Slashdot Mirror
Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
liqbase
Now where's my +1 Talent in every base?
if God wouldn't have used LISP to encode the darn sequence in the first place
Scientists: All your base pair are belong to us!
> Why do one chromosone have more genes than others?
Same reason some source code files contain more lines of code than others. They do different things.
Slashdot monitor for your Mozilla sidebar or Active Desktop.
From the fine article:
"The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
There are other variations which make us unique.
Alternate alleles*
Indels (insertions/deletions)
Variable numbers of repeats.*
The genetic code uses 4 letters, but I'll use English for explaination.
A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
"The cat and the dog" vs "the cat and the big dog".
In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".
Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
Comment removed based on user account deletion
You're just wrong about this. 20/10 means you can resolve something 20 feet away twice as well as the average person; similarly, 20/40 means you can resolve something 20 feet away half as well as the average person. But 20/10 does not mean your eye is misshapen or your sense of perspective is off. It simply means you have better distance vision than average. Now, you may also be "farsighted" -- i.e., have trouble resolving things close up -- but the two are basically independent of each other.
;)
20/20 isn't "perfect," BTW. Human vision is very good compared to that of most animals, but it's laughably bad compared to that of, e.g., birds of prey. I guarantee you an eagle can see better than you can whether it's spotting a rabbit from a few hundred feet in the air, or staring that same rabbit in the face right before dinnertime.
The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.
Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.
All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.
Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.
For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.
At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.
In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.
I've fallen off your lawn, and I can't get up.