Slashdot Mirror


DNA-Based Steganography Wins Intel Education Award

to'c wrote: "17-year-old Viviana Risca wins US$100,000 from Intel for her work in 'DNA-based Steganography.' Talk about combining hot technologies! With a bit of gene-splicing, that next pigeon you clone wouldn't need to carry a message. It would be the message! Full story here." Interesting test message she chose, too.

190 of 246 comments (clear)

  1. You did! by Anonymous Coward · · Score: 1
    I would have cloned myself and skipped school.

    You did! But it's your bad luck to be the clone!!

    Ever notice how there's less money in your checking account then you think there should be? That's me ... your original ... buying stuff that I need. So get back to work -- I want to buy some more CD's!

  2. Definitely a Public High School by Anonymous Coward · · Score: 1

    It's definitely a Public High School. See here. So much for those who think that public schools are necessarily trash. If you look at the record of past finalists you'll see that a very large percentage are from NY city and Long Island (Port Washington is on LI). Since I live in that area (pardon the local chauvinism) I can tell you that the majority of those finalists came from public schools.

    1. Re:Definitely a Public High School by Troll+Boy+2 · · Score: 1
      It's definitely a Public High School. See here. So much for those who think that public schools are necessarily trash. If you look at the record of past finalists you'll see that a very large percentage are from NY city and Long Island (Port Washington is on LI). Since I live in that area (pardon the local chauvinism) I can tell you that the majority of those finalists came from public schools.

      GEE, MAYBE OTHER HIGH SCHOOLS DIDN'T PARTIPIPATE?

      --
      You know you want to give me -1 Troll
  3. Severe consequences by Anonymous Coward · · Score: 1

    >With a bit of gene-splicing, that next pigeon you clone wouldn't need to carry a message. It would be the message!

    This would have severe consequences, rippling throughout the IETF. RFCs 1149 and 2549 would have to be completely rewritten.
    RFC 1149
    RFC 2549

    The preceeding has been a humorous message. Moderate accordingly.

    1. Re:Severe consequences by maan · · Score: 1

      Wow! I had no idea that RFCs like this existed! This is really great! And who said that computer people had no humor???

      Maan

  4. Mt. Sinai School of Medicine ... by Anonymous Coward · · Score: 1

    Viviana was an author on the paper, part of a research group from Mt. Sinai School of Medicine in New York. The other authors were quite senior (one was a professor, the other at least a post-doc, from this story.

    1. Re:Mt. Sinai School of Medicine ... by JunkDNA · · Score: 1

      WOW! Published in Nature as a HIGH SCHOOL student...boy do I feel behind the curve. I can't wait to see the papers she publishes in college.

  5. Re:Intel STI by jbuhler · · Score: 1

    So why did Westinghouse give up sponsorship of the contest anyway? I can't imagine that it was just about the money.

    What's next: will Microsoft take over sponsorship of RSI? If that's already happened, don't tell me -- just shoot me now.

    Jeremy (RSI '91, but didn't have a project worth submitting to Westinghouse)

  6. In _my_ DNA by Pseudonymus+Bosch · · Score: 1

    So might there be a message in my DNA from those superadvanced but uncommunicative aliens that shaped apes into mankind?
    Maybe a lossily encoded one so that it stands across millenia?

    Something like a fuzzy certificate of a intergalactic patent on human beings? :)
    --

    --
    __
    Men with no respect for life must never be allowed to control the ultimate instruments of death.
    GW Bu
  7. Re:Pretty cool, but why only for Americans? by Quinn · · Score: 1

    Maybe it will make you feel better to know that at least three of them were born outside the US. I stopped counting there, because I am a lazy American white boy. I only read the story because I saw "Viviana", "17", and "hot" in the summary.

    --

    --
    #19845
  8. Re:Cool Lab Work - but Bad Crypto! by hobbit · · Score: 1
    Changing the way something is represented is the definition of encryption...

    Wrong! Ig0r has already told you: "I think you're using 'encrypting' when you should be using 'encoding'." Changing the way something is represented is the definition of encoding.

    Hamish

    --
    "Wise men talk because they have something to say; fools, because they have to say something" - Plato
  9. mmmmmm by aphr0 · · Score: 1

    Is she sexy?

  10. bullshit by aphr0 · · Score: 1

    She won because she's female. She didn't do anything new or exciting. She took existing technology and just put it together. She didn't innovate at all. The second place kid deserves it more than she does. I hate it when girls get things just to stimulate female interest in technology. If women aren't as good at it, then so be it. They shouldn't win if they aren't as good as the males.

    1. Re:bullshit by aphr0 · · Score: 1

      I get plenty of day-to-day contact w/ men. Who needs women? Sexy..

    2. Re:bullshit by Potatoswatter · · Score: 1

      Check out this guy's e-mail address. Mebbe he doesn't get enough day-to-day contact w/ women...

      Where is my mind?
      mfspr r3, pc / lvxl v0, 0, r3 / li r0, 16 / stvxl v0, r3, r0

      --

      Check out Project Upper/Mute, an all-around awesome compiler fra
  11. Re:Interesting, but don't let's start... by PD · · Score: 1

    You should remember that security by obscurity is no security at all.

    If you're going to use steganography, make sure that you're hiding *encrypted* data away.

    The recent shouting in England was all about the courts forcing you to turn over the keys if they find encrypted data in an investigation. If you don't have the key, or you lost the key, off to the pokey you go.

    Steganography when it's done correctly will most likely prevent the authorities from becoming aware of encrypted data at all. But if they do manage to discover it, another layer of encryption will stop them cold.

    Furthermore, encrypted data should look statistically random. They'll have a hell of a time proving that they've got encrypted data and not some kind of random figment of their imagination.

  12. Clay pigeons by swerdloff · · Score: 1

    What happens? You encode yer bird, teach it to fly to the specific place you want, and then dissect the thing?

    1) The ASPCA is gonna have a FIELD day.
    2) What the hell sort of critter are you going to breed for this? Homing pigeons? Teach it to go home, just once, before you slice it to ribbons?
    3) High ickiness factor here.

  13. Re:that's her work by Noehre · · Score: 1
    And I'm sure she did a lot of work on the project. I can work with a bunch of grad students and professors and get papers published too (and I do! Just that I'm an undergrad working with some upperclassmen :P). I would like to know much much of the work done on this project is her own and how much she acted as a 'lab assistant.'

    Doing research and being involved in research are two completely different things.

  14. moderate parent back up, please by esk · · Score: 1

    (alas, my poor karma.)

  15. Re:Please don't post stories like this... by Anonymous+Shepherd · · Score: 1

    Posting these stories does nothing to you if you are a gibbering idiot and your self esteem is crumbling.

    I would suggest therapy, or pursuing positive and constructive activity.

    Okay, I'm sorry; I'm feeding the trolls, and I'm being cruel to those who legitamately suffer from poor self esteem. But I'm in a strange mood, and want to respond to this one.

    -AS

    --

    -AS
    *Pikachu*
  16. Re: Your Sig by FatSean · · Score: 1

    Guess Momma Listen Up shouldn't be expecting grandchildren any time soon, eh? MmmmmHMMMM! I sure do love some Revisionist History.

    --
    Blar.
  17. Re:This is old news... by QuMa · · Score: 1

    Not only that, but there's also an ST:TNG ep about that.. ;-)

  18. Re:What about her education by mwillis · · Score: 1

    She is Romanian. This information, and more, is in the article.

  19. Re:Pretty cool, but check out the second place win by Emilio · · Score: 1

    Yes,
    1^3 + 12^3 = 1729 and 9^3 + 10^3 = 1729

    but be careful, 1729 is the smallest positive integer that can be represented as the sum of two *positive* cubes in two different ways.

  20. i dont wanna come off... by confidential · · Score: 1

    i dont wanna come off sounding evil-steriotypical-maleish, but is it just me or did the part of the article saying, "First in her class, Viviana is managing editor of the school's literary magazine, and has won numerous science and writing awards. A native of Romania and a published poet, she enjoys computer programming, painting and badminton, and hopes to attend the Massachusetts Institute of Technology." sound like a dating service description?

    1. Re:i dont wanna come off... by mreece · · Score: 1

      Well, the descriptions may sound that way... All the bios of the finalists (I was one) are put together by Intel based on our applications. The application asks many questions about hobbies, interests, membership in clubs, and so on, and the Intel PR people put together the bios based on that. So yes, they don't always come out the way we would prefer to have ourselves described.

      --
      Matt Reece
    2. Re:i dont wanna come off... by Ophelan · · Score: 1
      Sounds like my kind of chick! Oh wait, didn't say anything about reading SlashDot, nevermind. At any rate, I don't see myself at MIT next year. Maybe my masters...

      On a more on-topic note, any idea what she is planning on studying in school? Computer science and biochemistry would seem like obvious choices, but who knows. At any rate, I commend her for her efforts.

      Daniel

      ---

    3. Re:i dont wanna come off... by Psinoside · · Score: 1

      ....enjoys dancing, talking, long walks on the beach, and is not afraid to cry. Also likes to be ticked. Presently in good financial status.

  21. Re:No picture??? by DaEvOsH · · Score: 1

    Go to google, search with her name... there she is...

    :)

  22. Re:Pretty cool, but check out the second place win by nEoN+nOoDlE · · Score: 1

    yeah yeah, we all saw Good Will Hunting

    --
    Don't trust a bull's horn, a doberman's tooth, a runaway horse or me.
  23. Watch out by Other · · Score: 1

    And you thought Intel's p3 serial numbers were bad
    Maybe we can give each human a DNA serial number for "better shopping security"

    1. Re: Watch Out by Lockle · · Score: 1

      Sorry to tell you but identical twins have different DNA. Only clones are truely identical. You can't kill your neighbor and have your twin to take the rap. An interesting note: Recently in England, someone was going to be charged with a crime because the DNA at the scene matched his DNA in the UK DNA database using the standard 6 point test, but when he objected and they tested it with a 10 point test, it was proven that he was not the criminal. I do not remember the exact odds, but I believe they were greater than the population of the earth. Things that make you go hmmmm.

  24. ...when you can just use M&Ms by VP · · Score: 1

    Off topic, I know...

    1. Re:...when you can just use M&Ms by Giant+Robot · · Score: 1

      Using SGI computers to simulate the M&Ms
      of course ;-)

    2. Re:...when you can just use M&Ms by psergiu · · Score: 1

      ... using the new alias|wavefront renderer for linux on a beowolf cluster

      --
      1% APY, No fees, Online Bank https://captl1.co/2uIErYq Don't let your $$$ sit in a no-interest acct.
  25. Re:Interesting, but don't let's start... by Omar+Djabji · · Score: 1

    you don't need a copy of the original.

    You just encode the message in the least signifigant bits of each pixel.

    If the real bit is the desired crypto bit, you leave it. If it is not, then flip the bit.

    To decode the message you just read off the least signifigant bits.

  26. Re:Let's set the story straight by vanth · · Score: 1

    I presume by your adamant claims that you
    were a first hand witness to the accounts of
    Rosalind Franklin and Watson/Crick??

    If not, you really have no basis in fact, and your
    claims of women being denied credit (as far as this case is concerned) seems to be nothing more than FUD disguised as righteous indignation.

    just my 2 cents worth.

  27. She would be a GREAT Slashdot Interview! by ehiggins · · Score: 1

    Rob, Hemos, are you reading?

    Any shot at getting her for a Slashdot Interview?

    --Earl Higgins

  28. Re:Unbreakable Code? by Dreamweaver · · Score: 1

    Wouldn't really work.. the message (and the primers) are just more dna pairs (you know, the old TAGCCAGTTGetc). Given such a limited vocabulary to encode in, you'd need a number of pairs for each character in the message.
    You'd need to know not only that there Is a message, but also where to begin decoding (if you start at one point you get 'hello world' start a couple pairs down and get 'rglno9p:f' and the encoding scheme used ('TAGACCATA' == A). If you just scanned the whole thing (which would, with current technology, take a hell of a long time) you'd get probably hundreds of possible messages even if you knew the encoding scheme. Not to mention the possibility that the message itself is encoded.. i don't think this will become an encryption standard, but it could certainly be useful for those messages that just have to be sent securely for military purposes.
    Dreamweaver

    --


    "If a man hasn't discovered something he will die for, he isn't fit to live" -- MLK, Jr.
  29. I'm in for something ... by timothy · · Score: 1

    I'll gladly contribute some money toward a fund that would go for scholarships for young programmers, as long as it had terms I liked. Creating scholarships which recognize other than conventional success or goals is a tough task, because the reason that deserving people are often passed over as 'underachievers' is precisely because it's hard to tell from the outside what in particular makes a particular person deserving of support unless they wear it on their sleeve.

    I'm far from a millionaire, or even a hundred-thousandaire ;), but if a few hundred people gave $100 apiece to establish an interest-bearing fund, there could be money to fund several small scholarships. Maybe not $100,000, though you have to respect Intel for giving that much. Unlike scholarships from the NSA, Intel can't demand that you work for them after school :)

    And I hereby suggest a domain name which has been floating in my head for a bit for an organization built to fund / sustain small scholarships or other funding projects: "cumulativity.org" (as in cumulative).

    timothy

    --
    jrnl: http://tinyurl.com/c2l8yr / foes: http://tinyurl.com/ckjno5
  30. that's her work by mreece · · Score: 1

    Notice the second name in what you wrote:

    Clelland, C.T., Risca, Viviana, and Bancroft, C. (1999). Hiding messages in DNA microdots. Nature 399, 533-534

    "Risca, Viviana" would be none other than Viviana Risca, the winner of the Intel Science Talent Search. Same person, same research.

    --
    Matt Reece
    1. Re:that's her work by Stonehand · · Score: 1

      If she did it while at RSI, she almost certainly did a LARGE portion of the work. It's a research-oriented program (e.g. it's basically your full-time job for all but the first and last weeks, IIRC), not a part-time job where profs just need an assistant.

      --
      Only the dead have seen the end of war.
  31. Re:This used to be called Westinghouse. by mreece · · Score: 1

    Yes, Intel is more or less just footing the bill. But that's what Westinghouse used to do, until two years ago. Science Service is the organization that arranges most of the activities, and has been (as far as I know) since the competition started in 1942.

    --
    Matt Reece
  32. math projects in the top ten by mreece · · Score: 1

    I found it very interesting that so many abstract mathematics projects placed in the top ten. Jayce Getz (from Montana) did the project extending one of Ramanujan's theorems, dealing with partitions. That placed 2nd.

    In 4th place, Sasha Schwartz (from Pennsylvania) worked on coset partitions of Abelian groups.

    And then in 9th place, there was Zach Cohn (from New York) with work on quadratic reciprocity in certain polynomial fields.

    So, that's three abstract mathematics (i.e. number theory and group theory) projects. It surprised me. I thought that the Intel judges were looking for things that had immediate applications that the public could understand. Apparently they weren't. That was a pleasant surprise. I think the math projects were all at a very high level and I'm glad to see them recognized. Of course, all 40 finalists had very good research, and I'm glad I didn't have to try to choose the best among them...

    Anyway, I just thought I would point out that there were several very interesting pure math projects at the competition and they all did very well.

    --
    Matt Reece
    1. Re:math projects in the top ten by latcarf · · Score: 1
      Original mathematics is usually done by the young. The subject of the fourth place finalist, Abelian groups was done by Abel 1828 when he was 26 -- he died in 1829 having created new branches of mathematics. Ramanujan's genius was apparent at 15 although he first published in 1911 at age 23. His work on the partition of numbers was done in his twenties and he died in 1920 at the age of 32. As G.H. Hardy laments in "A Mathematician's Apology", the real mathematics is done by the young.

      --
      Madmen in authority, who hear voices in the air, are distilling their frenzy from some academic scribbler of a few years
  33. Re:Westinghouse by mreece · · Score: 1

    The Westinghouse competition became the Intel competition two years ago. So perhaps it would be more correct to simply say "The STS is America's oldest...."

    --
    Matt Reece
  34. anyone else feel dumb? by irishmikev · · Score: 1

    Who else feels like they wasted some serious time in high school. Apparently it's not only impossible to keep up with really smart peers...but also really really smart youngun's...

  35. Re:Intel STI by sesquiped · · Score: 1

    > She does attend a U.S. school

    It's Schreiber High School in Port Washington, NY

  36. Re:How about scholarships young OS programmers by sesquiped · · Score: 1

    You can enter computer science projects in the STS, just like any other area of science. (I did.) They compete against all the other projects from different fields. The thing is that the project has to be about "computer science" not just programming. There has to be science involved. However, if you're intelligent enough to work on open source projects and make intelligent contributions, you're probably intelligent enough to put a "science" spin on whatever work you did to make it worthy of an STS project.

  37. Re:Equipment by sesquiped · · Score: 1

    I do agree with what you say here. In fact, I wrote just that in the last sentance of my original comment. I get the feeling you didn't read that far into it.

    Just as a little more anecdotal, and probably invalid, evidence, for 1999, I knew somewhat personally the 4th and 10th place winners in the STS. I can say with confidence that the 10th place person was much more intelligent than the 4th place person. Of course, they were both very intelligent. My original point is just that it's more than intelligence that's judged in this thing. Effort is a huge factor, and the smartest people don't always display the most effort.

  38. Credit where credit is due by parvati · · Score: 1

    This work was done, and published, by Dr. Carter Bancroft at the Mount Sinai School of Medicine. The girl may have worked in his lab, but the work is his. When the media covers contests like this, they make it seem as if the kids are the ones who thought up all these fantastic ideas. Really, the kids are nothing more than lab technicians (I know, because a Westinghouse student was in my thesis lab)--they do some work, but no actual thinking. It's good that they have a chance to pursue their interest in science, but what they do shouldn't be mistaken for genius.

  39. I agree with the Anonymous Coward who said... by cr0sh · · Score: 1

    While I applaud what these high school students have done, as well as all of their hard work, I still have to agree with the AC who wrote:

    I'm a high school Junior who is interested in cryptography and OS programming and a whole bunch o' stuff. How can ppl actually do such major research? or know enough to do it? or even have resources to get to this equiptment? I'd like to do these experiment and research but ppl like me are limited in what they can do. I don't understand how ppl at such an age can have the ability to do things.

    I really agree with this statement, and I am not even in high school anymore! I wonder what exactly this girl did? For her peers who won the other prizes, at least one can guess what was done and how it might have been done, but how was she able to do what she did?

    Did she really splice the DNA? Somehow I doubt it - I mean, in order to encode the DNA, she would need not only a way to splice it (which, as I understand it, isn't extremely hard. I think that part can be done using a small lab setup, because most of the work is done in a test tube, via RNA - but in a particular predetermined sequence of base pairs?), but also a way to sequence the DNA as well (in order to check the encoding, to verify it is valid).

    Or am I way off base (no pun intended) here? Someone, please correct me if I am completely wrong, because I would love to know how one can do this in thier own home (or at least a small lab)!

    I can only think of one way she could have done it, and wouldn't have needed a lot of equipment (in fact, she would only need a computer):

    1. We know what the base nucleotides are - Adenine (A), Guanine (G), Cytosine (C), and Thymine (T).
    2. These bases form pairs which make up the DNA helix ladder strand - pairs like A-T or C-G.
    3. The pairs in the ladder could be encoded to represent a binary stream - ie, A-T equals 0 and C-G equals 1. More complex encoding could be done by using other base pairs.
    4. With a computer, write a program that can take a message, and spits out "DNA sequences" of base pairs for keys and can encode a third "DNA sequence" of base pairs with the message using those keys.
    5. Theorize how such DNA strands could be inserted and used to convey "secret" information via another living organism.

    This is the only way I can see a high school student doing such a thing in his or her home. I don't really know how one would be able to do this stuff "by hand" with real DNA (In other words, how do you build a DNA strand, by hand, one base pair at a time, in a predetermined sequence? Can this even be done with current technology?).

    If this was all that was done, then it would still leave the exercise in the realm of theory (the theory that one could of encode base pairs in a DNA strand to convey secret information). If a student did such a thing, it would be interesting, but would it warrant a $100,000 prize? I can see where actually doing the sequencing and splicing of real DNA would, but not a simulation...

    Can someone enlighten me?

    --
    Reason is the Path to God - Anon
  40. heh... by cr0sh · · Score: 1

    I read a little further down, and found out the Miss Risca was working with two others on this: Carter Bancroft and Catherine Taylor Clelland.

    What is strange is that no mention of this is given in the articles about the prize, which makes it sound like Viviana was doing independent research, when in fact, she was part of a team who seems to have been doing research for at least a year on the subject (see this BBC article, which is dated June 10,1999).

    From what I have seen, which has mentioned these two other researchers, Viviana has gotten "low billing", so to speak. It makes me wonder what her role in the research is. She must have done some work, enough to understand what was going on, to do a science fair writeup.

    I still wonder about this prize, though. I mean, she did all of this, with access to the equipment and such, and people who REALLY knew what they were doing. How did she get on this team? Did she go up to them and say "Hey, I like the stuff you are doing, and it interests me - can I be a part of your team, and help you out?". This whole thing just sounds odd - it would be a totally different thing if the work she did was performed on her own, in her own home or at the school lab. But she obviously didn't - she had access to a lab with the right equipment and to others with more knowledge working in the field. How many of the other students had that option? How many independent adult "backyard" researchers have this option? It is almost like she was more apt to get the prize by who she knew, and not by what she did.

    Of course, I guess since that is how things seem to work in the real world, maybe she got some good experience after all?

    --
    Reason is the Path to God - Anon
  41. Re:Wasn't this done before? by BlahSnarto · · Score: 1

    I do recall seeing this somewhere as well ..

  42. Re:Equipment by m3000 · · Score: 1

    WOO HOO! I got an English lesson for free from an AC!

  43. Re:What about her education by m3000 · · Score: 1

    I was wondering that too, because there is no way a regular public high school would have the neccasary equipment to interact with genes the way she did. I guess she could have done it at a local university, but again, I'm wondering how she would gain access to the equipment neccasary to do that stuff (I'm assuming that the equipment is fairly expensive and complicated)

  44. Re:Equipment by m3000 · · Score: 1

    About the valedictorian part, I agree whole heartedly. The way that kind of thing is calculated at my school is so screwed up, taht some of the smartest people I know have no chance of becoming the validictoran. It's SOLEY based on how many honors/AP classes you took (assuming you get a A in every course, every semester, which isn't TOO hard to do, and which quite a few people, including me, do). True, they are hard workers, but the person currently in one of the top spots is one of the last I'd pick to be validitictoran out of all the smart people in our school.

  45. and in the news today . . . by Beached · · Score: 1

    I can see it now: Mother travelling with her newborn infant is arrested for exporting arms outside of the US. She apparently encrypted a message inside the DNA of her child. . .

    --
    ---- aut viam inveniam aut faciam
  46. The medium by 1010011010 · · Score: 1

    The medium is the message... is the pigeon...


    --
    Napster-to-go says "Fill and refill your compatible MP3 player", which is a lie. It's not MP3. It's WMA with DRM.
  47. Pun! by jovlinger · · Score: 1

    rapt / wrapped

    That was one of the better puns I've seen in a long time.

    Johan

  48. Re:Intel STI by jovlinger · · Score: 1

    c'mon people. that was funny. :-)

  49. Re:Cool Lab Work - but Bad Crypto! by jovlinger · · Score: 1

    The contribution is being able to locate the message in the DNA -that's where the primers come in. It's a simple pre/postprocessing step to make the hidden message conform to whatever statistics you want.

    A more sagacious question is _do the primers_ conform to the relevant statistics? Well, punk, do they?

  50. Re:No picture??? by pipeb0mb · · Score: 1

    Scumbag. Learn some respect.
    I emailed your boss.
    Have a nice day.


    "Don't try to confuse the issue with half truths and gorilla dust."
    Bill McNeal (Phil Hartman)

  51. Re:No picture??? by pipeb0mb · · Score: 1

    but the real lesson here is that you should worry about yourself, and stop throbbing in your own insecurity as to having to "tattle" on others.

    No, I think the real issue is that a 17 year old genius, who happens to be a female, was referred to as a slut, by someone claiming to represent a large ISP in the United States. People sometimes go to JAIL over things like that, and people definitely lose their jobs. If this really was the work of your 'friend', you should evaluate your peers.
    Have a nice day.

    "Don't try to confuse the issue with half truths and gorilla dust."
    Bill McNeal (Phil Hartman)

  52. Hey, you sound like a jerk! by Gorimek · · Score: 1

    Just kidding. Really. Look --> :-)

    1. Re:Hey, you sound like a jerk! by JunkDNA · · Score: 1

      Well yes, I am a jerk. :) I should've checked PubMed before opening my mouth!

  53. I can't help but comment... by Bedemus · · Score: 1

    Not that this post shouldn't have been moderated down, but how on earth can post number one be marked "redundant?" Wouldn't the other posts saying the same be the redundant ones, and not the first? Ah well...

  54. Re:Cool Lab Work - but Bad Crypto! by norton_I · · Score: 1

    The point is, unless your DNA *normally* looks like "JUNE8_INVASION: DEMNARK JUL4_INVASION: ELBONIA" you are going to notice a message if it isn't hidden better than that. A real-ish way to do this is to have the first key be the lead in sequence, and the second be a key for a pseudo-random number generator that gives you positive increments of "where the next letter is". Thus to decode it you need to find the lead in sequence, and then follow the jumps dictated by the psuedo-random sequence. Unless you know both, it only looks like DNA.

    Unfortunately, the more you spread it out, the more difficult it is to dodge the significant parts of DNA (assuming you mind). It is also much more expensive requiring many more splices and more sequencing, and is less damage tolerant because any insertion or deletion defect (if the DNA is actually reproducing) will cause the sequence to be corrupted.

  55. Re:What about her education by psergiu · · Score: 1

    We Romanians RULE !

    --
    1% APY, No fees, Online Bank https://captl1.co/2uIErYq Don't let your $$$ sit in a no-interest acct.
  56. Re:Can Anyone Say... by psergiu · · Score: 1

    The mices will be angry.

    ... hey, why is the sky filled with ugly yellow spaceships ? ...

    --
    1% APY, No fees, Online Bank https://captl1.co/2uIErYq Don't let your $$$ sit in a no-interest acct.
  57. Re:Intel STI by psergiu · · Score: 1

    > Some of the questions are things that no one knows...

    Like:

    State your reply in form of a question. The answer of the qustion is "42".

    --
    1% APY, No fees, Online Bank https://captl1.co/2uIErYq Don't let your $$$ sit in a no-interest acct.
  58. Re:Equipment by Stonehand · · Score: 1

    And it's not limited to U.S. students either; when I was there, somewhere around a third or a fourth of the participants were internationals.

    For all those who haven't reached their senior year in high school (if memory serves, and things haven't changed, folks are eligible for the summer before their last year in HS), consider the program. If they accept you, they'll try to match you with a research lab in the area (in '93, most folks were placed in labs at MIT itself; some of us, such as m'self, were in external labs affiliated with the program, like MERL), a mentor, and a project. During most of the program, you'll be doing original research work in this arrangement. And for those that are eligible for the STS (e.g. NOT scions of Intel employees), RSI/CEE will help you through it.

    So the eligible folks should seriously consider applying...

    --
    Only the dead have seen the end of war.
  59. Re:$100K!?! HA! by Inoshiro · · Score: 1

    AFAIK, all universities are controlled by their own local boards, but do receive government money for projects taken by professors for the government and for the students that take the courses. They are, in that sense, government funded (Canada has the separate provincial governments, under the central federal government).

    Given the rate of exchange the 2K US for a US U would likely work out to 3.2K Cdn, which is easily enough for tuition + books at any university, even the fancy-smancy U of T :)
    ---

    --
    --
    Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
  60. Re:Equipment by Alton · · Score: 1
    While it is true that in some cases, wealth begets wealth, don't forget about all of us out here who, at 25, are earing as much as both of our parents put together. Why? Because our parents encouraged us to do well and we worked hard and EARNED everything we have. And now we have great jobs and make great money due to our hard work.. and constantly get criticized because we make more money than other people.

    Sorry. I guess I just felt the need to rant this morning.

    --
    "Anyone who can't laugh at himself is not taking life seriously enough." - Larry Wall
  61. $100K!?! HA! by TheJoelMan · · Score: 1

    ... hopes to attend the Massachusetts Institute of Technology. How's she going to pay for her fourth year at MIT?

    --

    24-hour banking!?! I don't have time for that.
    -- Steven Wright

    1. Re:$100K!?! HA! by Insanik · · Score: 1

      I bet ya intel'll give her a summer job :)

    2. Re:$100K!?! HA! by stripes · · Score: 2
      100,000$ US would last for aprox 20 years, without any form of interest or savings program (also not taking into account inflation), at most Canadian universities assuming 8,000$ Canadian is spent per year (average residence + fees + food + "small" disposably budget). Why get a masters from MIT when you can get a Ph.D in several things from the U of C? :-)

      US$100,000 is far more then is needed in many US universities. In 1992 a semester at the University of Maryland (for Maryland residents) cost under $2,000. I don't know what the current prices for state-subsidised universities is, but it isn't unreasonable to expect the price has gone up a lot, but I doubt it is all that diffrent from the CA prices.

      On the other hand many of the top Universities are not public funded (many are), the US budget is irrelevent to them. The privately funded Universities are expensave to go to because they are expensave to run. The continue to exist because some of the people with money to spend on their children's (or their own, or others') education thinks they are worth it. Doesn't CA have private Universities? Or are they all state-subsidised?

    3. Re:$100K!?! HA! by Inoshiro · · Score: 2

      Perhaps she should go to a Canadian college then. US Universities are .. insanely expensive, due to the US budget people deciding that military spending is better than subsidizing the education of its citizens.

      100,000$ US would last for aprox 20 years, without any form of interest or savings program (also not taking into account inflation), at most Canadian universities assuming 8,000$ Canadian is spent per year (average residence + fees + food + "small" disposably budget). Why get a masters from MIT when you can get a Ph.D in several things from the U of C? :-)

      Of course, with proper investment, the girl could come to Canada, and retire around age 40 with such a head-start towards "critical mass" with her money. Read "The Wealthy Barber" if you want to know more about this :-) (It's a Canadian finance book)
      ---

      --
      --
      Internet Explorer (n): Another bug -- that is, a feature that can't be turned off -- in Windows.
  62. Re:Watch out slightly OT by puppet10 · · Score: 1

    Actually isn't this what biometrics is all about, your "DNA serial number" is just your thumbprint, iris pattern, retina, etc.

    This has been used for quite a while at high security government facillities, and is starting to move into main stream applications, and yes privacy issues are coming up. (IMO the best solution to the privacy issues is that the "vendor" or whoever does not store your information in their systems, your info is simply compared to the information on your card to verify your ID)

    --
    -------- This space intentionally left blank --------
  63. Re:Cool Lab Work - but Bad Crypto! by astrophysics · · Score: 1
    > Stashing a secret message in a bunch of a DNA has a good chance of "they wouldn't look there", but if they *did* decide to look in
    > the bunch of DNA, a message like "JUNE6_INVASION: NORMANDY" probably has different enough statistics from the rest of
    > the DNA around it that it might stand out.

    I'm not a bio expert, but my understanding is that there are large chuncks of our DNA that biologists can't determine any use for and appear to be random. Of course, it may turn out that the biologists just haven't figured it out yet (my bet), but I beleive it is generally accepted that large portions of our DNA are essentially random junk that is no longer serving any purpose.


    Thus, as long as the encoded message does not stick out as non-random (relatively easy to do for a small string in a large string of numbers, as she has done), it could fall under the title of steganography.

  64. Re:All Public Schools are not Equal by astrophysics · · Score: 1

    All students _should_ be able to get a good education at their local public school. We can dream, and make small steps like http://www.intel.com/pressroom/archive/releases/ed 012000.htm?iid={compinfo=000120}

  65. Re:What about her education by astrophysics · · Score: 1
    Actually, she is a very bright and personable young girl. I'm not certain, but I beleive she is from a public high school.



    About how she got her hands on such fancy equipment... She was one of several very distinguished juniors who was awarded the opprotunity to participate in the Research Science Institute (RSI), which gives some of the world's extremely gifted young scientists an early opprotunity to work in a real research laboratory. For the past several years, it's been hosted by MIT, but students work in many labs across the Boston area, at universities, hospitals, companies, zoos, etc.. Several RSI students have won top awards in the Intel (formerly Westinghouse) talent search every year for a long time.

  66. Impractical? by KeyLargo · · Score: 1

    Does this seem very impractical to anyone else? Maybe I am on the wrong track, but I don't see how hiding a message in a DNA sequence is at all ahead of hiding a message in, say, a stream of random data, or in a Quicktime video, or a bitmap, or anything else. It would be just as secure cryptographically speaking, but wouldn't require big/heavy/unusual/expensive equipment to decrypt. In some ways, raising the bar required for anyone to even start decrypting might be useful, but it seems that the problems inherent in any non-transmittable medium by far outweigh the benefeits when the encryption methods we have now (by all evidence) provide an equal level of security?

    Can anyone see a practical use to this procedure?

    1. Re:Impractical? by yuriwho · · Score: 1

      Your analogy of hiding code in a quicktime video is apt. It's like hiding a code in the collective data of the internet. Nobody can possibily have all the data on the internet at their disposal and search it for secret codes due to the sheer amount of data. DNA is similar in that it takes worldwide efforts to decode a very small part of it. Her (and the lab she worked in) scheme allows someone to know where to look for the message. A bit like pointing to a URL for the secret message.

      See my other posts in this story for a more biological explanation.

      --
      no sig.
  67. Re:Interesting, but don't let's start... by randombit · · Score: 1

    Another favorite steganographic method of mine is to encode data into graphic images, for example, taking a bitmapped image and using a key to encode data onto each pixel, say by incrementing the red RGB value of each pixel by 1 where appropriate. It would be exceedingly difficult to detect that a message even contained data, let alone extracting it without the key.

    Sadly, now that you've told me, I know how to get your messages. :) Also, if people have access to the original copy (ie, where you got it from) then you're in trouble. And, at least AFAIK, you'll have to keep an original around somewhere to "decrypt" your message, which is kind of a problem, I might think (note that I am not saying that all of stego is like that, just in this particular case). People might get curious - "why does he have 2 almost identical copies of the same picture?".

  68. Re:Cool Lab Work - but Bad Crypto! by randombit · · Score: 1

    Stashing a secret message in a bunch of a DNA has a good chance of "they wouldn't look there", but if they *did* decide to look in the bunch of DNA, a message like "JUNE6_INVASION: NORMANDY" probably has different enough statistics from the rest of the DNA around it that it might stand out.

    I'll admit that I know hardly anything about biology, but I'm pretty sure that DNA strings are very very very long. I wouldn't be suprised if a brute force search such as that you suggest is actually infeasible (similiar to "breaking" RSA by factoring the modulus, if you will).

    Hmmmm... I wonder if it would be possible to encode messages so they looked like normal DNA? I'm not sure how many proteins there are (probably a lot) - might it be possible to design some sort of coorespondance between proteins, and, say, strings of 8 bits and use that? Of course, could the animal live long enough with screwy DNA for the recipient to get it? :)

  69. Re:Cool Lab Work - but Bad Crypto! by ph0enix · · Score: 1

    "JUNE6_INVASION: NORMANDY" probably has different enough statistics from the rest of the DNA around it that it might stand out.

    Although this is correct, upon reading the article, one notes the following:

    She encrypted the message, "JUNE6_INVASION: NORMANDY," inserted it in the gene sequence of a DNA-strand, and flanked it by two secret "primer" DNA sequences.

    Presumably "encryption" means that the pattern would be scrambled enough to preclude any statistical analysis. A more interesting question is "What was in the other strings?" If it was natural dna from an organism, it could be filtered out by matching it with dna from that organism, leaving the correct string. (Which would still have to be decrypted, of course)

    In most cases, steganography on it's own is security through obscurity: it only works if your adversary doesn't know you're using it. You need a method of makeing the data stored look the same as the "chaff"

    --
    <sigh>
  70. Re:It's People Like This... by Psinoside · · Score: 1

    Yeah, but how well would they do on Who Wants to be a Millionare? Thats the only fair way of judging people. If you can make it to a half-mil, you're fine in my book ;p

  71. Re:Cool Lab Work - but Bad Crypto! by sugar+and+acid · · Score: 1

    You have missed one essential point. I haven't read any information about how this was done, or what organism, but assuming it is within the chromosomal DNA and organism, (bacteria or even better a rat), and no way to pick out the insert, or mutations in the DNA apart from the secret primers then it really is hard to crack. For a start, there is already a lot of DNA in higher organism chromosomes that is junk, it doensn't encode anything, a little bit more would hardly stand out. The shear amount of other information is staggering. And the most important, you assume that you can read the relevant DNA sequence instantaniously, think again. If you have no idea where the message is likely to be, then you probably have to sequence the whole genome again to make sure that the relevant coding region has been read. This could take years!!! Where as if you have the primers, you can easily select our the relevant portion of the code using PCR, and sequence the relevant section. All of maybe a day or two.

  72. Re:No picture??? by MicroBerto · · Score: 1

    First off, i'm sorry, my friend posted that. All apologies, i wish i could delete the message.

    Second off, you are the lamest piece of shit i've ever been witness to. If you have a problem with me, take it up to me first. I have a problem with people like you.

    so should i watch out where i'm logged in? Yes... but the real lesson here is that you should worry about yourself, and stop throbbing in your own insecurity as to having to "tattle" on others. Get real.

    Mike Roberto
    - roberto@soul.apk.net
    -- AOL IM: MicroBerto

    --
    Berto
  73. Re:Intel STI by Tayknight · · Score: 1
    Congrats, young man. Nobody may want to hear it, but you are probably _lots_ smarter than most of the slashdotteri here. Keep up the good work, post a story when you win the Nobel someday.

    ---------

    In the jungle...the lion sleeps tonight. - TMBG

    --
    Pair up in threes. - Yogi Berra
  74. Re:[OT] Re:All Public Schools are not Equal by sopwath · · Score: 1
    I have a few things to say about the previous post...

    Public schools do suck. The problem is, schools can't stop sports programms because they contribute a big part of thier budget. So they don't have any options except to keep them going. In the area I live, I read that almost 30% of the district's income comes from ticket sales of the football games!

    I don't understand how the US government can spend $60 Billion on a mission to mars and not make absolutly sure it will work. Then turn around and don't help out the future generation of this country by providing our public schools with adequate resources. How can we possibly expect to be a world leader if our children are being baby-sat instead of taught? The teacher have to put up with all kinds of problems, discipleine, time constraints, rescources, LOW PAY, etc.

    I think there is some value in physical education but in today's technology based society it's not as needed as it once was. Also people are so health concious, that PhyEd. isn't as important because the knowledge and information is out there anyway.

    You can't give special treatment to someone just because they scored higher on thier SATs or ACTs. A child doesn't know what he want' to do the rest of his life. I know I didn't and as a college student, I still don't. (Yes I've narrowed it down)

    How can you decide what programs are more important than others? The different classes should be offered to everyone, not those in a specific age or "intelligence" group. How would you decide who gets what when it comes to the advanced courses? If someone is found to be good at math and science do you drop art? There are some things that everyone has to know in order to function in society. These have probobly been taught in lower grades (and they should be) but some things, like math and science, need the building blocks of the previous year's teachings in order to be tought.

  75. Re:Pretty cool, but check out the second place win by jpatokal · · Score: 1
    Reminds me of something I saw a week or two ago (can't remember where), about a claim that there can be no "smallest uninteresting number", because that very fact makes it interesting.

    And, appropriately enough, this proof is also by Ramanujan. I can't seem to dig up a reference on the Web now, but one of Martin Gardner's books discusses this, along with the theory of "interesting numbers" in general.

    Cheers,
    -j.

  76. Re:Pretty cool, but check out the second place win by gargle · · Score: 1

    It's G.H Hardy, not Thomas Hardy. Thomas Hardy was a writer of books.

  77. Re:What about her education by Yoru-Hikage · · Score: 1

    Yes, Paul D. Schreiber is a public school in the suburbs of New York City on Long Island. I can tell you this since I graduated from that very school not two months ago.
    And I must say, I knew Viviana. While bright, I didn't realize she had this sort of potential. And I was certainly surprised to see a classmate's name up in lights on Slashdot!
    Well done.

  78. Re:Why use DNA molecules anyway.. by jareds · · Score: 1

    It seems to be that this technology would work equally well using modern technology, i.e. a computer, and would be far simpler to implement. Can anyone explain? I suppose that it would take longer to crack using DNA molecules?

    DNA sequencing isn't modern technology?!

    Seriously, the way the technique works, if I understand correcly, is that the message is placed in between two known but secret primers, and then somehow mixed into some organism's DNA, which could have hundreds of millions, or even billions, of nucleotides. Sequencing DNA is nontrivial, unlike a computer, where one can scan a multi-gigabyte hard drive in minutes. It would probably take the equivalent of something like the Human Genome Project to sequence the organism's genome and find a single message. However, because of the way DNA works, if you know the primers, you can directly snip out the part with the message, and sequence just that.

  79. Agree! Mod this up! by yuriwho · · Score: 1

    For those who don't know the story, please visit your local library and get a book called "The Eight Day of Creation" it documents fairly accurately the set of events leading up to the current field known as molecular biology. It is held in high regard by all the biologists I have known who have read it. It is commonly known that Watson and Crick solved the structure of DNA by interpreting Rosalind's data. Had she lived to claim her Nobel prize (see other post in this thread) she would be a national treasure of England and would be on postage stamps etc. right now.

    --
    no sig.
  80. It's been done before and published! by myc · · Score: 1

    Here is the reference. I'd hyperlink it, but accessing Nature's online site requires registration. Most good university libraries should carry Nature.

    Clelland, C.T., Risca, Viviana, and Bancroft, C. (1999). Hiding messages in DNA microdots. Nature 399, 533-534.

    Whoever did the judging for this contest should have done a literature search to show originality of the work.

    --
    NO CARRIER
    1. Re:It's been done before and published! by CravenRaven · · Score: 1

      >Clelland, C.T., Risca, Viviana, and Bancroft, C. >(1999). Hiding messages in DNA microdots. Nature >399, 533-534. >Whoever did the judging for this contest should >have done a literature search to show >originality of the work. Did you not look at the authors list? Viviana Risca (2nd Auth.) _is_ the contest winner.

  81. Whoa! She's an author on this paper! my bad! by myc · · Score: 1

    heh, didn't notice that the high school student in question is an author on the paper aforementioned. No *wonder* it reeked of plagerism! ;)

    --
    NO CARRIER
  82. Unbreakable Code? by hobgadling · · Score: 1

    Because the pair of primers provides a trillion trillion options, she concludes that the code is essentially unbreakable.

    Just because the primers are hard to find doesn't mean the message is. If you know how the message was encrypted into the strand, you can test the entire strand (if there is only one) to see if it makes sense when decrypted. That's how the codebreakers at Bletchley Park cracked the daily Enigma settings, they would try certain words that would fit into the message and see if the rest made sense.
    Adam

    --
    All good technology should be used to piss off people's parents. --Neil Gaiman
    1. Re:Unbreakable Code? by LaoK · · Score: 1

      To hide steganographic code in an organism's genome would be more difficult than hiding it in (as you say) a blizzard of synthetic DNA containing false messages. The naturally occurring DNA would be unlikely to resemble whatever encoding you chose for your message, since even the unexpressed (intron) regions of eukaryotic DNA tend to have some structure (multiple repeats, etc).

      Still, you can't beat the information density that the technique gives you.

      LaoK

  83. Let's set the story straight by Listen+Up · · Score: 1

    Whoever moderated my post as "Flamebait" can FUCK OFF. I am sorry that my support for this girl as well as other female scientists bothers you. Ignorant bastard.
    And, no, Watson and Crick did not like Rosalind Franklin. They NEVER gave her credit until confronted about it, unlike what some people think. Rosalind worked under John Randall at King's College. She was given the sole responsibility of discovering DNA's structure ALONE. Watson even went so far as to write an extremely damning paper about Rosalind where he actually claimed to have discovered DNA called "The Double Helix." The book actually raises Rosalind's lab partner Maurice Wilkins above Franklin when they worked as peers in the lab.
    At a routine seminar John Randall presented Rosalind's data and UNPUBLISHED discoveries on the helical structure of DNA. At the same conference this data was stolen and provided to Cambridge University where Watson and Crick used Franklin's data and claimed her discoveries as their own.

    And, on another note, to Uberminky. QUOTE..."I was dabbling with steganography and RSA years ago (8th grade)." HA HA HA HA. That post alone made me laugh for a couple of minutes. Amazing people on /. aren't there. Maybe someone will tell me next that they were, in 6th grade or maybe 8th grade to be fair...between watching TV and playing outside...figuring out the zeroes of the Riemann Zeta function in the complex plane for fun. HA HA HA HA HA HA

  84. Females in Science by Listen+Up · · Score: 1

    It good to finally start seeing exceptionally talented females being recognized for their achievements. Congratulaions to you. I am writing a research paper as we speak about a female scientist named Rosalind Franklin. Anybody ever hear of her? Probably not. As a matter of fact see was the first human being to ever discover DNA and its helical shaping. SHE was the FIRST. But, since her peers in Randall Laboratory were men, and you know who they were, they not only recieved credit for her work, but literally took all of her work as their own. Watson and Crick was nothing but liars and I hope that this female gets all of the attention and credit that she deserves today and in the future.

    1. Re:Females in Science by Uberminky · · Score: 1
      [violent coughing]

      Credit??? For DNA-based steganography? Please..... Steganography is certainly nothing new. I was dabbling with steganography and RSA years ago (8th grade). Applying it to DNA isn't anything special, and not even new (though I can't offer you a link, I'm sure dozens of others have already found them). Ah, well...

      --

      The streets shall flow with the blood of the Guberminky.

    2. Re:Females in Science by HvidNat · · Score: 2

      FWIW Watson and Crick did nothing to cover up Ms. Franklin's contribution to discovering the the double-helical structure of DNA. In fact, they very often acknowledge her role. The problem stems from the fact that she did not receive the Nobel prize along with Watson and Crick. Why? Because by the time Watson and Crick were nominated Ms. Franklin had already died and the Nobel committee does not (even to this day) give out posthumous awards. What did Ms. Franklin die of? Apparently of long-term exposure to x-rays (as was often the case with x-ray crystallographers before they learned to better respect radiation).

  85. Hmm by webrunner · · Score: 1

    I can imagine it now.
    "Honey, I'm going to go finish that pidgeon i was reading."

    --
    ADVENTURERS! - ANTIHERO FOR HIRE - CARDMASTER CONFLICT
  86. so what if she's only 17? by Travoltus · · Score: 1


    I'd give the equipment to do the job to a 4 year old if they could prove they knew what they were doing and their theories were sound.

    As far as I'm concerned, the explanation is she had some kind of incredible contribution to make, some science talent scout noticed her, and she got bumped up to the big leagues and hit a home run. It's as simple as that.
    ========================
    63,000 bugs in the code, 63,000 bugs,
    ya get 1 whacked with a service pack,

    --
    --- Grow a pair, liberals... stop letting the Republicans bully you!
  87. Re:What about her education by schloggie · · Score: 1

    Suffice it to say that many people manage to think despite their public school educations.

    Viviana probably would have done something pretty bright either way. Unfortunately, public schools ususally manage to allow those who really NEED a rigourous education to be left completely unprepared for much except garbage collection (the traditional kind...)


    - "If you tell the truth, you don't have to remember anything" -Mark Twain
    --
    - "If you tell the truth, you don't have to remember anything" -Mark Twain
  88. Re:Westinghouse by J.+T.+MacLeod · · Score: 1

    I believe that these are one in the same.

    I am not aware, however, of how it went from Westinghouse to Intel.

    Great. I just took time to show my ignorance :)

    J. T. MacLeod

  89. It's People Like This... by webfiend · · Score: 1
    Who make you realize how little you've accomplished. --Tom Lehrer

    Oh well, back to Wheel of Fortune.

  90. Re:Cool Lab Work - but Bad Crypto! by cheese_boy · · Score: 1
    The way you're implying encryption works is just changing the way it's represented. In that way, I could be encrypting a message just by writing it down

    Changing the way something is represented is the definition of encryption...

    If you write it down in egyptian hyroglyphs or apache, noone would consider it not to be encryption. Possibly poor encryption if it was easily translated back, but encryption nonetheless.

    What encrypting it does is distribute that entropy over as much space as possible, and turn your large secret (the plaintext) into a small secret (the secret key).

    Not necessarily so.

    keys can be extremely large. Even larger than the plaintext. Or just as large. (Learn about one-time-pads to see an example.

    Encryption says *nothing* about entropy.

    Good encryption codes take into account entropy, as statistical methods can be used against encryption codes that do not take that into account.

    I'd suggest reading "Applied Cryptography". It's an excellent background on what cryptography is and explains some of the various attacks against encryption methods and uses.

  91. Re:Cool Lab Work - but Bad Crypto! by cheese_boy · · Score: 1
    a message like "JUNE6_INVASION: NORMANDY" probably has different enough statistics from the rest of the DNA around it that it might stand out

    Why would the text "probably" be statistically different enough?

    And I'd say that since the text had to be transformed from plaintext to nucleotides, that alone qualifies as encryption.

    Encryption: "the activity of converting from plain text into code"

    but she's implying that straight plaintext is also unfindable there, and it's not, any more than hiding it in the low order bits of a picture is.

    Well, it can't be straight plaintext, it has to be encoded somehow.

    And since she is apparantly choosing the DNA to surround it, it is easy enough to make the background be similar to the text to be hidden and the keys.

    Also, since we're dealing with DNA here, it becomes difficult for someone to do any statistical analysis on it. With any significant amount of DNA it would be rather difficult to sequence it all.

  92. Re:Equipment by Bert+Peers · · Score: 1
    And I can assure you she is a very nice person. She strives to be a good person, just as much as a good scientist. Don't get me wrong. I don't mean "elite" as a personal, negative label. You can't "blame" somebody for growing up in a stimulating and intellectually rich environment, just you don't go after someone for growing up in a poor situation.

    My concern was rather the curious implication that the scientific world, in this example at least, seems to have no problems with the idea that one opportunity, deserved and well exploited, can lead to another, even bigger achievement, which would have been completely unreachable normally.
    However, at the same time governments, ACM/IEEE, etc, are raising important and valid concerns over the possible wide gap between have's and have-not's of the future, as a result of being online and not being online during the education (and leisure time).

  93. Wow! A whole bunch of future poor postdocs! by m.o · · Score: 1

    See subj.

  94. Re:Pretty cool, but check out the second place win by m.o · · Score: 1

    Hawking doesn't belong there. IMHO. Newton does. Also Poincare, Gauss, maybe couple others. Not Hawking (at least not yet).

  95. Re:Equipment by m.o · · Score: 1

    Dude, awesome points!!!

  96. math projects by m.o · · Score: 1

    Do you know if I can get these papers anywhere?

    1. Re:math projects by astrophysics · · Score: 2

      Try sending them email. For the RSI students, just finger lastname@mit.edu and you'll probably be able to fine them.

  97. Apologies by Uberminky · · Score: 1
    My sincerest apologies for my previous post. As you pointed out, it was immature and rude. I should have waited longer before posting.

    I certainly have nothing against women, and nothing against the recognition of their acheivements. If this Rosalind Franklin has done any of what you say, then she was indeed a remarkable person who deserves far more credit than she is given (based on the fact that I've never heard of her in my life ;).

    My previous post was to (unfortunately rudely) convey my disgust that this person was receiving an enormous sum of money for completely unoriginal work. But the main point of this post was to apologize, so I'll leave it at that. You can agree with me, or you can disagree with me, and either way it doesn't much matter. There's a little too much negativity and flaming going on on the net, and I try not to be part of it. My two cents

    -Dave

    --

    The streets shall flow with the blood of the Guberminky.

  98. Wasn't this done before? by JunkDNA · · Score: 1

    I don't want to sound like a jerk; but I seem to recall a letter in the journal Nature (sometime this summer) where several researchers encoded a message in DNA and used primers as the keys to find the message...essentially what Viviana did. Anyone else remember this?

  99. If you spliced the decss sourcecode in your own ge by mr+bozo · · Score: 1

    If you spliced the decss sourcecode in your own genes, could the MPAA prevent you from breeding?

  100. Re:Interesting, but don't let's start... by regen · · Score: 1

    Stenganographic encoding of data into images was part of the research I was doing for my Ph.D. a few years ago. Most good techniques are not this trivial. The are typically based upon spread spectrum coding techniques, which when properly employed are very secure. An excellent starting place for research in this area is at Neil Johnson's site.

  101. New Bumper Sticker? by fluxrad · · Score: 1

    My kid beat up your DNA Stenographer


    -FluX
    -------------------------
    Your Ad Here!
    -------------------------

    --
    "It is seldom that liberty of any kind is lost all at once." -David Hume
  102. Can Anyone Say... by canthidefromme · · Score: 1

    Hitchhiker's Guide to the Galaxy?
    -j

    --
    -sigs of the world unite
  103. Re:Intel STI by canthidefromme · · Score: 1

    Westinghouse does not sponser it anymore because they don't exist. A few years ago they bought CBS and changed their name to that, selling off their engineers to Bechtel or Seamans and others.
    -j

    --
    -sigs of the world unite
  104. This used to be called Westinghouse. by toppk · · Score: 1

    Wow, times have changed since I've gone to highschool.. Not that long ago, and everyone thinks this is Intel's award. They are just footing the bill (perhaps more).

  105. This is EXACTLY how nature works. by ca1v1n · · Score: 1

    Hello! Human DNA is 99% fluff. How do we sort through all the noise and get to the protein-directing strands? With keys. Nature has its own built-in keys. Of course, with this kind of DNA steno, the keys can be of arbitrary length, but still, we should keep in mind that this process has been going on for billions of years.

  106. Franklin's accomplishments by No+Such+Agency · · Score: 1

    She was a remarkable scientist. By some accounts she was robbed, by others she was less-than-collegial and missed out on some collaborative rewards as a result. One of the more interesting (and tragic) things I learned about her was that, as a Jew, she had a hard time finding somebody who would allow her to rent a room to live in. She spent a lot of her time living in a nasty garret which she rented from a landlady who openly despised her and didn't even want her to use the same bathroom. And I imagine she had to deal with a lot of other discrimination in her life too.

    --
    Freedom: "I won't!"
  107. MPAA injunctions on pet shops? by iainl · · Score: 1

    So, who can make pets with DeCSS in them? Hell, there's enough space DNA for you to be a walking Napster!

    --
    "I Know You Are But What Am I?"
  108. Re:What about her education by fifreak · · Score: 1

    I graduated Paul D. Schreiber High School last year and I can tell you that Schreiber High School is a public high school just like any other school. We do not have any kind of special magnet program to attract special student....just a local high school in a small suburban town. The reason that Schreiber produces so many talented students with excellent science projects are the special Science, Social Science, and Math research programs that the school funds. They each take 10 students from each year (10th-12th grade) and provide a mentoring evnvironment where students learn to do their own research studies. After the junior year of high school, students goto univeristies over the summer to do their Intel reseach. Its really a great program with some excellent faculty members behind them. The school should be proud of their teachers. As for Viviana, I knew her personally when I was there and I have to say that nobody deserves this award more than her. She is one of the most hard working people I have ever met. And she was extremely dedicated to her research as well. Viviana, if you read this, good luck at college!!!

  109. Re:Equipment by rhombic · · Score: 1

    DNA work isn't expensive anymore. PCR machines are well within the budget of a reasonably well off school-- for the price of a PC you could get two or three thermocyclers. Oligonucleotides run around $1/base. The total cost of this work (using other people's equiment) might have been as low as $1k or so. The main block to mainstream high-schools doing DNA stuff is teacher knowledge and the need to be follow recombinant DNA safety rules, which are _very_ important in things like this. The last thing we need is for some wiseass to clone tet toxin or such into E. coli & innoculate the school lunch dessert line. DNA tech has moved into frosh biology labs at many major U's and in 10 years it'll be routine in high school biology classes.

    --
    1984 was supposed to be a warning, not an instruction manual.
  110. How about scholarships young OS programmers by lukel · · Score: 1

    I was thinking, something along similar lines (i.e. scholarships), but for young programmers working on open source projects would be a good idea. Working for nothing (at least financially anyway) is all very well, but talented young programmers still need to pay for their education (in some parts of the world).

    Any internet millionaires wanting to give something back to the community listening?

    1. Re:How about scholarships young OS programmers by lukel · · Score: 1

      I don't dispute the usefulness of what has been pointed out by sesiquiped and mreece - that open source projects can be entered into the competition STI, or that winners of the are deserving, or that the criteria for judging it are valid. Perhaps it is true that someone "intelligent enough to work on open source projects and make intelligent contributions" would be " intelligent enough to put a "science" spin on whatever work [they] did to make it worthy of an STI project." I don't know, I'm not such a person.

      The point I want to make is that, as I understand it, what makes a good contribution to an open source project is very different from what makes a good contribution to science or computer science. Both are valuable but in different ways. Talented young people doing both these things are deserving of scholarships. It seems the criteria of the Intel STI competition are more aimed at people making contribution to science or computer science. So that establishing some form of scholarships for young programmers contributing to open source projects who may not be pushing back the barriers of science but are providing valuable contributions would be a good thing.

      Furthermore, since a few people have become very rich through open source software and many more have benefited greatly from using it, if these people did want to give something back to the community, contributing to such a fund would be a good way of doing it. Such a scheme would reward some those who have contributed and encourage others to contribute.

  111. Re:Westinghouse by dacarson · · Score: 1

    Westinghouse bought CBS several years ago and sold the aerospace division to Northrup-Grumman. I guess since they've gone from a tech/engineering company to a media company they don't care if people can think anymore.

  112. Westinghouse by avandesande · · Score: 1

    "The Intel STS is America's oldest, and most prestigious, pre-college science scholarship competition, often considered the "Junior Nobel Prize."" Just for the sake of argument, isn't the Westinghouse competition older?

    --
    love is just extroverted narcissism
  113. Re:Cool Lab Work - but Bad Crypto! by scifi · · Score: 1
    I'm sure someone will correct me if I'm wrong, but I thought that sequencing DNA was a destructive process, essentially involving tearing lots of strands into itty-bitty pieces, then doing some cool computational analysis to figure out what the full sequence looks like from where the strands overlap. This works because all of the multitudinous strands you started with are identical.

    However, the technique here is burying one modified strand in with a bunch of others, which seems to me makes it essentially the same as a one-time pad. The interceptor gets one shot at guessing the pair of primers, and if s/he is wrong, the strand is gone, and it won't be possible to figure out which pieces came from the target strand.

    It's not unbreakable, you just have to steal the manual which tells the technicians which primers to use. =)

  114. Now where did she get those wonderful toys... by CravenRaven · · Score: 1

    Where on earth did Ms. Risca (and the other contest winners) get their lab equipment? I was going to enter, but I didn't have any of the resources necessary to finish my science project. Admittedly, it was my own fault, I should have checked to make sure I didn't need a supercomputer before I began. But still, how many people with same aptitude for science research have access to a gene sequencer? (Aside: Can you believe that my highschool's science supplies are so crappy that we use plastic 1oz. pipettes as a substitute for test tubes?)

  115. Call me bitter, I am bitter by kafka1984 · · Score: 1

    These kinds of things always bother me. It isn't simply because I didn't and still don't have the motivation to do this kind of thing in High School or College for that matter. It is because I don't think these kind of contests even recognize what the purport to. As several posters have noted, these types of projects simply cannot be undertaken by high schoolers acting independently. Although I do agree that certain CS and Math projects could be done, I am willing to bet that none of them were done without assistance from real scientists. Someone previously posted that they would give the equipment to a 4 year old if they could show their theories were sound. I propose that if you did give the equipment to the 4 year old, they wouldn't even need the theories. With only a tad more assistance than most of these students got, I bet a 4 year old could come up with the same results. I don't feel like writing a more poigant critique at this time in the morning, perhaps someone else put it better.

    --
    Who watches the watchmen? -Juvenal
  116. Re:Pretty cool, but check out the second place win by akgoel · · Score: 1

    It wasn't the strict vegetarian diet that particularly killed him. Dude just forgot to eat, since he was so rapt up in his math. Actually, it wasn't that he so much forgot, since his wife was constantly hounding him to eat, but rather, he just didn't want to.

  117. Re:Cool Lab Work - but Bad Crypto! by Ig0r · · Score: 1

    The way you're implying encryption works is just changing the way it's represented. In that way, I could be encrypting a message just by writing it down (changing the coding from brainwaves to written characters).
    Because of the fact that plaintext has lots of repitition, there are always going to be non-random sequences (in ascii there's only around 2.7 (if I remember correctly) bits of entropy per byte for english). What encrypting it does is distribute that entropy over as much space as possible, and turn your large secret (the plaintext) into a small secret (the secret key).
    I think you're using 'encrypting' when you should be using 'encoding'.

    --

    --
    Soma: because a gramme is better than a damn.
  118. damn... by DeXtR · · Score: 1

    Anybody else feeling like they've read /. for too long and too often when more ... productive things could have been.. accomplished...in science's *cough* money's */cough* sake?

    --

    Istigkeit -"is-ness" being and becoming & i'dfiying it with the mathematical abstraction of the idea

  119. Re:Pretty cool, but check out the second place win by maggiesmith · · Score: 1

    in order to understand why no number is uninteresting, you have to take this to its logical conclusion, which I admit is still a bit of a paradox. If you have a list of all the uninteresting numbers, and you take the smallest one and say it is no longer uninteresting because it is the smallest, then the next one will become the smallest uninteresting number, and the process continues until they are all interesting.

  120. Re:This is old news... by tesserae · · Score: 1
    That was my first response, but it wasn't a joke I thought of...

    Years ago, I worked with a guy who got his undergraduate physics degree from Cornell. For his senior paper, he wrote on the concept of an alien race from the ancient past leaving messages to intelligent lifeforms which might evolve in the future, in exons within highly-conserved DNA regions of microbes. While not steganography at all, it's a remarkably similar concept.

    As it turned out, my friend showed his paper to Carl Sagan, who was of course also at Cornell. I think it bothered him, when years later he read the punchline in Sagan's new novel, Contact. (I don't think I need to explain that one, do I?)

    ---

    --

    ---
    Politics is about making compromises. Religion isn't. --Michael Horton

  121. Stamp collecting by Troll+Boy+2 · · Score: 1

    Aww, Biology is stamp collection, along with everything but physics and math.

    --
    You know you want to give me -1 Troll
  122. wtf? by Troll+Boy+2 · · Score: 1

    Dude, the professor probably had the idea of what to do, this is really over-rated. It just took some decicated work, lots of people could have done it.

    --
    You know you want to give me -1 Troll
  123. Re:Equipment by aki-chan · · Score: 1

    All this talk of economic advantage is all well and good, but a bit off. RSI, the summer program Viviana (and the previous two years' winners) attended is free of charge to those that get in. In fact, the organization (CEE - see http://rsi.cee.org) that helps to fund it also funds other programs in public schools. The program is selected ENTIRELY on an academic basis, without regard to race, gender, or economics.

    --
    ---- Ton role dans ma vie n'est point hasard. -Ba
  124. Re:It's steGAnography by Picky+Linguist · · Score: 1

    Stenography is another name for shorthand. I guess you could take dictation into your arm with DNA stenography... -----BEG PGP SIGNATURE---- Version: Petty Genetic Privacy v -1 GATCGATCGACGCATGACTGCATGACGTACGTTGACT GTACGACTGTGACTGATCTTACGCAGTTGACTGACTG ACACTGAGCTGCACATCTGCATCTGATGCATGACTTC GTCAACATCG -----END PGP SIGNATURE-----

  125. Could be useful for copyrighting or comments :) by Fastolfe · · Score: 2
    A variation of the idea could be used to insert copyright text or whatever at the start of your own original genetic sequences.. Heh.
    Organism felis.domesticus v-ig318 build 3 genetic code copyright (c) 2000 inGen, Inc. Unauthorized use of copyrighted, non-naturally-occuring code is prohibited. Contains visual cortex code from the University of California at Berkeley.
    or
    Organism drosophilia melanogaster base-315j+joehacker20000315c - Magnetic sensory sequences copyright Joe Hacker 2000. This code is released under the GNU Genetic Public License ...
    Just use standard, known header sequences that both tell any biological processes to skip this chunk of DNA while making it easy to locate the text. :)
  126. Was Westinghouse, now is Intel by Guy+Harris · · Score: 2
    isn't the Westinghouse competition older?

    Nope, they're exactly the same age...

    ...because they're the same competition. Here's an Intel press release saying:

    The Intel Science Talent Search (STS) is in the business of making dreams come true and opening new doors for young scientists. This nationwide competition - America's oldest and most highly regarded pre-college science contest -- has for the last 58 years helped the nation find and encourage talented high school seniors to pursue careers in science, math, engineering and medicine. The competition was previously sponsored by Westinghouse Electric Corporation. For 57 years the Science Talent Search has been administered by Science Service, a non-profit organization based in Washington, D.C.
  127. Re:What about her education by sdw · · Score: 2

    I visited the competition Sunday afternoon. I received an invitation in the mail a month ago.

    Viviana was very personable and explained her project to our 14 year old very well. While she is obviously very talented and has a cool project, I actually would have rated several other projects higher for research, experimentation, difficulty, and innovation.

    At least 3/4 of the projects were amazing. Robert Wang's project was particularly impressive for a 15 year old from Arkansas. (There were two finalists age 15, the rest were 17 or 18.) He had come up with two useful and apparently innovative 3D detail scaling and visibility culling algorithms that he had implemented in C++ on Windows with an Open/GL demo. He's been programming since he was 10. I suggested he contribute the source to one of the Linux game projects. Scaled for his age, it was impressive.

    The most impressive projects, to me, were those that appeared to have broken new ground and actually extended human knowledge sucessfully.

    sdw

    --
    Stephen D. Williams
  128. This is old news... by mattkime · · Score: 2

    This is old news. I've been encoding the DeCSS algorithm in the DNA of the apples I grow on my farm.

    Sure, people might be forced to take DeCSS off the web - but have you ever heard of a food recall based on information?

    --
    Know what I like about atheists? I've yet to meet one that believes God is on their side.
  129. Re:Pretty cool, but check out the second place win by PD · · Score: 2

    Vegetarian diet and cold weather killed him? Hmmmm. I would have thought it was a combination of crappy medicine and microscopic life forms. Remember folks, most of us are alive today for one reason: we figured out how to battle the bugs. Poor Ramanujan lived before all that. Sorry, rant off.

    The real reason that I'm posting is that Ramanujan was a VERY SERIOUS LOVER OF PI. He memorized many many digits, and he invented the Ramanujan series which calculates PI pretty quickly.

    And since it was 3.14 March 14th yesterday, that seems appropriate.

  130. Re:Pretty cool, but check out the second place win by Black+Parrot · · Score: 2

    > Hardy says that the number of the taxi he road over in, 1729, wasn't very interesting.

    [export associativity="free"]

    Reminds me of something I saw a week or two ago (can't remember where), about a claim that there can be no "smallest uninteresting number", because that very fact makes it interesting.

    Which tempts you toward an inductive proof that all numbers are interesting (because there can't be a smallest uninteresting one). But a bit of a paradox arises if you do claim that induction, because they can't all claim status as the smallest.

    [export associativity=]

    --

    --
    Sheesh, evil *and* a jerk. -- Jade
  131. Re:What about her education by VP · · Score: 2

    The article said that her family immigrated from Romania 8 years ago - therefore the bulk of her education must have been in the US. Could it be that her family is paying better attention to her education than most?

  132. Re:Intel STI by Foogle · · Score: 2
    Yes as a matter of fact, Microsoft will be sponsoring RSI in 2001. They're going to pass out really lousy keyboards and square mice to all the participants and see how long it takes for them to get CTS.

    It's all a big plot to sell more Microsoft Natural keyboards :)

    -----------

    "You can't shake the Devil's hand and say you're only kidding."

  133. My key is a subdermal bacterium by thrig · · Score: 2

    I guess most immigration agents aren't going to check subdermal bacteria for data pertaining to National Security for at least another year or two at the most...

  134. Re:Equipment by sesquiped · · Score: 2

    Hmmm... you've touched on a long-standing criticism of the STS here. No, the equipment was not the school's. She attended a special summer research program where she worked in real laboratories with real scientists. The "elitist ring" you describe would certinly be argued true by a whole bunch of people. It can be argued that today, it's just about impossible to be an STS finalist without attending some kind of extracurricular research program like she did. (She happened to go one of the very best, but there are others.) Doing research at the level that the STS expects without access to real equipment and real labs is extrelemy difficult, unless you go for pure math or CS. In the past, you would have had a harder time arguing the elitist point of view (refer to the movie/book October Sky) but now, it's hard to deny it. Just look at the list of finalists' project titles and see how many look like they had to be done in special programs.

    Now, making special research programs effectively mandatory may not be such a bad thing. The problem comes in the price: many of them cost money to get in to, often thousands of dollars. (I was lucky enough to get an fellowship where they paid me.) That adds a economic advantage into the mix. Admittance to the programs is often based on things that might be economically influenced also. The net effect is to close off the competition to a whole lot of very intelligent people.

    Having said that, I'd like to add my personal feelings about the STS. It's my belief (so far without rigourous argument) that the people who succeed at the STS are the same types of people who are valedictorians. If you haven't been in high school in the past 5-10 years, you might have a slightly different picture than I do. Basically, these people who achieve the most are not always the most intelligent. They are the hardest workers and the most consciencious students. They are smarter than the average, but they aren't often the smartest people in the school. Of course, I admit that there are always exceptions: I know Viviana a little bit (I go to school a few minutes away from her) and she most definitely _is_ the smartest person in her school, and probably many of the surrounding ones too.

    [Sorry if I rambed a bit, I have a lot to say, and I'm a bit bitter about my whole STS experience :) ]

  135. Funny hype... by Gorimek · · Score: 2

    I stopped reading when I came to this description of the winner, she "is the third youngest woman in the last seven years to win the top prize".

    In other words, she is a pretty average winner of the prize. Maybe a sports writer was temping in the science section that day...

  136. Re:Cool Lab Work - but Bad Crypto! by norton_I · · Score: 2

    Actually, the reason A) you are wrong, B) I was wrong below, and C) This is actually a really cool idea, rather than a simple application of stenography is all the same.

    I don't remember all the right terms, but the way it works is that you know the exact sequence before and after your message, which could be encoded on one small part of thousands of similar DNA strands. You then manufacture the complimentary nucleotide sequences of the prelude and postlude strings in mass, tag them with some flourecent molecules or something, mix it in with the DNA, do some more magic, and they automatically line up to the right sequences. Rinse the excess, hit it with some UV, and look for the flourescing DNA molecule.

    In computer terms, this works because nature has given us a mechanism to do a constant-string grep on DNA many orders of magnitude faster than we can do a linear scan.

    The drawback is that if someone finds an equally novel way to search for something a little more ambigious (a molecular NDFA/regexp matcher!) then you are hosed. This is very much like RSA--if large composite numbers are easily factorable, it is not secure, but in the mean time it is a really cool algorithm. And it is very cool, though perhaps a little impractical for everyday use.

  137. Re:Equipment by astrophysics · · Score: 2

    I agree that what you say about valedictorian is often true.

    However, every school has a valedictorian. Tons of kids get double 800s on (P)SATs. Yet, only 40 are selected as Westinghouse semifinalists and only ~50 (Americans) are selected for RSI each year. It takes much more (and not necessarily either) to be honored by either of these programs. They had to do something that distinguished them amongst a large group of smart and accomplished young peope. Neither ITS's or RSI's selections are perfect, but both try very hard to look beyond simplistic measures like GPA and test scores. Still there are many deserving students who aren't selected by either. Just because you haven't yet distinguished yourself yet, doesn't mean you're not worthy, but it does mean you are unlikely to be considered by either. However, most of those that are selected are much more than your average 1600 valedictorian.

    For some reason the press likes to mention these kinds of things about the students for which it is true. News reporter often doesn't understand or know how to quantify things like working late hours in a lab, amassing tons of background knowledge, and then combining them in a flash of insight. So they write something like you read. Please don't attack the kid.

  138. Re:Equipment by astrophysics · · Score: 2
    >My concern was rather the curious implication that the scientific world, in this example at least, seems to have no problems with
    >the idea that one opportunity, deserved and well exploited, can lead to another, even bigger achievement, which would have been
    >completely unreachable normally.

    Yes, this is generally the way science works. Do you want random people using the Hubble Space Telescope, if they haven't first demonstrated that they know how to plan observations, analyze data, and do good science? Before you are entrusted to make good use of 10 orbits of Hubble Space Telescope time, you make good use of 1. Before you make an observation with Hubble, you will have used a serious ground based research observatory. Before you expect to get observing time on a four meter telescope, you better have done good research with a one meter class telescope. Before you get funding for oyur own research project, you first gain experience working with more experienced scientists, as a post-doc and/or grad student. If you want to get into a good grad school, you better have done well as an undergrad. If you want to get into a good undergraduate school, you'd be well advised to be a good student in high school.



    My point is, yes, there are concerns about society becoming increasingly fragmented by wealth leading to knowledge leading to power leading to more wealth. It is unfortunate to see silly corellations such as race and wealth stay entrenched in society.



    However, being able to spend your life conducting scientific research is a great privilege, that our society awards to a select few. It only makes sense that before someone uses precious resources such as a research labs, telescopes, or graduate students, that they have distinguished themselves at smaller things.



    To whom much is given, much is expected. Some people still manage to suprise us with the fruits of their labor.

  139. Re:Equipment by astrophysics · · Score: 2
    >(a) the price was awarded to somebody who already had access to nonstandard equipment (giving the price a bit of an elitarian ring)

    Yes, and no. She was selected to participate in a summer research program (RSI, see more info in previous post) based on her very impressive motivation and intellect. She made the most of this opprotunity and did some very good research.


    So, yes, she did come from the intellectually elite. There may be correlations with other kinds of elitism, but those did not earn her the opprotunity to use fancy equipment. And I can assure you she is a very nice person. She strives to be a good person, just as much as a good scientist.

  140. She's pretty cute too! by PenguiN42 · · Score: 2

    Hehe, sorry, just my raging hormones talking here -- just how I get about smart young women ;)
    but anyway, if anyone's interested in a picture here ya go.


    -------------
    The following sentence is true.

    --
    The following sentence is true. The preceding sentence was false.
  141. Pretty cool, but why only for Americans? by fantomas · · Score: 2

    "The Intel STS is America's oldest, and most prestigious, pre-college science scholarship competition, often considered the "Junior Nobel Prize." This year, Intel has increased award scholarships and equipment from $330,000 to $1.25 million."

    First off, big respect and good on all the participants, and Intel. Encouraging young people in scientific endeavour is a Good Thing, and my respect and congratulations to all the individuals who worked hard and took part. I hope everybody got positive results out of taking part.

    Here comes the rant, switch off now if you don't want it...

    "Junior Nobel Prize" ...err, come on Intel, that is an *international* prize. Sounds like this is a US only competition. Easy with the hype there. Better still - a challenge - make it an international prize! Why not open up this competition to schools across the planet? Now that would be a great competition, it truly would be a Junior Nobel Prize. Definitely a good thing.

    (rant over!)

  142. Re:Intel STI by IslesFan · · Score: 2

    Schreiber High School is a Public HS, its the only HS in the Port Washington School district. Since I live on Long Island also, one of our local newspapers, newsday has an article about this as well, reach it here. It also includes information on two other finalists, who are both from Long Island as well.

  143. She does go to public school by Carnage4Life · · Score: 2

    The article says she goes to Paul D. Schreiber Senior High School in Port Washington, N.Y which from information on the New York State Elementary, Middle, Secondary, and Continuing Education (EMSC) website is a public school. It is in the Port Washington Union Free School District which is listed Port Washington UFSD in the link provided.

  144. Re:Pretty cool, but check out the second place win by kjeldar · · Score: 2

    Yeah, I saw Good Will Hunting too. =)

    --

    J

  145. Re:Cool Lab Work - but Bad Crypto! by JunkDNA · · Score: 2

    The problem with DNA is that it's a real pain to sequence. Sequencing large amounts of DNA is a nontrivial task. Therefore, her message would be EXTREMELY well hidden. Once sequencing technology improves, the situation changes, and you are correct that a simple analysis would find the message.

  146. Re:Interesting, but don't let's start... by hypergeek · · Score: 2
    "If everyone knows that there's DNA in that there pigeon, it makes it a lot easier to find than if they don't even know that you're transmitting DNA via rabies-infected fowl."

    That would present quite a challenge, especially since rabies only infects mammals.

    I guess it all depends on exactly how much DNA tampering you're willing to do...

    "Another favorite steganographic method of mine is to encode data into graphic images, for example, taking a bitmapped image and using a key to encode data onto each pixel, say by incrementing the red RGB value of each pixel by 1 where appropriate. It would be exceedingly difficult to detect that a message even contained data, let alone extracting it without the key."

    Now, that is interesting. Of course, if you have a pristine copy of the original image, couldn't you just get the message by using some diff-type method, or does this method have a higher security-to-obscurity ratio than you give it credit for?

    --

    --
    Stay up hacking each weekend. Sleep is for the week.
  147. Regulation of Investigatory Powers by Lowther · · Score: 2

    Will the UK government now need to extend the RIP legislation to include this technology *lol* I wait with bated breath .....

    Instead of encrypted e-mails, will I now be able to pass a genetically modified goldfish to my KGB controller each month, right under the noses of MI.5 ? What legislation will the UK government pass then to tap my goldfish ?

    I am really tempted to send a link for this article to my MP, to see what confusion it causes ......

    --
    Stephen Hawking has written another book. It's about time as well.
  148. Why use DNA molecules anyway.. by lukel · · Score: 2

    It seems to be that this technology would work equally well using modern technology, i.e. a computer, and would be far simpler to implement. Can anyone explain? I suppose that it would take longer to crack using DNA molecules?

  149. Re:Pretty cool, but check out the second place win by latcarf · · Score: 2
    Hardy wrote a wonderful little book "A Mathematician's Apology" ("AMA") where he recounts his experiences working with the top number theorists of the day. I recall a anecdote regarding Ramanujan in AMA where he goes to visit Ramanujan when the Indian is sick. Hardy says that the number of the taxi he road over in, 1729, wasn't very interesting. Ramanujan says "Oh no, that is the smallest integer that can be represented as the sum of two cubes in two different ways."

    --
    Madmen in authority, who hear voices in the air, are distilling their frenzy from some academic scribbler of a few years
  150. Never forget your passwords again... by eric434 · · Score: 2

    Now I can encode my pet snake's offspring with all my passwords, if I can get a good deal on the rather pricey process.

    --
    This .sig temporary until a better .sig can be constructed.
  151. Marshall Mc Luhan would be happy!!!! by Pig+Hogger · · Score: 3

    With a bit of gene-splicing, that next pigeon you clone wouldn't need to carry a message. It would be the message!

    Definite proof that the medium is the message!!!!


    --

  152. Re:Pretty cool, but check out the second place win by sdr · · Score: 3

    Just to correct a few details - Ramanujan was not an "untouchable". He was a bramhin - that is from the highest cast. He was also in reasonable good health while in India. But he was poor and he was uneducated. He became ill after going to Cambridge due to his strict vegeterian diet and the cold weather.

    The British mathematician was G.H. Hardy. For more about Ramanujan and a non-technical description of his work on partitions check out Robert Kanigel's book The Man Who Knew Infinity. A more technical introduction is Hardy's Twelve Lectures on Ramanujan or The Collected Works of Ramanujan.

  153. Participants by PhiRatE · · Score: 3

    My hat off to you and the other winners, just reading the summarised list of achievements with your project information on that article indicates not only that you are very gifted, but that you have the determination to utilise those gifts, a rarer thing than it might appear. I look forward to seeing what you all do in the future, and I hope it still manages to balance well enough that you all have fun too :)

    --
    You can't win a fight.
  154. Re:Cool Lab Work - but Bad Crypto! by Convergence · · Score: 3

    To respond to both this message and the sibling message. It doesn't matter if the statistics are normal. In a human, there are a few billion base-pairs in DNA. If the secret is encoded at some unknown position, it might be hard to extract without the primers, but there are ONLY a few billion positions it could be in.. So this looks like cryptography with a 32-bit key.

    This is much like the 'secret' cypher where you encode each word of some plaintext message as a list of page, line, and word numbers in some arbitrary book. 12-3-5 (page 12, line 3, word 5). The book itself acts like the key. Unfortunately, this isn't secure as there aren't so many books out there. I can just try each one till I find one that gives a reasonable message, say a 20-bit key.

    On the other hand, this is a news report, the story might have just 'skipped over' this issue and Viviana thought over it and has a solution. Or maybe not, don't forget that good steganography is damned hard. I ask you, how would you try to 'hide' some secret message so that somebody couldn't even detect it?

  155. Interesting, but don't let's start... by Dirtside · · Score: 3
    Because the pair of primers provides a trillion trillion options, she concludes that the code is essentially unbreakable.

    Only in the same way that public-key encryption is unbreakable, in that you can't brute-force it in any reasonable amount of time. However this doesn't rule out any weaknesses in the method itself, such as being able to statistically detect the desired data segment, etc.

    Also note that steganography in general relies on obscurity; in other words, "Secrets are best kept when no one knows that secrets are being kept." (Nigel Calder, Einstein's Universe) If everyone knows that there's DNA in that there pigeon, it makes it a lot easier to find than if they don't even know that you're transmitting DNA via rabies-infected fowl.

    Another favorite steganographic method of mine is to encode data into graphic images, for example, taking a bitmapped image and using a key to encode data onto each pixel, say by incrementing the red RGB value of each pixel by 1 where appropriate. It would be exceedingly difficult to detect that a message even contained data, let alone extracting it without the key.

    --
    "Destroy science and religion. Science would re-emerge exactly the same; but not religion." - Penn Jillette, paraphrased
  156. Quake and Science by Syn.Terra · · Score: 3

    "Also, the week is not all science - Intel provided a web center in the hotel with lots of nice computers equipped with Quake 3, so we could have big multiplayer deathmatches over the LAN."

    See? The government organizations were right! Playing Quake and other violent video games does make you become violent, neurotic, and make you want to blow up your...

    Oh wait, these kids won what award? How prestegious was it? Intel says they'll be the nations leaders and innovators?


    ------------
    --
    "Okay, who taught the cat how to type ctrl alt delete?"
  157. Re:What about her education by danb35 · · Score: 3
    I can bet she is not a product of the U.S. Public Education System.

    I don't know about that. Paul D. Schreiber High School is part of the Port Washington Union Free School District, according to the 1999 profile. I can't tell for sure, but that kind of sounds like a public school to me...

  158. Equipment by Bert+Peers · · Score: 3

    I'm a bit confused here. The article seems to suggest that the DNA encoding was actually executed, instead of merely being theoretically described/proposed. Um, the school I was in when I was 17 most definitely did not have DNA-handling equipment. Does this mean that (a) the price was awarded to somebody who already had access to nonstandard equipment (giving the price a bit of an elitarian ring), or (b) DNA juggling is already common place enough that highschools carry the stuff as basic equipment ? Both options seem a bit of food for thought to me...

  159. give those kids a break!! by Anonymous Coward · · Score: 4

    Honestly,

    here we have (some of) the most outstanding and promising kids in highschools in the US (or didn't I get the meaning of this award). They will probably even be among the best in their year at Harvard/MIT or whatever. And they did some excellent and truly impressive work.
    They deserve credit and appreciation instead of bitching about this or that detail of their work or whining "If I would have had these toys to play I would have done what he/she did". Pure envy... If you're be capable of doing cool stuff, nobody at your local university will leave you standing outside.
    Seeing stuff like this make me profoundly happy and say about Intel what you want, but this is a service to society (and their PR-dept. :) ).
    The winners and most probably a lot of non-winners have shown how cool doing research (or hacking in the true sense of the work, which is essentially the same) is and they should get all that support to pursue whatever they're capable of doing.

    Nevertheless: critical and rational analysis of their work a much appreciated way to show respect (in my experience).

    So sit back, relax and
    #define BITCHMODE 0
    for once.

    Roland

  160. Re:Cool Lab Work - but Bad Crypto! by billstewart · · Score: 4
    The "only a few billion" comment is good, and some of the other poster's comments about it being much easier to find the sequence you're looking for by searching for the start token rather than having to sequence the whole mess are bang on as well.


    The solution for securing steganography is straightforward - it's to say "it's not crypto, it
    's just stego, but that can still be pretty effective" rather than saying "there's a trillion trillion possible sequences in this billion starting points, so nobody'd ever find it". So rather than hiding a plaintext message, which somebody might find, you encrypt your message with a real crypto algorithm, producing something that looks like random noise, and then if the underlying substrate you're hiding it in (whether its pictures, sounds, or DNA) looks enough like random bits, you're done; otherwise you make a model of the substrate and transform your cyphertext into that space. (Peter Wayner's paper on Mimic Functions has a really good discussion of this.) For an application like this, just getting the right ratio of nucleotides may be enough, or one or two levels of Markov chain beyond it. (Plus make sure the DNA isn't from a really popular mouse clone or whatever that somebody might have already sequenced :-)
    Then it does become much harder to find the cyphertext, which makes cracking it much much harder.


    Dirtside said:
    Because the pair of primers provides a trillion trillion options, she concludes that the code is essentially unbreakable.
    Only in the same way that public-key encryption is unbreakable, in that you can't brute-force it in any reasonable amount of time.

    and randombit said something similar.

    No, it's much different than that. Public-key encryption is exponentially hard, while this is just linear in the length of the chains. Computer-Crunching through a billion starting points looking for English-like sequences is a few minutes' work, though the chemical work in sequencing the whole mess is much slower. By contrast, it's easy to make a factoring job taking longer than the current age of the universe, just by making the keys a few hundred bits longer.

    --

    Bill Stewart
    New Fast-Compression-only CPR http://preview.tinyurl.com/dy575ks
  161. Hidden in Plain View; Public Key Biosteganography by Effugas · · Score: 5

    Surprisingly common form of steganography, really. There is *absolutely* no obfuscation actually hidden in the data itself--it's literally plaintext encoded as simple entries in the DNA sequence. The security comes from the fact that its surrounded by a significant amount of difficult to search(without knowledge of the correct primers) of non-secret information.

    Essentially, you're talking about a symmetric "location" secret protecting unencrypted content within a significant amount of data.

    Such techniques are actually used quite commonly as countermeasures against legally mandated discovery procedings--a large corporation(Microsoft or Tobacco companies in particular) is sued for its memo records; tens of thousands of boxes of unrelated material are delivered to the suing party on the presumption that they will hide the one "smoking gun" memo that will seriously damage the corporation.

    In the inevitable arms race that follows, the entire mass of data gets OCR'd and searched for critical keywords. That solves the legal issues, but without an efficient "OCR" method that can quickly sequence a chromosome into its underlying data, this student's steganographic method is extraordinarily effective.

    However, should such a technology be created, the size of the "keyspace" becomes drastically shortened: Apparently, the entire human genome will fit into six hundred megabytes--this is quite a bit of data, but it's not "trillions and trillions" of possibilities. A simple statistical analysis tool will reveal *any* non-natural data, as nCipher revealed when they showed that a cryptographic private key will stick out even within 2GB of fluff data--it's *TOO* random.

    What'd really blow me away is if Viviana was able to follow up this fascinating research with an implementation of Public Key Steganography. There was a paper referenced on Counterpane that talked about this; essentially it hides data in such a manner that the ensteganographer(and thus, anyone other than the recipient of the hidden message) cannot determine the exact location of their own message. The way I'd imagine it working, you'd mutate a virus such that it delivered a given message to a location dependant upon not the data being delivered but some publically available key. That key would essentially be a one way hash of bioreceptors that the virus should attach itself to, and you'd essentially have a restriction that the virus would not infect any cell that did not possess those specific bioreceptors. An attacker would need to sequence not only the global DNA sequence for changes but each possible type of cell that could have been modified to contain the secret, whereas the message reader would know exactly what types of cells to search--viola, your asymmetric primitive. Maybe you'd only find a link to the appropriate primer, or possibly your entire message, but you'd have your public key steganography implemented with biological methods.

    Funky.

    Yours Truly,

    Dan Kaminsky
    DoxPara Research
    http://www.doxpara.com

  162. Re:What about her education by mreece · · Score: 5

    Just to expand on the previous comment...

    I did not do my work for the Intel STS (I was the 6th place winner) in a laboratory, but I have worked in a university lab in the past. There are many high school students who do research in well-equipped labs. It isn't an unfair advantage - these opportunities are available to most people who have enough initiative and intelligence to pursue them.

    This year (if I remember correctly) there were 4 Intel finalists who participated in RSI (if I remember right, it was Feng Zhang, Viviana, Sasha Schwartz, and Elizabeth Williams). A few other finalists were in other summer research programs.

    Also, I recall Viviana saying that she ordered the DNA from a lab somewhere that will manufacture DNA with a given base-pair sequence... Apparently it isn't too expensive.

    I hope this clarifies some things...

    --
    Matt Reece
  163. Intel STI by mreece · · Score: 5

    I was one of the participants in this competition - I finished in 6th place with a project on adaptive wavelet methods for fluid dynamics problems. (I'm Matt Reece from Louisville, Kentucky).

    First of all, I would like to say that if anyone reading this is a high school student considering entering this competition, do it. It is very much worth the time you spend on your research if you can become a finalist. All 40 finalists get $5000, a laptop (650 MHz Pentium III), and a trip to D.C. where Intel pays for everything - very nice expensive dinners, meetings with Nobel laureates... it's an incredible program. The best part was definitely meeting the other finalists, though. They were all wonderful people and I have had a great week... Don't think these people are just science nerds (not that that's a bad thing, mind you). They're very well-rounded. Many speak foreign languages, play musical instruments, sports, etc.

    Also, the week is not all science - Intel provided a web center in the hotel with lots of nice computers equipped with Quake 3, so we could have big multiplayer deathmatches over the LAN. I also played cards more in the past week than I have in months, and generally just spent a lot of time hanging out with the other finalists.

    Anyway, to get on to some of the comments the rest of you have made about Viviana's project. First, I will say that I'm not as familiar with her work as I am with some of the other projects.

    She does attend a U.S. school - I think it's a public one but I'll have to look that up later. Personally, I attend a public magnet school (duPont Manual High School) and I know many of the other finalists do attend public schools.

    It would probably be best if Viviana responded to your comments about DNA steganography, as I'm not an expert in the area. Still, the project did seem to be very well done and she did an excellent job of presenting it to the public.

    As far as your comment about open source programmers... If an open source project involved a new algorithm or some other method that could be applied to science, then it would certainly stand a chance in the Intel competition. My wavelet code is open source, although at this point I haven't implemented enough features to make it very useful.

    Also, you might be interested to know that the judging is not solely based on the research. The first stages are based on a research paper - out of about 1500 applicants, 300 semifinalists were chosen and then from those 300, forty were chosen as finalists.

    The finalist judging is based on three 15-minute interviews in which judges ask questions related to science in general. Some questions are straightforward tests of scientific knowledge, others are more open-ended questions meant to see how well you can think. Some of the questions are things that no one knows...

    These judging interviews took place on Thursday and Friday (the 9th and 10th). The next two days, March 11th and 12th, involved the public presentations, where we set up display boards at the National Academy of Science and talked about our research with judges, scientists, and anyone else who showed up. The judges talked to students on Saturday, and from what I understand had made all their decisions just before the dinner at Mr. K's (great Chinese restaurant) Saturday night. The winners were announced Monday evening.

    So anyway, judging is based initially on the research, but the final awards are also based on general scientific knowledge and also ability to communicate that knowledge to others. The emphasis on communication is also evident in the Seaborg award, given to the student who best displays an excitement about science and a willingness to share that excitement - that award went to Eugene Simuni, who finished 5th. His work was all the more amazing because he's only lived in the U.S. for two years (he came here from Russia) and yet he's better at communicating science to the general public (in English, a language that he more or less taught himself) than most or maybe all of the rest of us who have been speaking English our whole lives.

    Well, there is much more I could say, but I just wanted to give you a better idea of what this competition is all about. It's a great program, and I would recommend it to anyone. If you have any questions about the Intel STS, feel free to ask me.

    --
    Matt Reece
  164. Cool Lab Work - but Bad Crypto! by billstewart · · Score: 5
    I don't know how much of this is the reporting, either by the judges or the press, vs. how much is the winner's understanding of the technology involved (it sounds like it's her mistake, and the judges didn't understand it.) The idea of stashing messages in DNA is cool, and doing the actual work to build it is definitely cool stuff for a high-school student. But the crypto isn't correct.


    Steganography is the art of hiding messages in things, where they aren't likely to be noticed, either because nobody'd think to look there, or because there's too much other junk for your message to stand out, or because you've done the work to make your message look similar to the background noise. The classic example is hiding a message in the low-order bits of a digitized photo image or a sound file, where they don't affect the output much, though they're usually visible if anybody looks.

    Stashing a secret message in a bunch of a DNA has a good chance of "they wouldn't look there", but if they *did* decide to look in the bunch of DNA, a message like "JUNE6_INVASION: NORMANDY" probably has different enough statistics from the rest of the DNA around it that it might stand out. Sure, it's much more obvious to the intended recipient, who's looking for the specific start and end "primer" sequences, and it's also much more obvious to someone who knows the alphabet of nucleotides she's using to represent letters (as opposed to having to guess from entropy, where there'd be too many false positives.) But the conclusion "Because the pair of primers provides a trillion trillion options, she concludes that the code is essentially unbreakable" is insupportable - If you encode your message in a way that has similar statistics to the background signals/noise, you can hide it pretty well, but she's implying that straight plaintext is also unfindable there, and it's not, any more than hiding it in the low order bits of a picture is.


    Nice work anyway, and it lets people make lots of entertaining comments about "Computer Viruses" :-)

    --

    Bill Stewart
    New Fast-Compression-only CPR http://preview.tinyurl.com/dy575ks
  165. Pretty cool, but check out the second place winner by Darby · · Score: 5

    He came up with an extension to a mathematical theorem by Ramanujan. This is pretty impressive since most people have no idea what that guy was talking about ;-)

    If you don't know, Ramanujan was an Indian mathematician who was born an "untouchable".
    He was poor, sickly and almost totally uneducated.
    He recreated a large portion of modern mathematics independently. He wrote to a British mathematician whose name escapes me with a lot of his work included. At first glance it looked like all previously proven theorems and so he disregarded it and threw it away. He started thinking about it and realized there were many novel approaches and new ideas so he brought him over to England and set him up at the university. He died a few years later due basically to poor health attributable to a really shitty life, but his work blew open doors into mathematical realms we are still trying to probe.

    So, in long ;-) , this kid might be a candidate for a Fields medal in the future.
    ---CONFLICT!!---

  166. MODERATORS! LEARN SOME BIOLOGY BEFORE MODERATING by yuriwho · · Score: 5

    JunkDNA's post nails the issue. There are too many high-rated posts criticising the cryptography used here. Cryptography has nothing to do with it. The message is easy to read but it is hidden in a large volume of DNA sequence. The human genome project (a worldwide effort) has been working for years to sequence the entire genome...still unfinished. She proposes to bury the message in the genome of an organism. To try and use your sophisticated cryptography breaking algorithyms to "break the code" you first would have to sequence all the DNA present in your suspect message DNA. Given that coded DNA could be stored anywhere on a spy (in a stain on a dress for example) you would have to be able to sequence the human genome thousands of times over (once for every stain/suspect location) to have the data to apply encryption cracking algorithyms to. With the wonderful invention of PCR (polymerase chain reaction), the code (two primers of defined sequence, ~ 18 base pairs in length) and the location of the stain are all that needed to read the message. This idea is brilliant. Its not based on crypto but on the unreadability of the data. Yet provides a method for the intended receiver to find the message with very little info. The beauty is that the decoding message is very small, simple and easily crypto'd into a conversation.

    This idea is so simple and elegant that I'm sure the intelligence agencies around the world will use it now, if they are not already

    --
    no sig.