Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
liqbase
Now where's my +1 Talent in every base?
if God wouldn't have used LISP to encode the darn sequence in the first place
I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!
"To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
-- Academician Prokhor Zakharov,
"Address to the Faculty"
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
Evolution is a process with a lot of randomness. So I'd instead ask the question: Why would you exepct them to be the same?
Scientists: All your base pair are belong to us!
Your single nucleotide polymorphisms are unique! Just like everyone else's.
ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
The grass is always greener on the other side of the light cone.
> Why do one chromosone have more genes than others?
Same reason some source code files contain more lines of code than others. They do different things.
Slashdot monitor for your Mozilla sidebar or Active Desktop.
From the fine article:
"The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
There are other variations which make us unique.
Alternate alleles*
Indels (insertions/deletions)
Variable numbers of repeats.*
The genetic code uses 4 letters, but I'll use English for explaination.
A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
"The cat and the dog" vs "the cat and the big dog".
In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".
Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
Why do one chromosone have more genes than others
Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!
The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
gtcatgcgatacgtaggcaaatcg2tgacggcagt
hmmm i guess its not as funny unless its binary
Just to add on to this
20/20 vision means that when you stand away from something at 20ft, what you see is what the normal person would see at 20ft.
20/40 is, well, if you stand 20ft away, you see what a normal person would see at 40ft
Same goes for 20/10.
You seem to be under the impression that the number 1000 has some special meaning. Let's try your comment again, in octal:
pi * 1750 genes. Got to love those fun coincidences
Not so exciting now, is it? Nature is not decimal-based. The only reason we tend to be is because of the number of fingers we have.
Comment removed based on user account deletion
Actually there are a few "numbers" that are "magic" in nature. Depending on the species.
10 certainly is important to us, having 10 fingers and 10 toes. Unless you're carpenter.
Asking a bee, you'd prolly be called crazy and 6 is the perfect number, from legs to comb.
A spider would probably tell you 8 is more important, from legs to their web's segments.
But since this genome has meaning for us, I'd wager that our "magic" applies.
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug
This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.
Automated DNA sequencing software