open source security solution.

An open source solution provides the user and the systems administrator the instructions that allow them to examine it for security holes, Trojan horses and trap doors. It provides an enhanced sense of security for those who would like to have the source code to examine.

Corporate IT managers and security administrators use good judgment everyday by deploying best-of-breed security products. Good security policy dictates that one purchases software or downloads software from the actual security vendor's site and not from "spurious sites" on the Internet. By taking the appropriate steps to create a solid security framework, the security community and the users of Tripwire vastly reduce any risks of the code being modified intentionally for wrongdoing.

--

Want to see something interesting?

Go to this page within the Entrez browser of Genbank. Click Begin Download...and watch:

>gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785 TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT TCAGAAAGGAATTAGTTTACCTACTCATCAGGTGAGGAGACCCACAGAGG GGAAGTCACC TGCCTGACTCCCAGAGACAGAAACAGTGCTGGGACTAAAACCCAAGAAGG GTCCTGACTC CCAAGTCCCAGGAACTTAATTTTCCCCCAGGGAATGGCCCACCACCCACC CAGATGTAAA AACTAGAGACTCTGGGCAGCATTCTATCTCTATGCCAGCCTCCAGTCTCC TGTCTATTTT GCCTCCAAGATACATCTCTAATTTGCCCACTTTTCTTGAACTTCACATCA CCGATCTGGT ACAAGCCATCATCATCTCCTTGCTTGGGCCTACCAAGACACTAATCACTG TTCTTTTTGT TTCGTTTTGTTTGTTTTTGAGACAGAGTCTCATTCTTATCACCCAGGCTG GAGTACAGTG GCATGATCTCAGCTCACTGCAACCTCTGCCTCCCATGTTCAAGCGATTCT CCTGCCTCAG CCTCCCAAGAAGCTGGGATTATTGGCATGCGCCACCACACCAGGCTAACT TCATATTTTT AGTAGAGATGGGGTTTCACCCTGTTGGCCAGGCTGGTCTTGAACTCCTGA CCTCAGGTGA TCCACCTGCCTCGGCCTCCCGAAGTGCTGGCATTACAGGCATGAACCACC ATGGCAGGCT GACTTTCATTCTTTCTCTAGTATTATTAGAATATTCCCAAATAATATTCC ATTGTGTATA TATTCCACATTTTGCTCATTGGTTTCTCATGGTCCGATCTGAGCTTTGGG TAGATCTGGC TATAGGCAGATAATCCCTGAGACATACTGCTAAATGGGAACAGCAGATGC AGAACAGTGT GTATGATACGCTACCACTTCTGCTGGAAAACGTCAAACAGGCACGTGTGC ATACATATGT ACGTGGACTTGGAAAGGCATAGACCGTCTTTGAGAATACTCAAGAAGTGG TTATCTTGGG TAGGAGAGCTGGTGGCGGGGGACAGAAATGGAAAGGAGACTTATTTTTCA CTGGATATAC TTTTGTACATTTTATGGCTTATTAATAATGATTTTATAATTATATTACCA TGATCAAATA AAACCCTTGGTGAATCTTCAATATTCAATAAAAGGCTTGGTTCTTTTAAG CACATATAAA CTTTTTTTTTTTTTGAGACAGGGTCTTGCTCTGTCACCCAGGCTGGGGTG CAGTGGCACA ATCTCTGGCTCACTGCAGCCTCTACTTCCCAGGCTCAAGTGATCCTCCCG CTTCAGCCTC

And so on, so forth, for 33Mb worth...Chromosome 22.

It's a bit dump, folks, with two bits per character. That's it. cat /dev/sequencer | gendump. (Yeah, yeah, abuse of unix commands. Too simple to resist.) Of course, what made this so ungodly difficult was the getting the sequences straight--vast amounts of data, no headers, and a flaky character mode device. Not simple to get this data; they essentially needed to repeatedly run the data through the analyzer and look for patterns which constantly repeated to determine how everything lined up within the chromosome.

We don't know what any of it does, of course. We have ideas, implemented using the crudest of methods. The last time I tried to figure out what a piece of code did by commenting it out, I actually felt pretty good about myself--that's what genetics researchers do, and it is what they're wanting to patent, right or wrong.

We've got the bits. Now we've got to figure out what they do. The entire field of computational biology has been created to decode this mess...I'm truly looking forward to seeing open source genome analysis tools come out of this.

Open Source analysis of a system within which Source has never existed. That should be interesting.

Entertaining tidbit: The CEO of Celera will likely have his own genome sequenced and released publically. Contrary to popular belief, this has nothing to do with the Human Genome Project's threat that "your ass is mine." (Kidding ;-)

Yours Truly,

Dan Kaminsky
DoxPara Research
http://www.doxpara.com

Want to see something interesting?

Go to this page within the Entrez browser of Genbank. Click Begin Download...and watch:

>gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785 TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT TCAGAAAGGAATTAGTTTACCTACTCATCAGGTGAGGAGACCCACAGAGG GGAAGTCACC TGCCTGACTCCCAGAGACAGAAACAGTGCTGGGACTAAAACCCAAGAAGG GTCCTGACTC CCAAGTCCCAGGAACTTAATTTTCCCCCAGGGAATGGCCCACCACCCACC CAGATGTAAA AACTAGAGACTCTGGGCAGCATTCTATCTCTATGCCAGCCTCCAGTCTCC TGTCTATTTT GCCTCCAAGATACATCTCTAATTTGCCCACTTTTCTTGAACTTCACATCA CCGATCTGGT ACAAGCCATCATCATCTCCTTGCTTGGGCCTACCAAGACACTAATCACTG TTCTTTTTGT TTCGTTTTGTTTGTTTTTGAGACAGAGTCTCATTCTTATCACCCAGGCTG GAGTACAGTG GCATGATCTCAGCTCACTGCAACCTCTGCCTCCCATGTTCAAGCGATTCT CCTGCCTCAG CCTCCCAAGAAGCTGGGATTATTGGCATGCGCCACCACACCAGGCTAACT TCATATTTTT AGTAGAGATGGGGTTTCACCCTGTTGGCCAGGCTGGTCTTGAACTCCTGA CCTCAGGTGA TCCACCTGCCTCGGCCTCCCGAAGTGCTGGCATTACAGGCATGAACCACC ATGGCAGGCT GACTTTCATTCTTTCTCTAGTATTATTAGAATATTCCCAAATAATATTCC ATTGTGTATA TATTCCACATTTTGCTCATTGGTTTCTCATGGTCCGATCTGAGCTTTGGG TAGATCTGGC TATAGGCAGATAATCCCTGAGACATACTGCTAAATGGGAACAGCAGATGC AGAACAGTGT GTATGATACGCTACCACTTCTGCTGGAAAACGTCAAACAGGCACGTGTGC ATACATATGT ACGTGGACTTGGAAAGGCATAGACCGTCTTTGAGAATACTCAAGAAGTGG TTATCTTGGG TAGGAGAGCTGGTGGCGGGGGACAGAAATGGAAAGGAGACTTATTTTTCA CTGGATATAC TTTTGTACATTTTATGGCTTATTAATAATGATTTTATAATTATATTACCA TGATCAAATA AAACCCTTGGTGAATCTTCAATATTCAATAAAAGGCTTGGTTCTTTTAAG CACATATAAA CTTTTTTTTTTTTTGAGACAGGGTCTTGCTCTGTCACCCAGGCTGGGGTG CAGTGGCACA ATCTCTGGCTCACTGCAGCCTCTACTTCCCAGGCTCAAGTGATCCTCCCG CTTCAGCCTC

And so on, so forth, for 33Mb worth...Chromosome 22.

It's a bit dump, folks, with two bits per character. That's it. cat /dev/sequencer | gendump. (Yeah, yeah, abuse of unix commands. Too simple to resist.) Of course, what made this so ungodly difficult was the getting the sequences straight--vast amounts of data, no headers, and a flaky character mode device. Not simple to get this data; they essentially needed to repeatedly run the data through the analyzer and look for patterns which constantly repeated to determine how everything lined up within the chromosome.

We don't know what any of it does, of course. We have ideas, implemented using the crudest of methods. The last time I tried to figure out what a piece of code did by commenting it out, I actually felt pretty good about myself--that's what genetics researchers do, and it is what they're wanting to patent, right or wrong.

We've got the bits. Now we've got to figure out what they do. The entire field of computational biology has been created to decode this mess...I'm truly looking forward to seeing open source genome analysis tools come out of this.

Open Source analysis of a system within which Source has never existed. That should be interesting.

Entertaining tidbit: The CEO of Celera will likely have his own genome sequenced and released publically. Contrary to popular belief, this has nothing to do with the Human Genome Project's threat that "your ass is mine." (Kidding ;-)

Yours Truly,

Dan Kaminsky
DoxPara Research
http://www.doxpara.com

Neither of them seems to have reported anything on the news conferences, though.

-hk

I'm not sure that, that is something you can prove but over-cooked beef has been known to cause cancer. This has been pointed out after a study done by the American Association of Cancer Research. This study was done in 1996 so you've had time to hear about it.

Click here for a report

First off, the incentive for professors (and Universities) to engage in basic research has not always been, and need not be, to gain patents. Successful reseach == academic prestige for both the researcher and the Unioveristy. This pays off in many ways (in the professor's case, in how much he or she can command in salery.)

My point was not that academia was uninterested in such grants, but rather that universities will not allow grants which maintain a stipulation that intellectual property belongs to the patent granting agency.

Also, from the NIH web page

2. WHAT IS THE BAYH-DOLE ACT AND WHY IS IT IMPORTANT?

The Bayh-Dole Act encourages researchers to patent and market their inventions by guaranteeing patent rights. This Act automatically grants first rights to a patent for an invention fully or partially funded by a Federal agency to the awardee organization. To obtain these benefits, however, the inventor and the organization have several reporting requirements that protect the rights of the Government.
------------------
There is more at NIH, but the bottom line is that as long as you are up front with them, you retain ALL rights to your intellectual property. You can note that this holds for individuals and small businesses that are awarded grants, but not for larger corporations. And being up front with them is pretty important (you basically fill out a form that discloses the patent filing to them).

I can eat PVC and nothing bad will happen to me.

Besides a stomach ache, there is some risk of cancer from vinyl chloride, though as the link says the migration of VC from PVC is essentially zero. It is bad to manufacture though.

As for legality, hey, man, I just work here.

I'm not surprised the error was caught so quickly. One of the first things that was probably done with the Fly data was to run a sequence matching program (Like NCBI BLAST), to compare it to the known portions of the human genome. The sequence matches would stand out, as they would be ~100% identical. That might occasionally happen for very short sequences, but exact matches with any large portions of the human genome would be highly suspicious.

I think the problem here (Besides egos and bad blood) is that some scientists are still suspicious of Celera's motives and methods, and that they wonder if sometime in the future Celera could (whether accidentally or on purpose) release corrupted data that would be much harder to detect.

To cause damage to animal or plant tissue, electromagnetic radiation needs to either cook it by raising its temperature (lots of watts, like in a microwave or a solar reflector), or have ENOUGH ENERGY PER PHOTON to ionize it. Radio wave and microwave photons don't have enough energy to ionize or break chemical bonds in living tissue. They're less dangerous than infrared radiation (heat). UV, X-rays, and Gamma rays have enough energy per photon to ionize or break chemical bonds in living tissue.

Yes, let's talk photons. It turns out the situation is not as simple as it first seems. The energy from a microwave photon eventually ends up as heat, but you could easily argue that for every other form of EM radiation as well. The question is, what happens in the interval between the time the energy is adsorbed, and the time it ends up as waste heat?

Basically, microwaves set up a rapidly oscillating electric field in the material they pass through. Polar molecules (Such as water) experience a torque that aligns them in the direction of the elctric field, and which changes direction each time the field reverses direction. What makes water an especially good adsorber of microwaves is their network of hydrogen bonds, some of which must be broken to allow the molecules the freedom to rotate with the field (Note--hydrogen bonds break and reform all the time, it's one of the properties that allows water to flow).

Now, what happens to biological molecules is something that is not understood well. We do know, though, that polar molecules will experience forces that unlike those from normal thermal agitation, in that the forces are non-random.

In vitro, microwave energy can cause subtle but repeatable changes in gene expression and protein activity (Such of those like heat shock proteins) in ways that differ from those observed with simply application of heat. Go to PubMed and search for the term "Microwave Exposure", you'll find there is actually quite a bit of research on the subject.

A follow up on Apple:

Apple also makes its iMac line of computers with polycarbonate plastic. This plastic contains bisphenol A.

Apple acknologies the plastic outgasses enough for people to notice the smell.

A list of links from 'it causes testicles to shrink' to 'everything is ok'
http://www.wwfcanada.org/red uce-risk/questionable.html
http://www.sciencedai ly.com/releases/1999/10/991021075812.htm
http://www.niehs.nih.gov/oc/news/seala nt.htm
http://www.doh.gov.uk/hef/bisphena.htm
The Pro BPA page telling you everything is Ok, nothign to see here...http://www.bisphenol-a.org/

Now the question:
Is it socially responsible to
1) be making this kind of machine covering
2) have these computers in schools, where endocrine disruption has more of an effect.

Keep in mind that the Good Design (tm) award given out in Japan was NOT given to the iMac. Why? Because of the use of bisphenol-A. (this is how I found out in fact....)

Five years ago, the NIH (www,nih.gov) funded an investigation into the viability of these methods of vaccination which found that retrovirus research had a good chance of applicability in combating AIDS. I'm still wondering what happened with a lot of the recommendations of the report, but it remains an extremely good read. Also on the NIH page is a much more detailed announcement of another bionanotech conference.

Five years ago, the NIH (www,nih.gov) funded an investigation into the viability of these methods of vaccination which found that retrovirus research had a good chance of applicability in combating AIDS. I'm still wondering what happened with a lot of the recommendations of the report, but it remains an extremely good read. Also on the NIH page is a much more detailed announcement of another bionanotech conference.

Someone else mentioned that there was a 3 month waiting period by the company before release.

Does anyone know if the actual genome is publicly available somewhere? I was thinking of republishing it via Project Gutenberg (we've done the draft human genomes that have been released already).

• Greg

From their press release....they have a map, they don't have the sequence yet. A map is a guide with landmarks as to where major chunks of sequence fall within the genome. Celera has pioneered the approach of shotgun cloning. They randomly capture chunks of the genome and sequence them. If they do this enough times (10-50X genome size) they will ultimately have the entire genome after some sophisticated algorithyms sort the data and place it onto the map. They probably have most of the genome and have a few difficult bits to figure out (some sequences are harder then others to get).

Some searching reveals the NCBI press release. Looks like they have most of the sequence together. I'll bet berkeley provided the map which is allowing Celera to put their info together.

The big question is: Has Celera already filed patents on every ORF it has found; Will the patent office grant the patents; Will Celera get patents on the human homologs of these genes (they have identified most of the homologous sequences from EST's in the human genome project).

And you thought software patenting was fusked.

Celera's private data is being progressively devalued each day as the HGP marches on. In a few weeks, nearly the entire genome will be in the public domain. At that point, Celera might as well release the bulk of their data to the public. Celera can't claim the Government is out to get them, because public release of genomic data has been HGP policy all along.

Interestingly, this is rather like a situation Celera's Craig Venter faced just a few years ago with expressed sequence tag (EST) data when he was at TIGR. At first, the non-profit TIGR had access to the world's largest private collection of human EST data. For months (years?), Venter told the community TIGR would make the data publicly available. But the licensing terms to users gave TIGR the rights to 99% of royalties from discoveries made using their data. Few academic researchers were that interested.

Merck pharmaceutical company then funded Washington University in St. Louis in a big way to generate human EST data and release it immediately into the public domain. Realizing a rapid devaluation of their data (and reputation) as the WashU-Merck project cranked out data at a furious pace, TIGR began trickling its ESTs into the public domain when they matched ESTs already in the public domain from the WashU-Merck project. Kind of a silly gesture of TIGR, but this is a similar situation to what Celera faces today. A big difference today, though, is that Celera has shareholders to contend with. So while Celera would make a big hit with academics by releasing their redundant data, shareholders might be a little unhappy if this happened. Craig Venter may again try to save face by saying he's really a good guy but his hands are tied by commercial concerns, which is essentially what happened when he was at TIGR saying his hands were tied by contractual agreements with Smith-Kline and Human Genome Sciences. As if he wasn't smart enough to know what he was signing onto in the first place!

By the way, the UK government has funded precious little of the HGP effort in Great Britain. The vast majority of the Sanger Center's funding has been provided by the Wellcome Trust. It's really great Tony Blair is speaking out, but the UK government could have done more than just talk the talk.

Finally? The Human Genome Project has been dedicated to public release from its inception.
The general rule worked under is public release within 24 hours, go to any of the genome sites and the sequence is on ftp ready for perusal. It's also in Genbank/EMBL and the japanese (JDB?) database which are all publicly availabe/searchable
Most of the programs used in the genome program are open sourced and have been for as long as I can recall, blast Blast, Crossmatch, phred(the basecaller of choice), phrap(the assembler of choice), consed(a great analysis set of tools) are all at phrap.org
grr, there's no finally these scientists are getting the point about it, the point was clear from the get go.
Anonymous coward

This particular document happens to be related to the US portion of the HGP, but as you can see it has been standard policy, for several years now, to release data as it is generated to public databases. For example, the NCBI Genome Guide, which has both sequence and general information.

DOE-NIH Guidelines for Sharing Data and Resources

At its December 7, 1992, meeting, the DOE-NIH Joint Subcommittee on the Human Genome approved the following sharing guidelines, developed from the DOE draft of September 1991.

The information and resources generated by the Human Genome Project have become substantial, and the interest in having access to them is widespread. It is therefore desirable to have a statement of philosophy concerning the sharing of these resources that can guide investigators who generate the resources as well as those who wish to use them.

A key issue for the Human Genome Project is how to promote and encourage the rapid sharing of materials and data that are produced, especially information that has not yet been published or may never be published in its entirety. Such sharing is essential for progress toward the goals of the program and to avoid unnecessary duplication. It is also desirable to make the fruits of genome research available to the scientific community as a whole as soon as possible to expedite research in other areas.

Although it is the policy of the Human Genome Project to maximize outreach to the scientific community, it is also necessary to give investigators time to verify the accuracy of their data and to gain some scientific advantage from the effort they have invested. Furthermore, in order to assure that novel ideas and inventions are rapidly developed to the benefit of the public, intellectual property protection may be needed for some of the data and materials.

After extensive discussion with the community of genome researchers, the advisors of the NIH and DOE genome programs have determined that consensus is developing around the concept that a 6-month period from the time the data or materials are generated to the time they are made available publicly is a reasonable maximum in almost all cases. More rapid sharing is encouraged.

Whenever possible, data should be deposited in public databases and materials in public repositories. Where appropriate repositories do not exist or are unable to accept the data or materials, investigators should accommodate requests to the extent possible.

The NIH and DOE genome programs have decided to require all applicants expecting to generate significant amounts of genome data or materials to describe in their application how and when they plan to make such data and materials available to the community. Grant solicitations will specify this requirement. These plans in each application will be reviewed in the course of peer review and by staff to assure they are reasonable and in conformity with program philosophy. If a grant is made, the applicant's sharing plans will become a condition of the award and compliance will be reviewed before continuation funding is provided. Progress reports will be asked to address the issue.

To understand genetic engineering you need to understand the technology and also the organism on which it is being used. A fair grounding in general biology, the model organisms used to develop the technology, the basics of molecular biology, some genetics and cell biology is needed. Most genetic engineering is developed by finding out how some portion of biology works, and then imitating it for human purposes. Genetic engineering is like copying source code--scientists study the organism (the original code), and then crudely copy it giving a new genetic engineering technology.

These links can give you a start, but if you are seriously interested, pick up an introductory college text with molecular biology, cell biology, or genetics in the title.

Here are some resources available on the web:

Primer on Molecular Genetics (Department of Energy)

MIT Biology Hypertextbook

Primer on Molecular Genetics from the U.S. Department of Energy

Biotech Applied follow the Biotech Applied and Biotech Chronicles links

(Small) glossary of genetic terms put together by the National Human Genome Research Institute

Info on research (with great graphics) funded by the Howard Hughes Medical Institute

Jim Lund

Genomic (and anti-genomics) Links [To Top]

Mapping the Icelandic Genome. "An Anthropology of the scientific, political, economic, religious, and ethical issues surrounding the deCode Project and its global implications." Contains useful pointers.

Indigenous people's coalition against biopiracy.

The Human Genome Diversity Project as explained by Stanford Professor and posted on the U.N. website.

Various UN reports on the Genome question.

An Outline : Human Genome Diversity Project (HGDP) Background.

Cultural Survival has issue 20.2 (sum 1996) dedicated to 'Genes, People, and Property' issues.

The archive for discover magazine. Nov. 1994 issue has a few articles about genome and diversity.

The gene letter. The Nov. 96 issue has an HGDP article.

High school lesson plan for teaching students about the HGDP.

"The Gene Wars: Science, Politics, and the Human Genome." An excellent book review with bibliography and online resources.

National Human Genome Research Institute (NHGRI) has a Bibliography Page about the HGP.

Ethical, Legal, and Social Implications (ELSI) of the HGP.

The Human Genome Diversity Project: Scientific, Social and Ethical Issues .

A list of articles from Native-L mailing list, listing all articles related to HGDP posted to the list.

Six papers given at various genome-related conferences. Topics include:

*"Why Human Genetics is a Social Science"
* "Racism, Eugenics, and the Burdens of History"
* "Scientific and Folk Idea About Heredity"
* "The Spectrum of Human Variation"
* "The Human Germ-Plasm Project: Eugenics in the 1920s and the 1990s."

Native net letter to HGDP scientists.

Pilot Projects for a Human Genome Diversity Project - Special Competition.

Molecular Anthropology Symposium at Stanford.

Seeds of Destruction. A must read for anyone who eats french fries or is concerned with genetically modified crops.

Also see Patents and Jumpstations.

Comics [To Top]

Angels of Health/Medicine Cartoon by Quino. Here is another one of a dis-orderly girl.

Patent$ and Thing$ [To Top]

An Upside article discussing patents and its history. Very informative.

Gene Patents and Bioethics.

6,000 human gene patents sought in BBC News and also the Washington Post.

American Society of Human Genetics Position Paper on Patenting of Expressed Sequence Tags.

of course the list is continually updated, ... hope this helps, bobbaqATyouknowHOO

Genomic (and anti-genomics) Links [To Top]

Mapping the Icelandic Genome. "An Anthropology of the scientific, political, economic, religious, and ethical issues surrounding the deCode Project and its global implications." Contains useful pointers.

Indigenous people's coalition against biopiracy.

The Human Genome Diversity Project as explained by Stanford Professor and posted on the U.N. website.

Various UN reports on the Genome question.

An Outline : Human Genome Diversity Project (HGDP) Background.

Cultural Survival has issue 20.2 (sum 1996) dedicated to 'Genes, People, and Property' issues.

The archive for discover magazine. Nov. 1994 issue has a few articles about genome and diversity.

The gene letter. The Nov. 96 issue has an HGDP article.

High school lesson plan for teaching students about the HGDP.

"The Gene Wars: Science, Politics, and the Human Genome." An excellent book review with bibliography and online resources.

National Human Genome Research Institute (NHGRI) has a Bibliography Page about the HGP.

Ethical, Legal, and Social Implications (ELSI) of the HGP.

The Human Genome Diversity Project: Scientific, Social and Ethical Issues .

A list of articles from Native-L mailing list, listing all articles related to HGDP posted to the list.

Six papers given at various genome-related conferences. Topics include:

*"Why Human Genetics is a Social Science"
* "Racism, Eugenics, and the Burdens of History"
* "Scientific and Folk Idea About Heredity"
* "The Spectrum of Human Variation"
* "The Human Germ-Plasm Project: Eugenics in the 1920s and the 1990s."

Native net letter to HGDP scientists.

Pilot Projects for a Human Genome Diversity Project - Special Competition.

Molecular Anthropology Symposium at Stanford.

Seeds of Destruction. A must read for anyone who eats french fries or is concerned with genetically modified crops.

Also see Patents and Jumpstations.

Comics [To Top]

Angels of Health/Medicine Cartoon by Quino. Here is another one of a dis-orderly girl.

Patent$ and Thing$ [To Top]

An Upside article discussing patents and its history. Very informative.

Gene Patents and Bioethics.

6,000 human gene patents sought in BBC News and also the Washington Post.

American Society of Human Genetics Position Paper on Patenting of Expressed Sequence Tags.

of course the list is continually updated, ... hope this helps, bobbaqATyouknowHOO

Codon Usage Database
DNA is encoded as a series of nucleotides (G,A,T,C), but interpereted in groups of three, called "codons." This is a database of the frequencies of all 4^3 combinations for various species.

Info on Blast and FastA
We can also compare the genomes of various species to see how similar they are. The above link is a short description of how two of the major programs work, BLAST (Basic Local Alignment Search Tool) and FastA (not an acroynm). There's some theoretical background on genome sequence comparison on Dr. Just's page.

If you want use BLAST to search for for things with similar genomes, just grab your favorite chunk of DNA and take it on down to the BLAST homepage at the NCBI, and let it search for chunks of DNA that are similar.
Don't know any gene sequences for you favorite organism? Then head to NCBI and type its scientific name into the "Search GenBank" box at the top.

If you're tired of this computer stuff, learn how actual DNA is scanned onto microarrays for analysis. Or, better yet, learn to build your own!

(And to think I was browsing Slashdot because I wanted to take a break from studying this.)

Codon Usage Database
DNA is encoded as a series of nucleotides (G,A,T,C), but interpereted in groups of three, called "codons." This is a database of the frequencies of all 4^3 combinations for various species.

Info on Blast and FastA
We can also compare the genomes of various species to see how similar they are. The above link is a short description of how two of the major programs work, BLAST (Basic Local Alignment Search Tool) and FastA (not an acroynm). There's some theoretical background on genome sequence comparison on Dr. Just's page.

If you want use BLAST to search for for things with similar genomes, just grab your favorite chunk of DNA and take it on down to the BLAST homepage at the NCBI, and let it search for chunks of DNA that are similar.
Don't know any gene sequences for you favorite organism? Then head to NCBI and type its scientific name into the "Search GenBank" box at the top.

If you're tired of this computer stuff, learn how actual DNA is scanned onto microarrays for analysis. Or, better yet, learn to build your own!

(And to think I was browsing Slashdot because I wanted to take a break from studying this.)

As a second note, did you know that there are two types of the Ebola virus that have had outbreaks? One was in Africa, which we all saw on the evening news. It killed humans, but could only be transferred by bodily fluids. Since your entire body turned into jelly, there was plenty of that to go around, but still, the infection rate was not critical. The other strain came to North America with a shipment of monkeys. It did not kill humans (only made you sick), but it was airborne!!! Put the two strains together, couple it with a flight out of Zaire to NYC, and...

Do you want to talk about accentuating the positive? Accentuate the fact that genetically engineered crops with the 'Bt' pesticide inserted are killing off Monarch butterflies. Accentuate the fact that frogs are being born with three legs and two heads due to toxins released during paper processing which mimic hormones. Accentuate the fact that we are destroying species at a rate never before seen in the history of the earth since the meteor that killed the dinosaurs! THERE IS A FINITE LIMIT ON GROWTH. That's right - the Dow Jones can't keep growing forever, because natural resources which we depend on are non-renewable! Of course, in a capitalist system which rewards profit as the most noble of motivations, that issue never comes up.

Trees grow at 2% a year. If you cut timber at 2% a year, and kept the amount of forest protected, you could cut trees forever. However, the stock market grows at 10% (at least). It makes more economic sense to cut down the trees now and invest the money. Does that make sense?

However, you say, technology will find us a way out. The Biosphere II project was an example of how we could use technology to live on Mars by generating a natural environment that would support us. Of course, you don't hear much about the Biosphere project anymore, because it failed miserably. Oxygen levels inside the sealed environment dropped to those found at 12,000 feet. Then Nitrogen levels skyrocketed, causing risk of brain damage. Then most of the plants which were supposed to sustain the bionauts died off, and cockroaches and ants began to swarm over everything. Had they stayed inside any longer, they might have died. The lesson this teaches is that we don't know what the hell is going on in the ecosystem! Working in a lab is fine and dandy, but as soon as you take out the fixed variables that the scientific method is based around and throw your invention into the real world, who knows what might happen? There have already been instances of genes jumping from one species to another, for example in the Mad Cow disease incident... Sheep --> Cows --> Humans. Don't get me started.

Sorry for the flames but I strongly disagree with the cheery optimisim which pervades North American society.

The most helpful site that I have found while doing genetics research is the NCBI site at http://www.ncbi.nlm.nih.gov

This site allows access to the enormous amounts of data generated by genome sequencing projects including the Human Genome Project as well as links to research articles about specific sequences. It is especially helpful when researching specific mutations in genes and proteins and what they do to the organism. The attached OMIM database is a treasure trove of genetic disease information.

Important parts of the database include the BLAST section, in which you can search for sequence homology given a short stretch of gene or protein. This is very helpful whether you are querying for either protein or gene.

Another important part is PubMed, which is the place to start for literature searches. Entrez is helpful if you have a specific gene name in mind and want sequence information (genomic sequence, cDNA sequence, protein sequence, and even links to NMR and X-ray structures). LocusLink allows a gene name query to retrieve information about the gene's chromosomal location, alternate names, and related diseases.

All in all, the NCBI site is the most helpful site for on-line queries about specific genes and the Human Genome Project. The site might not be the best for someone who is looking for ready-made answers; there are few clear-cut answers in genetics right now and this site is good for formulating one's one hypothesis based on the real data. The NCBI site also has a small news section that features some of the more interesting finds.

Anyway, I help that this and all the other sites being given help!

Invicta{HOG}

http://www.genesummary.nih.gov

[ Reply to This | Parent ]

One resource I'd strongly recommend is the National Center for Biotechnology Information. I'm a professional working in the field of Proteomics (the protein equivalent of Genomics) and NCBI is an outstanding clearinghouse of information. It also has good links to other sites. If you really want to see some of the science that's going on using genomic information (and are willing to put up with a somewhat dry, utilitarian attitude), it's a good place to look.

Human Genome Project Information:
http://www.ornl.gov/TechRe sources/Human_Genome/home.html

Human Genome Program, Genome Research:
http://www.er.doe.gov/production /ober/hug_top.html

National Human Genome Research Institute:
http://www.nhgri.nih.gov/

On a more philosophical note, when those who are in their adolescence find themselves looking at a generation which has had their genes tampered, there will be prejudice. Lots of it. It can't be avoided.

But what about those who got vaccines at birth? Those who never had to worry about smallpox, polio, etc.? Every generation we go through is healthier than the last, constantly improving. Genetic research will be an issue, obviously, but it's not that unbelivable or radical. Just another step in the same direction.
------------

If I want the gene sequence to a well-characterised species (i.e. one for which there are molecular genetic studies), I can perform a search through the genome database at The National Center for Biotechnology Information and download the base pair sequence for free, in addition to any other sequences that it is evolutionarily related to.

Needless to say, this is a great benefit to biological work.

Given that all of these sequences were obtained by researchers at various universities and institutes, using equipment that is funded by their own grants, why is it that a company with similar equipment needs the sort of reimbursement we are discussing here?

Moreover, if genome sequence information from Joe Public is used in fruitful biomedical research, will he be reimbursed? The historical record suggests not. HeLa cells, for example, were obtained from a female cancer patient whose name is immortalised in the abbreviation "HeLa". They are a ubiquitous "study organism" in molecular genetic laboratories. But I have yet to hear of recompensation for her estate.

there is no convincing medical evidence that moderate use of drugs such as marijuana, alcohol, mdma, and lsd cause brain damage.

Actualy, there is evidence that MDMA causes brain damage.

Serious damage, too.

In parts of your brain which you really want.

Try a quick medline search for "mdma AND neurotoxic."

Plenty of evidence there.

Be careful with X, it can do some very nasty things to your brain with moderate exposure.

So "What can QC do for AI?" Well, if humans are Turing machines, then in principle you can write down my algorithm and run it faster than my own brain can. On a quantum computer you could run my algorithm (ME essentially) not just a constant amount faster (more MHZ or a constant number of parallel processors) but quadratically faster and maybe even exponentially faster. It's not clear that "faster" would lead to more intelligence but I'd be surprised if you never ran out of time on an exam-- in those cases Faster would be smarter.

So, "What can QC do for Evolution?" We are in the proccess of decoding all 3 billion bits of the human genetic code. The specific arrangement of 3 billion bits came into existence through an evolutionary process over generations and generations of organisms (ultimately humans) on this planet. Now imagine we simulate that process. [We used to do this for fun in high-school] On a quantum computer entirely new ways of searching the available state space emerge-- once again we have a minimum of quadratic improvement on exhaustive search (for a QC) and exponential improvements are possible. That means my evolutionary simulations on a QC will be much richer and more interesting than your simulations on a classical computer.

Clearly, the simulation of evolution is not the same thing as evolution itself. My genetic algorithms will evolve more interesting behaviour than yours if mine run on a quantum computer-- that's the best --I-- can do. In "Quantum Evolution" a book that I haven't read McFadden tried to make a strong connection between QC and Evolution and previously I posted an Amazon link (lots of reviews there) that explores this QC-Evolution connection. I've read that book and I still can't explain the Many-worlds-evolution thing! Deutsch book is, for the most part, sound so maybe this new "Quantum evolution" thing is sound too. You can NEVER judge science by the press-releases. Look at this as an example. The journalists are actually talking about an experimentally verified technique (Quantum teleportation) that might be used to help us build a practical quantum computer. Did you get that from the article?

A. Wait.

and here is the abstract:

Biosystems 1999 Jun;50(3):203-11

A quantum mechanical model of adaptive mutation.

McFadden J, Al-Khalili J

Molecular Microbiology Group, School of Biological Sciences, University of Surrey, Guildford, UK. j.al-khalili@surrey.ac.uk

The principle that mutations occur randomly with respect to the direction of evolutionary change has been challenged by the phenomenon of adaptive mutations. There is currently no entirely satisfactory theory to account for how a cell can selectively mutate certain genes in response to environmental signals. However, spontaneous mutations are initiated by quantum events such as the shift of a single proton (hydrogen atom) from one site to an adjacent one. We consider here the wave function describing the quantum state of the genome as being in a coherent linear superposition of states describing both the shifted and unshifted protons. Quantum coherence will be destroyed by the process of decoherence in which the quantum state of the genome becomes correlated (entangled) with its surroundings. Using a very simple model we estimate the decoherence times for protons within DNA and demonstrate that quantum coherence may be maintained for biological time-scales. Interaction of the coherent genome wave function with environments containing utilisable substrate will induce rapid decoherence and thereby destroy the superposition of mutant and non-mutant states. We show that this accelerated rate of decoherence may significantly increase the rate of production of the mutated state.

PMID: 10400270, UI: 99325857

ok, over and out.

The sliced-up person mentioned in the article has his homepage here. There's also a nice Java applet to view slices of him here.