Slashdot Mirror


Human Genome Sequencing Completed

Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

252 of 337 comments (clear)

  1. First Chromosome by LiquidCoooled · · Score: 5, Interesting

    I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here

    --
    liqbase :: faster than paper
    1. Re:First Chromosome by Anonymous Coward · · Score: 1, Interesting

      That's why they named that movie with those letters.

    2. Re:First Chromosome by PyrotekNX · · Score: 5, Funny

      I always wondered where the movie GATTACA got it's title.

    3. Re:First Chromosome by Anonymous Coward · · Score: 1, Funny

      Please don't spoil the ending.

    4. Re:First Chromosome by Anonymous Coward · · Score: 1, Interesting

      Whoops.. too large for http.. try this instead.

    5. Re:First Chromosome by LokiSteve · · Score: 1, Funny

      You mean that for all His infinite intelligence, God couldn't come up with a decent compression algorithm?

      --
      END OF LINE.
    6. Re:First Chromosome by tomhudson · · Score: 4, Funny

      Well, now that they've sequenced the Genome, can sequencing the KeDE be far behind?

    7. Re:First Chromosome by Ethan+Allison · · Score: 1

      404

    8. Re:First Chromosome by Frogbert · · Score: 1

      ... Followed by Quagmire shouting "All Right" whilst thrusting his pelvis

    9. Re:First Chromosome by phoenix321 · · Score: 1

      I think He placed more emphasis on useful redundancy, data integrity and versatility. Or all compressed chromosome species were wiped out when bandwidth got cheap.

    10. Re:First Chromosome by madsh · · Score: 1

      Not to be picky... but I am pretty sure there is only one of them... at around chr1:4,618,578-4,618,626

      Actually you usually only have to have a sequence 8-10 basepairs long to locate one unique position in the whole genome.

    11. Re:First Chromosome by D-Cypell · · Score: 1

      These are all steps on the path to enlightenment.

    12. Re:First Chromosome by sidfaiwu · · Score: 1

      There's a typo on line 748.

    13. Re:First Chromosome by trentblase · · Score: 2, Informative
      Funny you should mention that, since acording to wikipedia:

      "Each draft sequence has been checked at least four to five times to increase 'depth of coverage' or accuracy. About 47% of the draft were high-quality sequences. The final version will have been checked eight to nine times giving an error rate of 1 in 10,000 bases."

      Which means that there will be an estimated 300,000 errors in the project.

    14. Re:First Chromosome by cloak42 · · Score: 1

      Amazingly enough, I never realized that until I looked at that string of letters just now.

    15. Re:First Chromosome by Goaway · · Score: 1

      "Score:5, Funny"?

      For stating the obvious? For stating that you didn't get the obvious until now? What?

      http://imdb.com/title/tt0119177/trivia

    16. Re:First Chromosome by Carbonated+Milk · · Score: 1
      Well, considering that unwound, the average length of a DNA molecule in a human chromosome is about 5 centimeters long, I'd say it's pretty good compression...

      http://hypertextbook.com/facts/1998/StevenChen.sht ml

    17. Re:First Chromosome by Anonymous Coward · · Score: 1, Funny

      All your base pair belong to us

    18. Re:First Chromosome by Profane+MuthaFucka · · Score: 1

      We're laughing at his improper use of the apostrophe in the word 'its'. So cute!

      --
      Fascism trolls keeping me up every night. When I starts a preachin', he HITS ME WITH HIS REICH!
    19. Re:First Chromosome by 6th+time+lucky · · Score: 1

      its (TTAGGG)n... No, seriously...

    20. Re:First Chromosome by 6th+time+lucky · · Score: 1

      Warning... 836MB !

    21. Re:First Chromosome by Jaruzel · · Score: 1

      You're not alone. I always wondered why the movie was called that! Now I know!

      -Jar.

      --
      Together, We Can Make Slashdot Better. I Do NOT Mod ACs. - Check Me Out
    22. Re:First Chromosome by eaglebtc · · Score: 1

      The sequence "GATTACA" appears at least 3 times in that new sequence on Sacred-Texts.

      --
      Homestarrunner.net -- It's Dot Com!
    23. Re:First Chromosome by xmda · · Score: 1

      I see the movie "Gattaca" mentioned several times in there. Isn't this some kind of "IP" (take your pick) violation...

  2. So now. by AltGrendel · · Score: 3, Funny

    Can we start the patent countdown clock?

    --
    The simple truth is that interstellar distances will not fit into the human imagination

    - Douglas Adams

    1. Re:So now. by Ant+P. · · Score: 1

      Already been started long ago, IIRC.

    2. Re:So now. by espressojim · · Score: 2

      You can't patent seqeuence info. You haven't been able to since 2000. Get with the times.

  3. Secret Project Complete by FhnuZoag · · Score: 5, Funny

    Now where's my +1 Talent in every base?

    1. Re:Secret Project Complete by Fjornir · · Score: 1

      Please don't go. The Drones need you. They look up to you.

      --
      I want a new world. I think this one is broken.
    2. Re:Secret Project Complete by drinkypoo · · Score: 1

      Whoop de doo. Get back to me when your units equipped with drop pods can make airdrops to any location.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    3. Re:Secret Project Complete by Tofino · · Score: 1

      This was indeed awesome!

  4. Would've been decoded sooner ... by Anonymous Coward · · Score: 5, Funny

    if God wouldn't have used LISP to encode the darn sequence in the first place

    1. Re:Would've been decoded sooner ... by LordOfTheNoobs · · Score: 1

      And I thought he used Malbolge

      --
      They're there affecting their effect.
    2. Re:Would've been decoded sooner ... by Fjornir · · Score: 3, Funny
      You thought wrong.
      I was taught assembler
      in my second year of school.
      It's kinda like construction work --
      with a toothpick for a tool.
      So when I made my senior year,
      I threw my code away,
      And learned the way to program
      that I still prefer today.

      Now, some folks on the Internet
      put their faith in C++.
      They swear that it's so powerful,
      it's what God used for us.
      And maybe it lets mortals dredge
      their objects from the C.
      But I think that explains
      why only God can make a tree.

      For God wrote in Lisp code
      When he filled the leaves with green.
      The fractal flowers and recursive roots:
      The most lovely hack I've seen.
      And when I ponder snowflakes,
      never finding two the same,
      I know God likes a language
      with its own four-letter name.

      Now, I've used a SUN under Unix,
      so I've seen what C can hold.
      I've surfed for Perls, found what Fortran's for,
      Got that Java stuff down cold.
      Though the chance that I'd write COBOL code
      is a SNOBOL's chance in Hell.
      And I basically hate hieroglyphs,
      so I won't use APL.

      Now, God must know all these languages,
      and a few I haven't named.
      But the Lord made sure, when each sparrow falls,
      that its flesh will be reclaimed.
      And the Lord could not count grains of sand
      with a 32-bit word.
      Who knows where we would go to
      if Lisp weren't what he preferred?

      And God wrote in Lisp code
      Every creature great and small.
      Don't search the disk drive for man.c,
      When the listing's on the wall.
      And when I watch the lightning burn
      Unbelievers to a crisp,
      I know God had six days to work,
      So he wrote it all in Lisp.

      Yes, God had a deadline.
      So he wrote it all in Lisp.
      All credit to Julia Ecklar -- and (I believe) Heather Alexander who is singing the linked copy.
      --
      I want a new world. I think this one is broken.
    3. Re:Would've been decoded sooner ... by tinkerghost · · Score: 1

      Does encoding things in DNA constitute encryption for the DCMA?
      And does the govt get to bring the suit or does god have to show up in court personally? - I know he claims to, but I don't think Pat Robertson has the standing.......

  5. I'd like fries with that by gentimjs · · Score: 4, Funny

    I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!

    1. Re:I'd like fries with that by MBCook · · Score: 4, Insightful
      Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

      So, what if it was a choice between good vision and very high intelligence? How about between good vision or very low risk of cancer/heart disease?

      Bad vision is correctable. If there is a trade off to make, good vision would be something that wouldn't be too hard to trade for something better.

      --
      Comment forecast: Bits of genius surrounded by a sea of mediocrity.
    2. Re:I'd like fries with that by 0racle · · Score: 1

      The above poster didn't indicate that the poor eyesight was a trade off, they specifically asked for it leading me to believe they are among the many idiots in the world that think 20/10 eyesight is better then perfect.

      --
      "I use a Mac because I'm just better than you are."
    3. Re:I'd like fries with that by CoughDropAddict · · Score: 1
      Care to explain the difference? The "idiots" who wrote the Visual acuity article on Wikipedia are apparently under the same misunderstanding:
      It is possible to have vision superior to 20/20: the maximum acuity of the human eye without visual aids (such as binoculars) is generally thought to be around 20/10 (6/3).
    4. Re:I'd like fries with that by k98sven · · Score: 3, Interesting

      They two traits were related somehow, even though you wouldn't think it.

      Which is more of a typical example of Science challenging our preconceptions than actual "oddity".

      To make an analogy, if you came across a switchboard with 100 light bulbs and 100 switches, you'd probably assume each switch turned on a light. Then you'd be confused to discover that some switches turned on two lights, some lights needed several switches to be on, and some switches did nothing at all.

      Of course, if you looked under the hood and saw how the thing was wired, you'd then find that there wasn't actually anything strange going on, just that your assumption of how the thing worked was oversimplified.

      I think this oversimplification is one of the reasons some people have trouble understanding evolution. It's a bit hard to understand how things like heireditary genetic diseases could exist if you assume that it's a completely independent property (and indeed, most of them probably wouldn't exist if it was).

      Another fun example of non-obvious traits in humans is that a single SNP (prevalent in East Asians) causes you to sweat less, but also causes you to have dry and crumbly earwax instead of the gooey, sticky stuff most people have.

    5. Re:I'd like fries with that by khallow · · Score: 2, Informative
      Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

      That doesn't mean that the traits will always stay linked. They probably result from residing on the same chromosome. Such things often can be seperated over time with a lucky chromosome aberration.

    6. Re:I'd like fries with that by thisissilly · · Score: 1
    7. Re:I'd like fries with that by Daniel+Dvorkin · · Score: 5, Interesting

      You're just wrong about this. 20/10 means you can resolve something 20 feet away twice as well as the average person; similarly, 20/40 means you can resolve something 20 feet away half as well as the average person. But 20/10 does not mean your eye is misshapen or your sense of perspective is off. It simply means you have better distance vision than average. Now, you may also be "farsighted" -- i.e., have trouble resolving things close up -- but the two are basically independent of each other.

      20/20 isn't "perfect," BTW. Human vision is very good compared to that of most animals, but it's laughably bad compared to that of, e.g., birds of prey. I guarantee you an eagle can see better than you can whether it's spotting a rabbit from a few hundred feet in the air, or staring that same rabbit in the face right before dinnertime. ;)

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    8. Re:I'd like fries with that by AnFraX · · Score: 1

      20/10 vision means that the eyes have 4 (2^2) times the density of light receptors as one with 20/20. 20/20, in layspeak means that one's eyes focus perfectly. 20/10 is a bit of a misnomer in reality, it generaly means that one has a higher receptor density. There is a reason why glasses and contact prescriptions are measured in diopters, it clears up alot of confusion.

    9. Re:I'd like fries with that by visgoth · · Score: 1
      20/10 vision could result from simply having "clearer", more precisely shaped corneas and lenses in your eyes. In this case eye strain would be a non factor, as the muscles would not be overcompensating.

      There's studies being done using adaptive optics to enhance human vision to far beyond even 20/10 accuracy. Here's a google search to get people started.

      --
      My patience is infinite, my time is not.
    10. Re:I'd like fries with that by MBCook · · Score: 1
      I should have checked Wikipedia. Thanks for the link.

      I keep forgetting just HOW MUCH STUFF Wikipedia has. They are quickly approaching Tower of Babble / Library of Alexandria status in many ways (at least in English).

      --
      Comment forecast: Bits of genius surrounded by a sea of mediocrity.
    11. Re:I'd like fries with that by visgoth · · Score: 1

      Bah, I clicked submit too soon. I wanted to add that 20/10 vs 20/20 vision could be seen as having more resolution. For example, go play an fps at 640x480, and then on the same monitor go play it at 2048x1024. The image itself is not magnified, and yet you can see far away things much better. Why? Because more information is being passed to your visual processing unit...

      --
      My patience is infinite, my time is not.
    12. Re:I'd like fries with that by Elemenope · · Score: 1

      Sooooo....it's only a matter fo time before either God or Rome burns it all to the ground. ;)

      --
      All the techniques ever used to make men moral have been themselves thoroughly immoral... (Nietzsche)
    13. Re:I'd like fries with that by Fred_A · · Score: 2, Funny

      It is being passed much more slowly though. Everyone knows that people with 20/10 vision have less FPS.

      --

      May contain traces of nut.
      Made from the freshest electrons.
    14. Re:I'd like fries with that by hotdiggitydawg · · Score: 1

      Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

      <surprise>You mean in Soviet Russia, chromosomes really do sequence you?</surprise>

    15. Re:I'd like fries with that by prattle · · Score: 1
      all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

      True. I would have assumed the streak to be yellow. :-)

      --
      "We are here on Earth to fart around. Don't let anybody tell you any different!" -- Kurt Vonnegut
    16. Re:I'd like fries with that by camperdave · · Score: 1
      A visual acuity of 20/20 is frequently described as meaning that a person can see detail from 20 feet away the same as a person with normal eyesight would see from the same distance. If a person has a visual acuity of 20/40, that person is said to see detail from 20 feet away the same as a person with normal eyesight would see it from 40 feet away.
      - Wikipedia.

      20/10 IS better than 20/20. You can see at 20 feet what the average person can at only 10 feet. The misunderstanding is that 20/20 means perfect. It doesn't. It merely means average.
      --
      When our name is on the back of your car, we're behind you all the way!
    17. Re:I'd like fries with that by eth1 · · Score: 1

      "Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it."

      Disclaimer: trying to remember from 9th grade bio here... :)
      Those trais are probably related by being close to each other in the chromosome. Those traits are likely to stick together (like blue eyes and light hair) during normal reproduction. I would think if you're genetically engineering something and modifying the genes directly, you could avoid such issues.

    18. Re:I'd like fries with that by Arkaein · · Score: 1

      Just to add a few more points about the quality of human vision, birds of prey certainly have greater visual acuity, but I wouldn't say humans are laughably bad in comparison. Humans can resolve about 60 cycles per degree (cycles in a sine wave grating, typical measure of acuity) while eagles can resolve about 150 cycles/degree. In other words, an average eagle has vision of about 20/8.

      Also, while humans have fairly mediocre night vision, eagles (and I presume other related birds of prey) have even worse, and rarely leave their roosts at night.

    19. Re:I'd like fries with that by Citizen+of+Earth · · Score: 1

      I guarantee you an eagle can see better than you can whether it's spotting a rabbit from a few hundred feet in the air, or staring that same rabbit in the face right before dinnertime. ;)

      An Eagle's built-in binoculars are about 3x. My add-on ones are about 21x. I think we have found a way to compensate for our natural shortcomings.

    20. Re:I'd like fries with that by minginqunt · · Score: 1

      I remember hearing about how there were fox fur breeders somewhere (like in Russia).

      Surely, in Russia, Fox Fur breeds... oh wait, never mind.

    21. Re:I'd like fries with that by Citizen+of+Earth · · Score: 2, Funny

      Everyone knows that people with 20/10 vision have less FPS.

      Dogs actually have a higher FPS perception than we have. OTOH, they've been known to eat their own poop. There's an efficiency/complexity tradeoff in neural computation systems.

    22. Re:I'd like fries with that by Fordiman · · Score: 1

      I'm tall and intelligent with beautiful hair... am I gonna go bald?

      --
      110100 1101000 1101000 1100110 0 1101111 1101000 1100011 1
    23. Re:I'd like fries with that by stormcoder · · Score: 1

      I vote Klingon.

      --
      Sorry my bullshit sensor overloaded.
    24. Re:I'd like fries with that by Daniel+Dvorkin · · Score: 1

      Ah hah, I hadn't known that about night vision. Interesting!

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    25. Re:I'd like fries with that by Daniel+Dvorkin · · Score: 1

      Well, yes, and a rifle makes us tougher than a bear, and a car makes us faster than a cheetah, and ... My point was that there's nothing inherently "perfect" about the average, or even the best, of the capabilities of any species, including us.

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    26. Re:I'd like fries with that by binarysins · · Score: 1

      When I was younger and in the Marines, my vision was measured as 20/15. I could see things at a distance of 20 feet with the same acuity as someone with 20/20 vision has to be at a distance of 15 feet to see.

      I was (and am) not:

      1) Farsighted
      2) Nearsighted
      3) Myopic
      4) In need of glasses or contact lenses

      Sorry, but you're wrong on this; 20/10 or 20/15 indicates better visual acuity and is independent of any other visual deficiencies such as near or farsightedness

    27. Re:I'd like fries with that by flogic42 · · Score: 1

      That would certainly explain why almost no professional sports players are very intelligent.

      --
      Check out my women's designer clothing store.
    28. Re:I'd like fries with that by Citizen+of+Earth · · Score: 1

      That would certainly explain why almost no professional sports players are very intelligent.

      They may also have a touch of "Pretty-Girl Syndrome". If the players are exceptionally good at a young age, then they never have to put any effort into learning anything, doing anything for themselves, or being non-assholes.

  6. MOD PARENT UP! by Silverlancer · · Score: 1

    Alpha Centauri reference = complete win!

    1. Re:MOD PARENT UP! by ikkonoishi · · Score: 1
      Well he beat me to it. Oh well.

      To map the very stuff of life; to look into the
      genetic mirror and watch a million generations
      march past. That, friends, is both our curse and
      our proudest achievement. For it is in reaching to our
      beginnings that we begin to learn who we truly are.
       
              -- Academician Prokhor Zakharov,
                  "Address to the Faculty"
  7. A simple question by helioquake · · Score: 3, Interesting

    Why do one chromosone have more genes than others?

    1. Re:A simple question by WickedScorp · · Score: 3, Informative

      They are all different sizes. Chromosomes are numbered from largest to smallest 1 - 22 (except 21 and 22; 21 is actually the shortest and 22 is slightly bigger; the mistake was made in early cytogenetics because they couldn't distinguish the sizes well enough and those two were named incorrectly) + X and or Y. So chr 1, being very large, has a very large number of genes just because it's huge. It isn't the most gene dense, however, which is chromosome 19 with more genes / Mb than elsewhere in the genome.

    2. Re:A simple question by SnowZero · · Score: 4, Insightful

      Evolution is a process with a lot of randomness. So I'd instead ask the question: Why would you exepct them to be the same?

    3. Re:A simple question by FTL · · Score: 5, Informative

      > Why do one chromosone have more genes than others?

      Same reason some source code files contain more lines of code than others. They do different things.

      --
      Slashdot monitor for your Mozilla sidebar or Active Desktop.
    4. Re:A simple question by pintpusher · · Score: 1

      chromosome 19 with more genes / Mb than elsewhere

      luckily, this amazing breakthrough will help you store chr19 in less space.

      --
      man, I feel like mold.
    5. Re:A simple question by helioquake · · Score: 1

      So it is both the size and density that make the difference.

      Thanks, I hope someone mod you up.

    6. Re:A simple question by WickedScorp · · Score: 1

      Absolutely. Both size and density are important. For example, three copies of a chromosome are generally incompatible with life. But we see people with Down Syndrome all the time. One reason is that Chromosome 21 is both the shortest chromsome AND relatively gene poor compared to the rest of the genome.

    7. Re:A simple question by mapkinase · · Score: 1

      Duh!

      --
      I do not believe in karma. "Funny"=-6. Do good and forbid evil. Yours, Oft-Offtopic Flamebaiting Troll.
    8. Re:A simple question by cnettel · · Score: 1
      That suggests some organization. It's more like why one patch in the sky contains more stars than another. Of course, there are some patterns, like the original Milky Way streak towards the center of the galaxy, but most of it is just a coincidence without any real "reason".

      Another way to put it is that there has obviously not been enough of a disadvantage to have varying chromosome sizes, alternatively some slight advantage in maintaining something similar to the current layout. (Of course, significant chromosomal changes are a quite rare event, as they generally result in infertility, even if it would just be a rearrangement without any "real" damage.)

    9. Re:A simple question by natrius · · Score: 2, Informative

      In addition to what the other posters said, the chromosomes are numbered by their size up chromosome 22, then the 23rd pair is the X and/or Y chromosomes. Since this is chromosome 1 we're talking about, it's the largest one.

    10. Re:A simple question by Jasin+Natael · · Score: 2, Insightful

      I also consider that one of the chromosomes could maintain (as a unit) the code for some very complex interaction that can't be further broken down. Maybe something to control the expression of genes, p2p communication (to correlate production of proteins, etc.), or even the definition of types for cell differentiation. Or a kind of file full of unique keys to keep the immune system from attacking the body's own cells (errors in which might result in allergies). Consider the size of concurrency control and locking code in Enterprise software. It's easy to imagine that one chromosome would be the largest by far, especially if it contains an operation that cannot be split into multiple parts, and any subsequent additions to code could appear randomly on any of the 23.

      Perhaps I'm dead wrong -- I'm not a genetic researcher -- but whatever corpus of code serves functions like these, assuming they're not all n-th level emergent properties of a massive number of proteins, would intuitively seem to be much less tolerant of fragmentation than others. I'm betting that it contains some kind of code where having it all in one place increases its effectiveness to a point of conferring a survival advantage.

      --
      True science means that when you re-evaluate the evidence, you re-evaluate your faith.
    11. Re:A simple question by Citizen+of+Earth · · Score: 1

      Since this is chromosome 1 we're talking about, it's the largest one.

      The title "GATTACA" appears in the first 1000 lines three times. Conspiracy theorists may commence freaking out.

    12. Re:A simple question by espressojim · · Score: 1

      You know, the chromosomes are of different size. This goes from about (logs into database and checks) 246 Mb to 47 Mb.

      You'd guess (and be mostly right) that genes are randomly placed on chromosomes, so chromosome length determines this. You also have to remember that there are (or were) gaps in the genome where you data isn't mapped. Also, not all genes have been predicted yet, and some genes are predicted, but not yet proved to exist. So, these numbers are in flux.

      Here's the length of all the chromosomes in base pairs, given in order of chromosomes from 1-22, then X and Y (this is based on build HG16):

      If you do 30 seconds of bioinformatics, you can generate the chromosome, number of genes per chromosome, and average number of genes per 1M bases:

      1 2262 9.19
      2 1469 6.03
      3 1252 6.28
      4 812 4.23

      I officially have no idea why 17 and 19 are unusually rich in gene count. However, this is from 2 builds back in the genome, so it would be interesting to see how data has changed (but it's outside the scope of this slashdot post for me to work up that analysis when I'm just wasting time here.)

  8. It's the website, silly! by Anonymous Coward · · Score: 1, Insightful

    Any links to a site like "sacred-texts.com" gets a near automatic (-1, Religious) moderation. This can be overcome, but only if someone with mod points actually bothers to *read* the item in question.

    Naturally, this is quite rare. I mean, I didn't even look at anything but the name of the website you linked to, and I certainly don't have any mod points.

    1. Re:It's the website, silly! by LiquidCoooled · · Score: 1

      Well, since it was the first thing that came up when I searched google for DNA Chromosome code
      I thought it would do for a bit of a laugh, but its certainly not OT.

      (thought I know these comments are...)

      --
      liqbase :: faster than paper
  9. Re:Ah yes... by QuantumG · · Score: 1

    That movie has a lot to answer for. Unfortunately the level of public education in these matters hasn't gone up much since then. Which is a shame, because soon the technology will exist that allows us to cheaply sequence anyone or anything's DNA. The potential health benefits of such technology are extraordinary. Imagine going to the doctor with a cough. The doctor takes a sample of your phlegm and ten seconds later has a full genetic sequence of the virus that has infected you. Matching it against a medical database removes the guess work from treatment. And that's just the tip of the iceberg.

    --
    How we know is more important than what we know.
  10. In a slow elderly Eastern European accent.... by GoofyBoy · · Score: 4, Interesting

    "To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
          -- Academician Prokhor Zakharov,
          "Address to the Faculty"

    --
    The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
    1. Re:In a slow elderly Eastern European accent.... by Jerf · · Score: 2, Interesting

      Why do you insist that the human genetic code is "sacred" or "taboo"? It is a chemical process and nothing more. For that matter -we- are chemical processes and nothing more. If you deny yourself a useful tool simply because it reminds you uncomfortably of your mortality, you have uselessly and pointlessly crippled yourself. - Chairman Sheng-ji Yang, "Looking God in the Eye"

      Complete list of quotes here, although for full effect you really need to hear some of them. The voice acting on Alpha Centauri is among the best ever done for video games. Especially the Ascent to Transcendance sequence, though I find I prefer the second-to-last project to the last one.

      I'd post these, but every time I do my bandwidth gets shot all to hell. :)

  11. Oblig. by mk_is_here · · Score: 5, Funny

    Scientists: All your base pair are belong to us!

  12. Remember kids... by TheOldSchooler · · Score: 4, Insightful

    Your single nucleotide polymorphisms are unique! Just like everyone else's.

  13. Part of the sequence: by GroeFaZ · · Score: 4, Funny

    ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA

    --
    The grass is always greener on the other side of the light cone.
    1. Re:Part of the sequence: by Toba82 · · Score: 1

      I didn't know god spoke legalese. I guess our concept of lawyers as the spawn of satan will have to go.

      --
      I pretend to know more than I really do by mooching off google and wikipedia.
    2. Re:Part of the sequence: by KarmaOverDogma · · Score: 2, Funny

      Dear sir(s)

      You have posted parts of our patented human genome sequence without our prior authorization. We demand that you cease and decist this post and remove it immediatelty, or you will be hearing from our lawyers in short order.

      Sincerely,

      Genectics Mega Corp.

      --
      uR iGn0ranc3, Their Power
    3. Re:Part of the sequence: by ggvaidya · · Score: 4, Funny

      ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT

    4. Re:Part of the sequence: by rengolin · · Score: 1

      you cannot use c++ comments here! there's no EOL!

    5. Re:Part of the sequence: by norminator · · Score: 1

      ACGATCGTACATsorryCGCGTAGTAGCTAAATCGCCAforTCGCTCGAT CGAGGTATGCtheTAGTAGCTAGTGTAAATCGCCATCinconvenience GCGCCTCTC

    6. Re:Part of the sequence: by ggvaidya · · Score: 1

      Why do you think I used the 'AAAAAATTT' trigraph? :p

    7. Re:Part of the sequence: by rengolin · · Score: 1

      LOL! My bad, It was mixd up with other keywords and statements and I mised! ;)

  14. Re:Ah yes... by WickedScorp · · Score: 3, Interesting

    I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practical medical impact in daily life. Screen cancer samples for chromosomal abnormalities and mutations has led to the development of rational therapy for specific cancer types. Where everything is leading is rational therapy overall. Individualized medicine and preventative medicine are the goals. I do agree with you that there are dangers associated with such knowledge. The question is whether we can use it to benefit the everyday man or woman to improve the quality of life for everyone.

  15. SNPs by Michael+Woodhams · · Score: 5, Informative

    From the fine article:
    "The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

    There are other variations which make us unique.
    Alternate alleles*
    Indels (insertions/deletions)
    Variable numbers of repeats.*

    The genetic code uses 4 letters, but I'll use English for explaination.
    A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
    An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
    "The cat and the dog" vs "the cat and the big dog".
    In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
    Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".

    --
    Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
    1. Re:SNPs by WickedScorp · · Score: 1

      Don't forget large scale copy number polymorphims. Wigler, Iafrate, etc. If you concur that the data is really there. I'm disposed to believe them.

    2. Re:SNPs by Michael+Woodhams · · Score: 1

      I was unaware of that - thanks.

      There are also pathological cases, such as an extra copy of a chromosome (e.g. Down syndrome.)

      --
      Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
    3. Re:SNPs by LS · · Score: 1

      Thanks for the "plain" English, now again WTF are you talking about? I have no idea. Your comparisons in quotes make no sense. cat vs hat? big vs small? cat vs dog? What are these supposed to represent again?

      --
      There is a fine line between being a cultivated citizen and being someone else's crop. - A. J. Patrick Liszkie
    4. Re:SNPs by cnettel · · Score: 1

      I don't see why you would mention alternate alleles as something different. They're just SNPs kept closely together, or even indels within the coding sequence. (And some other traits have been shown to actually be varying repeat lengths, as well.) From a phenotypic perspective different alleles are naturally different than "hidden" markers, and of course we have a significant selection pressure on that material, but they're still not a different kind of variation.

    5. Re:SNPs by macklin01 · · Score: 1

      Interesting post. I noticed that the "Variable numbers of repeats" looks a lot like microsatellite instability (MSI), where extra copies of short sequences get inserted. Like ATATAT becomes ATATATAT. I'm not entirely up-to-date on what happens as a result, but certainly the encoded protein may lose or alter its function. This type of genetic instability is characteristic of certain types of cancer, like certain colorectal cancers, particularly when a mutation knocks out a crucial repair pathway gene.

      Do you have any insight if these truly are similar, or just look that way? (I'm also pretty new to the genetic aspects of cancer, and I'm trying to learn all I can.) Also, do you have any good web references that you could recommend for further learning on these topics? It would be very helpful for this mathematical biologist. :-)

      Thanks again for an interesting post! -- Paul

      --
      OpenSource.MathCancer.org: open source comp bio
    6. Re:SNPs by LS · · Score: 1

      Ah, so the examples were *strings*. He said *English*... big difference. If he just said strings to begin with, I would have understood what he was getting at... I thought the actual nouns in these strings were important and had some kind of meaning.

      --
      There is a fine line between being a cultivated citizen and being someone else's crop. - A. J. Patrick Liszkie
    7. Re:SNPs by MikeBabcock · · Score: 1

      They were english strings.

      Don't be a jerk.

      He said english, it was english. Poor grammar english but english nonetheless.

      --
      - Michael T. Babcock (Yes, I blog)
    8. Re:SNPs by PMuse · · Score: 1

      I thought the actual nouns in these strings were important and had some kind of meaning.

      In a sense, they do have meaning, I think. That is, English speakers will recognize that, when expressed, the string "The cat and the dog" produces something different from the string "the hat and the dog". The next step will be to learn what effects the various differences in the genetic sequence produce.

      --
      "We reject as false the choice between our safety and our ideals." --The American President (20.1.2009)
  16. Finally! by Tehrasha · · Score: 2, Insightful

    So we can start compiling from source code now! We better get this covered under the GPL quickly.

  17. Re:Have they found the gene by Anonymous Coward · · Score: 1, Interesting

    Blacks were bred to have more physical ability by slave owners, much like dog breeds were bred to encourage certain traits. There is no gene for it and these qualities will in fact recede over time.

  18. Because it evolved by GrahamCox · · Score: 4, Interesting

    Why do one chromosone have more genes than others

    Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!

    The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.

    1. Re:Because it evolved by GrahamCox · · Score: 1

      Of course I meant 46 chromosomes...

      Actually if it was designed by a computer geek, no doubt there would be 32,768 total genes and 32 chromosomes, with 1,024 genes per chromosome.

    2. Re:Because it evolved by fyngyrz · · Score: 5, Funny
      Nonsense. We'd design it to have 32 bits to index the chromesomes, 32 bits to index the genes in each chromesome, and an alternate set of registers so you could quickly swap chromesomes for different tasks. You could clock it at any speed, or leave it static, and it'd never lose data. It'd be radiation hardened, low-power, erasable by ultraviolet, reprogramable by anything from dip switches to GHz pulse trains, internally and externally redundant, solar-powered, ecologically friendly, and involve a great deal of caffiene. Primary developmental needs would be met by carefully metered infusions of pizza.

      However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.

      Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.

      All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.

      Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.

      For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.

      At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.

      In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.

      --
      I've fallen off your lawn, and I can't get up.
    3. Re:Because it evolved by zenmojodaddy · · Score: 2, Funny

      Maybe in Arkansas...

    4. Re:Because it evolved by Sigg3.net · · Score: 1

      You are saying that it was Unintelligently Designed?

    5. Re:Because it evolved by Malakusen · · Score: 1

      I cannot foresee any point in the near future where regular people will have a need for more then 640 chromosomes of genetic material.

      --
      Never give in--never, never, never, never, in nothing great or small, large or petty, never give in except to conviction
    6. Re:Because it evolved by josh_miller · · Score: 1

      Yeah, we're Legacy code.

    7. Re:Because it evolved by ggvaidya · · Score: 1

      *stands up and applauds*

    8. Re:Because it evolved by fyngyrz · · Score: 1

      If I had mod points, and I wasn't me (because I've posted) I'd mod you informative. Someone else should have anyway. But then, this is slashdot. Moderation is reserved for more important things. Like, uh, humor. (ducks)

      --
      I've fallen off your lawn, and I can't get up.
  19. 3,141 genes by Iznogood · · Score: 2, Funny

    pi * 1000 genes. Got to love those fun coincidences.

    1. Re:3,141 genes by pchan- · · Score: 4, Informative

      You seem to be under the impression that the number 1000 has some special meaning. Let's try your comment again, in octal:

      pi * 1750 genes. Got to love those fun coincidences

      Not so exciting now, is it? Nature is not decimal-based. The only reason we tend to be is because of the number of fingers we have.

    2. Re:3,141 genes by brianf711 · · Score: 1
      The exact number of genes may well turn out to be slightly higher (or less). This number probably is after a good estimate to identify potential genes and reading frames and weed out pseudogenes, but the number may not be exact. Secondly, what do you call microRNA? These are sometimes very short transcribed RNAs that do not get translated into proteins for their function. If it is a functional nucleotide message, but doesn't code for a protein, is it a gene? I don't know the convention, but it is probably not a gene, but maybe it should be.

      In addition, it is very possible there was some human tuning of the number to have it come out 3,141 instead of 3,142 or 3,140 for example.

    3. Re:3,141 genes by grolschie · · Score: 1

      mmmmMMMMM...... 1000 pies and my jeans won't fit anymore. Co-incidence?

    4. Re:3,141 genes by gwayne · · Score: 2, Funny

      That's no coincidence, it's the circle of life...

    5. Re:3,141 genes by vrt3 · · Score: 2, Insightful

      Indeed, and the number of fingers we have is specified in the genes, so maybe it's not a coincidence after all?

      --
      This sig under construction. Please check back later.
    6. Re:3,141 genes by Opportunist · · Score: 4, Interesting

      Actually there are a few "numbers" that are "magic" in nature. Depending on the species.

      10 certainly is important to us, having 10 fingers and 10 toes. Unless you're carpenter.
      Asking a bee, you'd prolly be called crazy and 6 is the perfect number, from legs to comb.
      A spider would probably tell you 8 is more important, from legs to their web's segments.

      But since this genome has meaning for us, I'd wager that our "magic" applies.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    7. Re:3,141 genes by the+dark+hero · · Score: 1
      Not so exciting now, is it? Nature is not decimal-based. The only reason we tend to be is because of the number of fingers we have.

      The Aztecs counted by twenties and also were a mathematically advanced civilization. Does that mean they counted with their toes?"

      --
      You constantly struggle for self improvement - and it shows.

      Hooray for bad Engrish on fortune cookies

    8. Re:3,141 genes by khallow · · Score: 1

      If something tends to be a certain way, implies that there are counterexamples, but that these are infrequent.

    9. Re:3,141 genes by Jogar+the+Barbarian · · Score: 1

      I'll say our magic applies... considering we can easily squash your aforementioned silly hexal and octal adherents.

      DECIMAL FOREVER!!!

      --
      3. Profit!
      2. ???
      1. On Soviet Slashdot, a Beowulf cluster of alien Natalie Portman overlords welcomes YOU!
    10. Re:3,141 genes by Xel · · Score: 1

      Not so exciting now, is it? Nature is not decimal-based. The only reason we tend to be is because of the number of fingers we have.

      That's why he said "fun coincidences" and not, "OMG! Obviously there is some amazing correlation here, we must file for large government grants to study this!!!"

      --
      "Eagles may soar, but weasels dont get sucked into jet engines."
    11. Re:3,141 genes by Opportunist · · Score: 2, Funny

      Superiority by having the bigger foot.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    12. Re:3,141 genes by gkhan1 · · Score: 1

      Ohh, stop coming here and making sense, you're ruining it for all of us!

    13. Re:3,141 genes by Opportunist · · Score: 1

      Yup. Exactly the point.

      --
      We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
    14. Re:3,141 genes by CODiNE · · Score: 1

      I multiplied 3 and 1,000 in hex and I still got 3,000. So was THAT a coincidence too??

      ALSO... 3141 in hex is C45 if you divide that by FF you get C!

      For the first time FMS is starting to make sense to me.

      --
      Cwm, fjord-bank glyphs vext quiz
    15. Re:3,141 genes by Trogre · · Score: 1

      Ah, but have you considered why we have ten fingers on each hand?

      --
      "Nine times out of ten, starting a fire is not the best way to solve the problem." - my wife
  20. One serious thing left to do by daemonenwind · · Score: 1

    Wake me when they make Cobra Commander.

    Joey stole mine when I was 12. He rocked.

    1. Re:One serious thing left to do by shinma · · Score: 1

      They genetically engineered Serpentor, not Cobra Commander. :P

      --
      Shinma
    2. Re:One serious thing left to do by Aeonite · · Score: 2, Informative

      I think what you're referring to is Serpentor, The Emperor, who was made *by* Cobra Commander from the DNA of the world's most evil people.

      http://en.wikipedia.org/wiki/Serpentor

  21. protein modelling by sc0p3 · · Score: 3, Insightful

    This is good news but not too useful until we can model protein shaping.

    The AGCT's code for proteins and so far we can only model very short combinations. All you coders keen for a life project have a crack at it. Theres 20 amino acids formed from combinations of three base pairs. The amino acids have attraction and repulsion properties with each other and their environment and form to make a unique shape. Its the analysis of that 3D shape that will solve:

    - all cancer - modelling protein shapes means instant cancer cures
    - bird flu - again modelling proteins means instant antibodies to diseases
    - the most toxic substance ever invented - it will also open up designer drugs

    1. Re:protein modelling by Charcharodon · · Score: 1
      It's already underway. Take a look see at http://www.grid.org/projects/

      Better yet download the client and throw some spare CPU cycles into the mix.

    2. Re:protein modelling by k98sven · · Score: 1

      All you coders keen for a life project have a crack at it.

      You do know it's not primarily a programming issue?


      Its the analysis of that 3D shape that will solve:
      - all cancer - modelling protein shapes means instant cancer cures


      Nonsense. Knowing the shape of a protein does not cure cancer in itself. You do know that the structures of thousands of proteins, hundreds of which are cancer related, are already known?

      bird flu - again modelling proteins means instant antibodies to diseases

      No, knowing the structure of a protein does not automatically give you a suitable antibody for a vaccine.

      the most toxic substance ever invented

      What?

      - it will also open up designer drugs

      What? "Designer drugs" is a term used to mean "illegal drugs with certain nonessential groups substituted to circumvent existing drug laws".

    3. Re:protein modelling by Dr.+GeneMachine · · Score: 2, Informative
      Sorry to say that, but you are overly optimistic here, as k98Sven stated above. I work in structural biochemistry, so let me clear up a few points here:

      First of all, you can't at the moment crack the protein folding problem by throwing more computational power at it. We still lack lots on insight into many of the fundamental forces governing protein folding. Electrostatics at that level are a nasty thing, for example. The scale of the system would require a quantum mechanical treatment, but then again the total systems are too large, not to speak of problems with the basis sets and parametrization for a QM treatment.
      Oh, and the protein folding and design problem has been shown to be NP-complete.

      Secondly, not all proteins even have defined structures. The class of so-called natively disordered proteins is large and might even comprise about 30% of the whole proteom. Those proteins only adopt structure in interaction with other proteins or other factors.

      Third, in many cases the structure doesn't help you very much. True, a cancer causing mutation might have a clear structural effect. In other cases, it could perhaps just subtly alter electrostatics on a protein surface, causing a slight difference in its interaction with another protein, which finally gets amplified way downstream a regulatory cascade where it causes the final problem. Knowledge of protein structures is useful to clarify that, but you need to know the whole interaction network to fully understand it.

      Fourth, the cell is crowded. Knowing the structure of an isolated protein in solution does not tell you all about its function in the cell, where it is in contact with lots of other proteins.

      Fifth, not only structure determines the function of a protein, but also its dynamics. Proteins move, and these movements are intricately linked to their function.

      Sixth, and final, if you want to use the structure of a protein as a basis for rational drug design, you have also to solve the design problem. How do you exactly build a compound with the desired properties? There is no completely rational approach implemented at the moment, much is just done by large-scale trial and error approaches.

      --
      This comment does not exist.
    4. Re:protein modelling by Dr.+GeneMachine · · Score: 1
      NP-complete? So if I give your a protein sequence and a predication of its structure you can tell if it is a correct predication with certainty? That is a big achievement.

      That would be the relevant decision problem, yes. Unfortunately, there is no know efficient algorithm for that class of problems... So, for now we have to rely mostly on exponential-time algorithms.

      --
      This comment does not exist.
    5. Re:protein modelling by vertinox · · Score: 1

      What? "Designer drugs" is a term used to mean "illegal drugs with certain nonessential groups substituted to circumvent existing drug laws".

      Actually, the term has fallen out of favor these days since the law enforcements main drug probelm is meth these days.

      However, in ten years, designer drugs will mean the drugs you go to the doctor, he pricks your finger to get your DNA, he runs it through a machine which emails the pharmacy exactly what drugs to make for your body makeup and condition, and by the time you arrive at the Drug store your prescription is made.

      It is what they mean by "designer drugs" these days.

      --
      "I am the king of the Romans, and am superior to rules of grammar!"
      -Sigismund, Holy Roman Emperor (1368-1437)
    6. Re:protein modelling by Bowling+Moses · · Score: 1

      To echo what the others have said, solving the structure isn't the end-all be-all. For instance in amyotrophic lateral sclerosis (Lou Gehrig's disease) a protein called superoxide dismutase 1 (SOD1) has been implicated as playing a role in the disease. Exactly how is unkown, but 10% of patients with the familial type of ALS have mutations to the gene. However, there are (last I looked a couple of years ago--I don't study the disease) about 80 or so different SOD1 mutations so linked. We have x-ray crystallographic structures of many of the SOD1 mutants, but despite the years of effort and tens of millions of dollars in obtaining and studying the structures they tell us very little. The mutations map all over the structure and there are no obvious reasons why the majority of them would do anything--the best guesses are they slightly destabilize the structure leading to formation of amyloid plaques and/or they alter the metal binding affinity potentially leading to different enzymatic functionality--which was suggested before we had hardly any SOD1 structures.

      One area I've been reading on a lot lately is bacterial pathogens and how they interact with the host. The guys leading us to potential targets are usually the geneticists, with the molbio and cell bio guys teasing out a number more and really cluing us into the molecular interactions. Protein structure's kind of the bottom feeder. Not bashing structural biology--that's my area of expertise. Everybody likes having the structures and an important structure will feed back into experiments for the molbio and cell bio guys. But a structure by itself doesn't necessarily mean anything. The structural genomics groups crank out crystal structures by the dozen but often don't know anything about their protein's physiological function. So it's data on a shelf waiting to be interpreted.

    7. Re:protein modelling by sc0p3 · · Score: 1

      you guys obviously have no world domination experience.

      Modelling AntiGens -> Custom Antibodies -> Instant Cancer Cure.
      Modelling AntiGens -> Custom Antibodies -> Instant Killer Toxin.
      And with water. Mix. Serve Cold.

    8. Re:protein modelling by magicchex · · Score: 1

      This is correct, the term for what use to be called designer drugs is now research chemicals.

      --
      How many fulltime jobs can one man have?
  22. and then there was a two...! by Anonymous Coward · · Score: 4, Funny

    gtcatgcgatacgtaggcaaatcg2tgacggcagt

    hmmm i guess its not as funny unless its binary

  23. Re:20/10 is better than perfect!!! by zeno_2 · · Score: 4, Informative

    Just to add on to this

    20/20 vision means that when you stand away from something at 20ft, what you see is what the normal person would see at 20ft.

    20/40 is, well, if you stand 20ft away, you see what a normal person would see at 40ft

    Same goes for 20/10.

  24. Re:I thought... by WickedScorp · · Score: 1

    Both right and wrong. In 2003 both the public effort and the effort at Celera released a "Finished" sequence that was basically 99% complete. It was as much of the genome as could be easily cloned and sequenced. But there have been gaps in the sequence. Since the release of the finished sequence the remaining gaps have slowly been resolved. I suppose by "finishing" chr 1 they are saying that all of the DNA that can be cloned and sequenced with current technology has been done.

  25. Re:Ah yes... by 19thNervousBreakdown · · Score: 1
    I'm a Human Geneticist

    Just who I was looking for!

    I've been hearing about genome sequencing for years now, and looked it up on Wikipedia and Google, but for the life of me I can't find out what it actually is, or what it tells you. I know it doesn't tell you what each gene does, although the first time I heard about it, before I thought about it I thought that might be it. Obviously, for any given species the majority of genes are going to be the same. Is sequencing finding out which ones have to be the same? I don't think it could be that, even with a large enough sample size you can never be sure that just because every one you've tested has the same value, every one has to have the same value. And if it can't tell what one value can go in a particular place, it can't tell you what possible values can go in a particular place.... So, doc, what's it all about? Is it good, or is it whack?

    --
    <xml><I><am><so><damn>Web 2.0</damn></so></am></I></xml>
  26. Re:Familiar Common Number? by modmans2ndcoming · · Score: 1

    or, perhaps the universe is one big transcendentally derived object.

  27. How do they know it's a "gene"? by jerometremblay · · Score: 2, Funny

    How do they differentiate junk dna from genes?

    I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?

    What makes a gene a gene?

    1. Re:How do they know it's a "gene"? by onco_p53 · · Score: 1
      What makes a gene a gene

      Well all genes start with the sequence "ATG" and end with a stop sequence eg. "TGA" (there are several). See http://en.wikipedia.org/wiki/Codon

      There are a lot of exceptions to all of this, eg. stop codons, RNAs, psuedo genes ect.. But it is generally true from a computational point of view.
    2. Re:How do they know it's a "gene"? by kromer · · Score: 2, Informative

      The answer, for bacteria and yeast genes are used to make protein. They start with a 3-base sequence that signals "start making protein," have some sequences that tell the cell which amino acids to put together to make the protein, and end with a 3-base sequence that signals "stop making protien." 3-base "stop" sequences occurs pretty frequently in the genome (just by random chance), so, if you find a long sequence that doesn't have a "stop" sequence, you can be pretty sure it's a gene. For more complicated organisms (like humans), it's much more difficult to tell what's a gene and what isn't, without figuring out what a gene does (because lots of human genes have what look like "stop" sequences in the middle of the gene)--but there are computer models of how genes appear different than "junk" DNA, that can be used to predict what is and isn't a gene. These aren't perfect, but they're fairly accurate.

    3. Re:How do they know it's a "gene"? by cnettel · · Score: 2, Informative
      In addition to what's already been mentioned, there are some highly characteristic start sequences "upstream" from the actual coding sequence, including what's called a "TATA box", a sequence of about eight nucleotides, where the most preserved part is TATA. The individual nucleotides vary a little, but it's still quite detectable in the overall noise.

      In addition, we have other effects. For example, there is a varying stability between GC and AT pairs, which gives a tendency to a biased ratio in "junk". This stability issue will naturally also possibly give a contribution to the coding sequence, but there, the selection towards specific function will often dominate. This means that you'll, generally, see a difference in GC/AT ratio between coding and non-coding.

      (Pseudo-genes, that is, simplified, genes that won't be transcribed anymore because they're slightly broken, are of course often quite hard to discriminate from real genes, how hard depends on the mechanism by which they were created.)

    4. Re:How do they know it's a "gene"? by danceswithtrees · · Score: 1

      Not quite so easy. DNA is transcribed into RNA and RNA is translated into protein. You can look for runs of DNA without stop codons called open reading frames (ORFs) but this does not give you a gene. That is because eukariotic organisms (mammals included) splice their RNA prior to translating into DNA. That means that genes have a lot of extra DNA (introns) interspersed between the DNA that actually encodes for protein sequence (exons). Genes often have a lot more intron (intervening) than exon (coding).

      I won't pretend to fully undertand the math involved but hidden Markov models (http://en.wikipedia.org/wiki/Hidden_Markov_Model) are used to determine the presence of genes. This gives the probability that a stretch of DNA is a gene so depending on the cutoff used, the gene count goes up and down a little bit.

    5. Re:How do they know it's a "gene"? by Peter+Mork · · Score: 2, Informative

      Determining what is (and is not) a gene is hard work. We know a number of rules (such as the aforementioned it must start with ATG), but these rules are largely of the form, if X is a gene then X has the following properties. These implications cannot be simply reversed; i.e., not all instances of ATG mark the start of a gene.

      In simpler organisms, you can simply scan for open-reading frames (i.e., instances of ATG) and keep reading until you hit a stop codon because there is no post-processing of the transcribed RNA. If the result has a reasonable length, you've probably found a gene.

      In complex organisms, once the RNA is transcribed, portions of the RNA are removed (spliced out). Thus, there could be a stop codon in the middle of the gene that is removed prior to translation. The splicing process is why certain repeated sequences are needed as filler material. During splicing the RNA strand has to be bent to bring the two ends together. In, for example, the cystic fibrosis gene (CFTR) if you don't have enough repeats, it is less likely that splicing will occur properly.

  28. Re:I thought... by brianf711 · · Score: 1

    Are you telling me "Mission accomplished" in 2003 was a little ahead of itself?

  29. Blasts.... by jrmiller84 · · Score: 1

    It's probably just me, but for some reason it seems like I've read about this happening already like three times. Maybe those were just updates on the progress but I swear I thought this was already completed. Maybe I'm just dupe weathered ;)

    --
    I will forever be a student.
    1. Re:Blasts.... by ej0c · · Score: 1

      Well, I just found on the HGP project page ( http://www.ornl.gov/sci/techresources/Human_Genome /home.shtml )that it was completed in 2003. Ant this page: http://www.ornl.gov/sci/techresources/Human_Genome /project/progress.shtml announces any number of completions since then. So yeah, a little explanation would be in order.

    2. Re:Blasts.... by cool_arrow · · Score: 1

      Agree. I recall an reading an article which indicated that the sequencing was done and now more work needs to be done in the study of the proteins.

  30. Re:Stupid Question by Anonymous Coward · · Score: 2, Informative

    Half answer:

    The beginning is very likely a non-coding region, since stuff near the ends can get damaged more readily. The chromosome itself probably does not exactly start with GAT, it probably has a few thousand bases worth of telomere, and this just happens the be the chunk that starts once they get past all that.

    Everybody has different genes, but the difference between two indviduals over the total range is measured in decimal-points of a percent. Big chunks of it are exactly the same from person to person.

  31. I'll bet this will make really great... by Weaselmancer · · Score: 1
    --
    Weaselmancer
    rediculous.
  32. A dozen sets would be signifigant by BlueCoder · · Score: 2, Insightful

    A dozen actual people please. It doesn't count if your just mixing chromosones from different people to claim you have a complete DNA decoded; there is no gaurantee that mix of dna would be viable. There ought to be a panel of scientists to select 12 people to have their DNA read that are willing to be studied for the rest of their lives. Six men and six women. At least some of which would be siblings. Only then can you actually decode DNA. You'll get 90% of the answers there.

    You always go with a base line. Then you read other people and compare and contrast them. Then add in other species. And voila, the genetic black box of subroutines that evolution found most useful that are 99.99999% of the answer. After that your left with mutations and figuring out what, and how, the code sequences do what they do and finally programming new sequences to test theory.

    In other words 30 years from now it will finally get interesting.

    1. Re:A dozen sets would be signifigant by cnettel · · Score: 1
      True, rearrangements do happen and, true, there is some chance that you have two lucky mutations in the same chromosome that each by itself is lethal. On the other hand, almost all haploid subsets of your genome are carrying lethal traits. So, what you request is sequencing of both copies. We want to get there, sometime, but if we should look for errors, I think the issues of being sure that the full contig sequence is the "true" one are more important, especially in repeat-rich sections.

      The current data is, counted just in correct base pairs vs. any human, probably over 99 % good. That's good enough to do a lot of cool analysis, and that work will keep the theorists happy while the boring prep work of sequencing more genomes, other species and more human individuals, goes on.

  33. Comment removed by account_deleted · · Score: 5, Funny

    Comment removed based on user account deletion

  34. Re:Ah yes... by Charcharodon · · Score: 1
    Gattaca is not a bad thing. If ever there were something in health care the gov't should be providing for free it is this. If everyone is born healthy, with a high resistance to disease, stable body chemistry, and a tendency towards a long active life this would not be a bad thing.

    You are right though, genes only create the starting point and set the absolute limits, environment and life experience paint the rest of the picture.

  35. Yay! This means... by RyuuzakiTetsuya · · Score: 1

    The L'Enfants Terrible Project can get underway.

    Just... 30 years too late.

    --
    Non impediti ratione cogitationus.
  36. That's not a simple question by SloppyElvis · · Score: 2, Insightful

    It may seem logical to respond that evolution yields varied results, or throw up hypotheses about the physics involved or whatever the hell you want. But these do not explain cause, and cannot answer why chromosomal size is varied.

    So, if you really want to know, the answer is...

    because.

    1. Re:That's not a simple question by mike77 · · Score: 1

      Perhaps a reason might be: A Simple lifeform might have 1 chromosome. As it develops that chromosome get's bigger. Along the line another one pops up due to mutation. And after that they just keep cropping up. in geek speak: My first code was 1 program, which got really big. Then I discovered libraries. So, I just added to a library when necessary, and created new ones when it was more efficient. Seems simple idea to me... perhaps I'm way off base tho as my knowledge of Biology stopped 10 years ago. A thought wuld be to compare chromosomes of other lifeforms and look for a similar pattern.

      --

      --Keeping the flame wars alive, one post at a time

  37. Re:God by hackwrench · · Score: 1

    He did, however he injected the data for this planet into chaos, so it all got corrupted. Adam didn't fall by eating the fruit of the knowledge of good and evil, it was just a data integrity check. When God creates, that which is created falls from him.

  38. Great But... by bill_mcgonigle · · Score: 1

    This is obviously great and all, but didn't they announce the Human Genome Project was complete 3 years ago?

    --
    My God, it's Full of Source!
    OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
    1. Re:Great But... by Prof.Phreak · · Score: 1

      Indeed. And it will be complete once again in a few years.

      Once you get beyond a certain point of "complete", there is no real boundary from where you can claim to be more complete than before.

      --

      "If anything can go wrong, it will." - Murphy

    2. Re:Great But... by lbbros · · Score: 3, Informative

      Completing the sequence and actually putting it together are two entirely different affairs. Small sequences called ESTs (Expressed Sequence Tags) were obtained during this effort. The big task after that was to put everything together AND in order. Think of it as a massive puzzle. Even the genome has different "builds" depending on the level of completeness of this work.

      --
      A CC-licensed illustrated horror novel
    3. Re:Great But... by absinthminded64 · · Score: 1

      ok, So, someone has compiled the thing.. Where can I find the torrent?

      Seriously though, where can the complete thing be obtained from? I want to tile my pool with the DVDs and call it Jeremy.

  39. Re:I thought... by WickedScorp · · Score: 1

    No, I wouldn't say that. We're talking about the vast VAST majority of the 3 billion some odd base pairs of sequence being completed. Sure, there were some gaps. But they are gaps on the order of "We only have 65% of the genome done". I would call it fair to say that the announcement was right. Since then it's all been refinement. Even now there are some regions that we just can't sequence. Repetitive regions for instance. There are some regions just made up of a ton of repetitive sequence that you can't put together into coherent sequences. But with those regions aside, it's pretty useful to have almost all of the bases out of the whole genome. The gaps typically aren't in areas where you would expect genes or control elements. In summary: No, I wouldn't say it's premature and we've got most of the important stuff.

  40. Re:Have they found the gene by barefootgenius · · Score: 1

    It was a joke, and a valid question. In terms of boxing, I have heard some pacific peoples should make better boxers because of their skull design. Look at some sports and see the mix of ethnicity. Is it due to economics, culture? Are you going to refuse to look at possible genetic differences because you feel that is racist? It is mainly just a difference of melatonin after all. Or do we say that because we haven't bothered to look. I would rather know the truth that dismiss something because of a political climate.

    --
    /. bug #926803 - Why I can post.
  41. Re:Ah yes... by WickedScorp · · Score: 3, Informative

    The basic idea is this. Our cells need a program that tells them what to do. That's the genome. There are a total of 46 chromosomes consisting of two sets of 23 independent chromosomes (1 - 22 and X or Y). DNA makes up the chromsomes. It's just a chemical structure that stores information; the four chemicals that make up DNA are Adenine (A), Thymidine (T), Cytosine (C) and Guanine (G). Every DNA molecule is actually two pieces of DNA that pair together as A binding to T and C binding to G. Sequencing is a chemical reaction that will tell you what the sequences of these four nitrogenous bases are. For example you may end up getting a read of AGTATTACGTATGCATAGGTCCGATG from a sequencing reaction (usu you'll get about 500 - 700 bases in one reaction). This tells you the sequence of ONE of the TWO strands of the DNA molecule. BUT since they pair in a predictable way, you know the sequence of the opposite strand (A-T and C-G). Our genomes are composed of approximately 3.2 billion total As, Cs, Ts and Gs. The goal of the genome project was just to tell us what the sequence of those bases are. That's it. Finding genes and things of that nature are really things that come about from having the primary sequence to reference. If you want to find a mutation you have to know what the sequence is SUPPOSED to be and WHERE IT IS before you can say it is different. That's your quick answer: the genome project sought to determine (1) what the sequence of bases in human chromosomes where and (2) the physical position of these sequences within the chromosomes. They did some other interesting things to prepare for it along the way, but that is a separate matter.

  42. Daniel Dennett (philosopher) once wrote by unspammable · · Score: 1

    "...the computer language Lisp [is] to Artificial Intelligence roughly what the DNA code is to genetics."

    from "Consciousness Explained", p. 384

  43. don't confuse by tacokill · · Score: 1

    Don't confuse randomness with not knowing how it works. Perhaps it just LOOKS random because we don't see or understand the pattern/function yet?

    It seems to me that there are definitely some "rules" for evolution, although our understanding of them and how they work is very very limited -- for now. I mean, we don't see trees evolving into dogs and vice versa. So clearly there are some constraints on what can and can not be done within evolution.

    But it's a hard thing to study because we've only been here (and been smart enough) for a very short period of time, evolution-wise.

    1. Re:don't confuse by It'sYerMam · · Score: 1

      Evolution is inherently random, unless you're defining random as non-deterministic. Which nucleotide is botched in the replication process, or thumped by a cosmic ray is pretty random.

      --
      im in ur .sig, writin ur memes.
    2. Re:don't confuse by MrFlibbs · · Score: 1

      Not quite. You're confusing mutations with selection. The mutations are random, but the selection process is not. Since only the beneficial mutations are "selected" by improving the survival probability of the mutated offspring, the end product of the mutations is most definitely not random.

      To summarize, mutations are random; evolution is not.

    3. Re:don't confuse by It'sYerMam · · Score: 1

      Selection only dictates whether a feature is selected, not what the feature is. So it is quite random what animal you end up with - starting with the same genetic data, in the same environment, if each gene pool is subjected to different mutations, then the organism will be different because the features evolved will be different.

      --
      im in ur .sig, writin ur memes.
    4. Re:don't confuse by Dr.+GeneMachine · · Score: 1

      The organism may end up genetically very different, but most likely morphologically very similar in your scenario. While the mutations are random, the selection pressure from the environment is the same here and will most likely result in very similar structures - compare the bodyshape of dolphins and tuna - completely different evolutionary path, highly similar morphology due to the same environmental selection pressure.

      --
      This comment does not exist.
    5. Re:don't confuse by SnowZero · · Score: 1

      The mutations are random, but the selection process is not. Since only the beneficial mutations are "selected" by improving the survival probability of the mutated offspring, the end product of the mutations is most definitely not random.

      I see, so probability isn't random?

      To summarize, mutations are random; evolution is not.

      A highly biased random distribution, is still a random distribution. It's just not uniformly random. A coin that lands on heads 999 times out of 1000 flips is still random.

      Evolution is essentially a stochastic search, since the most fit individual doesn't always survive. The vast majority of mutations are likely to have only a very small effect on the survival probability, making it quite random indeed. If you play roulette, probability says you will eventually lose. However if play a limited number of games, many outcomes are possible, they just aren't all equally likely.

    6. Re:don't confuse by MrFlibbs · · Score: 1

      You make a good point. Perhaps the distinction between "random" and "uniformly random" is the key.

      However, there is still a grey area here as illustrated by the following example. Suppose you randomly pick 10 cards from a standard deck of 52. I then example your picks and choose which card to keep. Is my choice random? By your definition it is, since the set presented to me was randomly created. However, from my point of view, my pick is entirely deterministic.

      Evolution sort of works this way. The set of mutations is randomly determined, but the selection process is not random. If you take the two processes together, I suppose you end up with a stochastic aggregate, since the final outcome cannot be accurately predicted.

      I agree that calling Evolution "stochastic" is more precise.

  44. Re:Genes make proteins. by WickedScorp · · Score: 2, Insightful

    Many genes make proteins, but not all. Genes are expressed into RNA. Ribosomal RNA genes don't make protein; instead they make RNA contribution to the ribosome.

  45. Re:20/10 is better than perfect!!! by The_Wilschon · · Score: 1

    So... what can a normal person see at 20ft?

    --
    SIGSEGV caught, terminating

    wait... not that kind of sig.
  46. Re:Have they found the gene by crazygamer · · Score: 1
    In terms of boxing, I have heard some pacific peoples should make better boxers because of their skull design.
    Not better boxers... more resistant punching bags. Having a more indestructible skull just means you might last longer, not box better.
  47. Slow by Joebert · · Score: 2, Funny

    At that rate, it must be a group made entirely of male scientists.

    All I have to do is open my mouth once & any female can sequence my genes instantly.
    Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".

    --
    Wanna fight ? Bend over, stick your head up your ass, and fight for air.
  48. Re:20/10 is better than perfect!!! by VE3MTM · · Score: 1

    s/average/normal/

    It's a definition. They just picked a reference point; in this case, the average visual acuity at 20ft.

    --
    09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0 Whoops, silly middle mouse button...
  49. Pi by 1235813 · · Score: 1

    OMFG...... pi = 3.14159265 so i recon there are .59265... Genomes that havent been discovered (i know fk all about this topic) however posibly genomes that change state inorder to fulfull diferent tasks. but you cant help but see the resembalance

  50. I'd Like A Blonde With That by umbrellasd · · Score: 1
    So, what if it was a choice between good vision and very high intelligence? How about between good vision or very low risk of cancer/heart disease?
    Because we can inexpensively correct vision, I'd say if this coupling existed, we would already be naturally selecting toward bad vision. More people will die from cancer/heart disease than from glasses. Pretty sure about that. Since we haven't turned into mole people, I think the two are probably pretty independent though.

    But I am still wondering about the intelligence/blonde connection, :-). I guess by my own reasoning, if there were such a coupling, there'd be no blondes. By contradiction of natural selection, intelligence and blonde are not connected. Q.E.D!

    Phew.

    Oh, damn. I have fallen victim to the dyed hair fallacy.

    1. Re:I'd Like A Blonde With That by bytemap · · Score: 1

      > More people will die from cancer/heart disease than from glasses.

      Sure, recently. Couple of thousand years ago, it was probably much more likely you would die from poor vision before you could breed than from heart disease.

  51. Re:Ah yes... by fyngyrz · · Score: 2, Informative
    I have questions also, if you'll indulge me:

    When we say that "the gene for xxxx is located at yyyy

    This means that we *do* know where the particular controlling sequence is located?

    Viral gene therapy is a process that can locate the target gene somehow and replace the sequence there with a new sequence?

    Does the sequence have to be broken, segmented, and re-built for viral gene therapy? Or is there a "merge" type of operation that "overlays" the new information?

    I have read a great deal that in a hand-waving manner, describes viral gene therapy as the next great thing either directly, or by implication. Is that so? Anything else like that, in terms of technology, that is currently looking promising?

    --
    I've fallen off your lawn, and I can't get up.
  52. also inversions by inigopete · · Score: 1

    inversions would form "the cat the and dog" or, more accurately ('scuse the pun) "the cat dna the dog".

  53. Re:Have they found the gene by LordLucless · · Score: 1

    All other factors being equal, having a more resilient skull will make you a better boxer.

    It's pretty freaking obvious that there are genetic differences between races. That means there is quite a distinct possiblity that the expression of these differences is going to create affinities for certain activities within various races. Saying "some races are better than others at certain things" isn't racism - it's saying what anyone whose watched the Olympics can tell you. Of course, that doesn't necessarily imply that these affinities are genetic; they could just as easily be cultural (for example, Australia tends to do well in swim events, despite being from similar genetic stock to Britain and the US).

    Then again, the Olympics is comparing highly trained athletes against each other - this tends to eliminate other factors, and make unmodifiable factors (like genetics) more pronounced. However, when you take it back to the general population, factors like education, health, environment and culture are likely to make a larger impact on individual ability than racial genetic tendancies.

    --
    Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
  54. Re:Have they found the gene by LordLucless · · Score: 2, Insightful

    Blacks were bred to have more physical ability by slave owners, much like dog breeds were bred to encourage certain traits. There is no gene for it and these qualities will in fact recede over time.

    You do realize that breeding like to like is genetic manipulation? That what you are essentially doing is reinforcing genes that express the desirous trait and eliminating genes that don't? Physical ability may have been bred in to certain people, as you suggest, and it may recede over time, but it's still a genetic trait.

    --
    Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
  55. Re:Have they found the gene by AnalystX · · Score: 1

    Skull design was obviously just one example, but I can't help but ask, isn't the boxer that lasts longer generally the winner? If one wins at boxing more than everyone else, that most certainly qualifies him as a better boxer. I think you may have confused excelling at a sport with excelling at one aspect of it (punching).

  56. 3,141 genes? by SashaM · · Score: 2, Interesting

    Did anyone else find the number 3,141 interesting? Is that a coincidence, or is there a good reason?

    1. Re:3,141 genes? by ltbarcly · · Score: 2, Funny

      Yea, especially since you have exactly 3,141.59... genes.

      And the distance from the base of the Great Pyramid is exactly twice the distance times 3/23 - the number of pounds in a dozen African Eliphants minus the sum of them... ... you get 666! Therefore, your genes are the antichrist. We should change public policy to better fit with this.

    2. Re:3,141 genes? by Ginnungagap42 · · Score: 2, Informative

      Personally, I'd have found it more interesting if there had been 1618 genes, with phi turning up all over the place in nature and all...

    3. Re:3,141 genes? by khallow · · Score: 1

      No. That sort of coincidence happens all the time.

    4. Re:3,141 genes? by Stellian · · Score: 2, Interesting
      No. That sort of coincidence happens all the time.

      If you express your mathematical results with 4 digits, there is a 1 in 9000 chance to get 3141. If you take, say, 9 "magic" numbers like e, phi, pi, 1, sqrt(2), etc. there is still only a 1 in 1000 chance to get a match.
      So it should not happen all the time, and if it does, there is something fishy about it. :)
    5. Re:3,141 genes? by Bryan+Ischo · · Score: 1

      Hm let's see ...

      The number of digits in our hands or feet multiplied by 100 then multiplied by the ratio of the circumference to the diamater of a circle equals the number of genes in our bodies.

      Sounds like a coincidence to me. How about another:

      The total number of eyes you have multiplied by the total number of thumbs you have equals the total number of limbs you have.

      Spooky ...

    6. Re:3,141 genes? by khallow · · Score: 1

      Well, it doesn't happen "all the time" so there's nothing fishy about it. Also, 3141/1000 is actually a poor approximation for pi. For example, 335/113 = 3.141592920353983... is a much better approximation than anything with denominator up to 33,215 (104348/33215 = 3.141592653921421...).

  57. Depressing thought about cost by Anonymous Coward · · Score: 1, Interesting

    The human genome project is one of the most monumental projects undertaken and accomplished by mankind in terms of technology, knowledge gained, collaboration, and potential for improving the human condition. It actually allows us to see the genetic blueprint for what makes us, us. Going to the moon is in the same category but precious few other things are in the same league. It was done under budget and ahead of schedule- it cost $2.7 billion (1991 dollars) which adjusted to 2006 would be $4B and was finished 2 years ahead of schedule. The people involved in the effort should be proud of their accomplishment.

    As a depressing comparison, consider the $281 billion and counting spent in Iraq so far http://nationalpriorities.org/index.php?option=com _wrapper&Itemid=182. It could have gone toward 68 other projects like the human genome project.

  58. Re:20/10 is better than perfect!!! by GamerGeek · · Score: 1

    OOOOHHhh that makes perfect sense. I have 20/100 vision. Thats explains why I've never been able to get close to a woman. And all this time they were in arms reach!

  59. The genome trading card game by Opportunist · · Score: 2, Insightful

    I'd give smarts for insight any day.

    Sometimes, I'd give intelligence for booze. Life'd be a lot easier and less painful.

    --
    We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
  60. The Nature paper by DerCed · · Score: 1

    I checked the Nature website for the paper, here's the free link:
    http://www.nature.com/nature/journal/v441/n7091/fu ll/nature04727.html

  61. Re:lalala by ltbarcly · · Score: 1

    Linus Torvalds says KDE is much better than Genome.

  62. ASCII art by Orlando · · Score: 1

    I'm convinced that the sequence is actually a big piece of ASCII art. Find the correct line width, print the whole thing off and stand back. I'm guessing it will spell out something like "Sorry for the inconvenience".

    --
    -= This is a self-referential sig =-
    1. Re:ASCII art by bazorg · · Score: 1

      I bet it will turn out to be a big "42"

  63. Finished my ass by pugdk · · Score: 4, Interesting

    There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug

    1. Re:Finished my ass by ill+dillettante · · Score: 2, Insightful
      Sorry I missed your post - basically said the same thing a few posts down.

      The really bad thing about all these announcements of "finishing the human genome" (apart from making the scientist involved look like idiots) is that it is stopping people from outside the field thinking about new ways of really finishing the genome as they think the problem has already been solved. This is a really hard problem and we need all the help we can get.

    2. Re:Finished my ass by theflattman · · Score: 1

      Yes the simple sequence control structures (centromeres and telomeres) are unresolved. There are also some large scale duplications > 1MB that are unresolved. This is as good as it gets with all current technology until we can magically peer at DNA and see the base pairs. However, saying "they are even lacking in the Celera version of the genome" is unintentionally funny cause of course they aren't in the Celera version, the Celera version leaves out all of the hard parts and many of the easy parts already, why would you expect the hardest parts to be resolved in the Celera (unfinished) version? If you NEED to use sequence in areas which has not been assembled or has not been sequenced then perhaps you might consider doing the work yourself for those areas as the funding and interest exist to work on them, instead of relying on someone else to generate the data for you. The HGP was meant to accelerate disease research and it has done so and will continue to do so for most diseases. Do you rememeber when you needed to spend 5 years mapping a trait loci, another 3 years sequencing (poorly) the local region, another 3 years mapping a finer interval, and then being able to construct a linkage SNP study on a population to attempt to identify the disease mutation? Before the sequence was available identifing and cloning a simple Mendalian disease trait was someone's and many grad students life work! You think you could always look up a candidate interval and identify all of the genes in that interval so you could postulate about the disease mechanism? No, 10 years ago you would sitting there with a disease phenotype and no other information, heck, before the HGP you didn't even have a decent human linkage map- these were built as part of the HGP. Before those ~15 years ago, you couldn't even map a disease interval. Anyway I'm all for finished and complete sequence as I push this viewpoint for a living, but there are limits for a reason. So congrats to Sanger and UWASH for finally publishing Chrom1, we've been waiting for a while :)

    3. Re:Finished my ass by ill+dillettante · · Score: 1

      Why - because we end up missing some sections of non repetitive DNA in the process as a side effect of not being able to sequence through these regions. In the last announcement of the human genome being finish these regions were estimated to be around 1% of the genome. Also many of the regions that are sequenced and contain a lot of repeats are not well assembled - just because a region is "finished" doesn't mean that it is assembled correctly.

    4. Re:Finished my ass by chawly · · Score: 1

      Sorry, but I get the feeling that I'm not really understanding all this too well - I do have a question, however

      Why should I care if your ass is finished or not ?

      However, out of kindness, I'll mention that I own a pair of football boots. One of those, applied vigorously to the said ass ..... may well finish your problem. They are size 43. I'm willing to lend them to a muscular neighbour of yours if you want to try.

      --
      How many beans make five, anyhow ? ... Charles Walmsley
  64. The One by Doc+Ruby · · Score: 1

    Who is this "human" whose genome has been sequenced? Is this some kind of "Messiah on CD" spam offer?

    --

    --
    make install -not war

    1. Re:The One by neveaire · · Score: 1

      Actually, it is the DNA of four individuals that were sequenced. One of these, is purportedly Craig Venter, who led the Celera venture. For those of you who have watched GATTACA, you can imagine most people don't want it to be known whose DNA was sequenced.

      To help answer some of the other questions I've seen thus far: Remember that the human genome was sequenced in a shotgun manner. We took the DNA of these individuals, fragmented the chromosomes randomly, and sequenced the fragments. At the beginning of all this, the sequencing machines (made by Celera) could only read about 200 base pairs at a time but this got better as the years went on. Still its not great. I believe a 1kb (one thousand base pairs) is the limit for a contiguous stretch of DNA using a sequencer. All of this was done with more than 12x coverage, so we repeated the procedure multiple times to get a better assembly.

      Because the genome was randomly fragmented, we look for overlaps between ends of fragments to assemble "contigs" which are longer stretches of DNA. So it was completely possible to sequence the entire genome and not have an assembly. The assembly problem is non trivial because you have millions of fragments and need to order them with high confidence. Some of the confounding characterisitics of DNA include the varying length of overlaps between fragments, regions of the genome containing high number of simple repeats (ATATATATATA), and certain types of sequences occur in multiple places (such as gene promoter regions, binding sites for various transcription factors). But of course, there are many others that I can't think of.

      Interestingly, when the sequencing was complete, it was the work of Jim Kent at UCSC that some say kept the sequence in the public domain. His work provided the first rough assembly of the genome at the same time HGSI and Celera were announcing completion of the sequencing. I'm not entirely sure about the public domain part, since I'm pretty sure you can't patent the entire genome in the US (goes against the Bill of Rights about owning another person).

      In any case, the genome sequences are subjected to a build routine every now and then and while positions might shift, the relative order of genes and elements should remain the same. If you ever look at the UCSC database tables you will find pieces that can't be mapped to a unique location and stretches of DNA that differ among the individuals (haplotypes). The problem is complicated, but I think they've made good progress.

  65. Human genome is not finished by ill+dillettante · · Score: 4, Informative
    It is actually only about 75% complete - basically the scientist involved have no idea how to finish the remaining sections (mostly simple repeats) so they have "defined" the genome complete by saying that these regions are unimportant.

    This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.

    1. Re:Human genome is not finished by chawly · · Score: 1

      I thought they already were /. editors !!

      --
      How many beans make five, anyhow ? ... Charles Walmsley
  66. Re:Have they found the gene by Anonymous Coward · · Score: 1, Insightful

    At the level of competition you are describing, the atheletes have more to overcome mentally than physically.

    Really, the issue is a lot more complex than just looking at a sport and taking anything at face value. What sort of cultural barriers are there to a certain sport? What sort of expectations are placed on atheletes of a certain color? These, and many other factors, are frequently left out when the discussion of race and athleticism. Tracing everything back to slavery is the lazy thing to do.

  67. Re:Ah yes... by WickedScorp · · Score: 2, Interesting
    Say I tell you that gene XXXX is located at YYYY. It doesn't necessarily mean that we know anything about the controlling sequences. I'll use a standard protein coding gene. We would know where all the exons are, including the upstream part of the transcript that is made into RNA but isn't translated into protein, the protein coding sequence, and the downstream region that is made into RNA but not made into protein. Also in between the exons of the gene are the introns that are made into RNA with the rest of the gene, but are cut out before the RNA is used. For many genes we have at least a fuzzy idea what *characterized* promoters are in the region. This is where it gets tricky. Enhancers and insulators, that increase and decrease the efficiency of making RNA from DNA, can be at *considerable* distance from the gene they control. They can even be within an intron of the gene AND they can function from either strand of a double stranded DNA molecule pointing in any direction (toward OR away from the sequence of interest). We don't know much about the control most of the time. Let me put it this way. There is evidence that 5% of the genome is under purifying selection i.e. very important to not tinker much with. 1.5% of that is gene coding space. What's the other 3.5%? At least a good fraction of it has to be controller sequences. But the beyond that, we don't know. They are probably going to end up being elements we've never seen and don't understand how they work. Entirely new classes of DNA control sequences.

    Viral Gene Therapy

    I don't know as much about this topic, so be forgiving. The idea with viral mediated gene therapy is that someone is missing a gene entirely or the copy they have is basically defunct. One way to fix it is to target the broken sequence and paste what you want into it. Like a word search and replace. Viruses that integrate into our genes are good at that. The problem is targeting. Most viruses that we can get to integrate do so RANDOMLY. Not a problem, you'll still be pasting a functional sequence into the DNA so they can at least make some of the protein. But what if you land it at a place far away from the uncharacterized control elements that say when to turn on and when turn off? Maybe the small amount of basal transcription will produce enough protein to correct the defect, maybe not. What if it lands in an area that is always very highly expressed? Overexpression of the gene product can be bad too. Then a third problem to look out for is what if this thing randomly integrates and hits the middle of a good gene, killing it. Then you've got a whole other problem entirely. For the sequence to go into the vector what you have to do is really going to be dependent on the sequence. If the gene is very small, maybe you want to put in exons, introns and everything else. Otherwise, if it is too big, maybe you take the introns out and put just the exons in (remember that the exons are cut out of RNA anyway and the exons are spliced together). Some are so big that even just the exons can't all go in. Dystrophin for example is mutated in Duchenne and Becker's Muscular Dystrophy. It would be great for gene therapy but it is *huge* and I mean huge compared to most genes. Maybe there you can only put part of the sequence in, so you try to guess what parts of the protein are the most functionally important. Gene therapy is something that has the potential to be very valuable. It just really hasn't had any success over a pretty big period of time that people have worked on it. One good example is Severe Combined Immune Deficiency (SCID). These are the people that have to live in a bubble because their immune system doesn't work. But if you reconstitute the mutated genes, they would be fine. There were some trials in France of Gene Therapy to fix the problem and in several people they did. Those individuals went from living in sterile conditions to basically a normal life. Then the side effects came in. Where the gene landed in a few of them basically gave some of the patients leukemia!!! So they

  68. Re:Stupid Question by mishmash · · Score: 2, Informative

    One point is that there's very little variation between individuals in terms of coding sequence - in this chromosome from the article there's only just over 1 base where there are known single base changes per gene. The most common type of variation is in the number of times repeated streaches of DNA are repeated, this generally (though not always) has no effect on an individual. The numbers of such repeats in the draft sequence are not meaningful in the published sequence.

    Databases of variation in the human genome are maintained. The paper accompanying the release of the finished sequence does discuss variation - and notes that in some areas of chromosome people have different numbers of copies of a large region which includes genes.

    Nature has made the Full text of the article announcing the completion of the chromosome one finished sequence available online. While this is good, it's still not the open publishing which ought be demanded by those spending public money on scientific endevours such as this.

  69. White Streak? by Comboman · · Score: 1
    There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

    I thought cowardly foxes had a yellow streak?

    --
    Support Right To Repair Legislation.
  70. Randomness in evolution by nephridium · · Score: 1
    In this respect one interesting illustration of this randomness (which is one of the pillars of evolution) is the horse. All our domestic breeds of horse Equus caballus be it a little pony or a huge Shire horse have 64 chromosomes. The only wild horse species left is the Przewalski's horse Equus ferus przewalskii which has 66 chromosomes, yet these species can produce fertile offspring (as opposed to hybrids of horses and Zebras, that have 44 chromosomes).

    Due to some 'random' thing happening two the chromosomes simply merged, yet when recombining to form the zygote the seperate chromosomes of the wild horse find their way to match up and combine with the domestic horses chromosomes. The resulting offspring will have 65 chromosomes.

    --


    And when you gaze long enough into the code, the code will also gaze into you.
  71. Re:Coincidence? by murderlegendre · · Score: 1

    Because if it had been 3140, that would have been the same number as the length of the US-Mexico border, in kilometers.

    That's why it's called a "coincidence"

    --
    There's a Starman, waiting in the sky / He'd like to come and meet us, but he hasn't got the time.
  72. I tried to create life with this. by Perl-Pusher · · Score: 1

    Unfortunately I'm dislexic, all I got was goo that tastes like chicken.

  73. Damn straight we aren't moles by Malakusen · · Score: 1

    Yeah, there's not a lot of people with glasses who hang around in dark enclosed spaces, avoiding the sunlight because it hurts our eyes.
     
      looks at inside of dark computer room, and closed blinds on window
     
    never mind...

    --
    Never give in--never, never, never, never, in nothing great or small, large or petty, never give in except to conviction
  74. Ahem. Over here. by Deal-a-Neil · · Score: 1

    I'll take that genome therapy shake for a larger penis now, thank you.

    1. Re:Ahem. Over here. by Deal-a-Neil · · Score: 1

      So much for checking the Anonymous Coward box. :-O

  75. Re:Ah yes... by Pozican · · Score: 1

    While I agree that everyone should have a high resistance to disease, it scares me to say that it is something we should all do. What is to happen when we all essentially patch our immune systems in the beginning, and then have some equivalent of a 0day root execution exploit come out. We could have huge issues when no one can survive little things that could happen. I guess a decent example would be when a disease mutates in order to continue to survive (since they do mutate also ) and our immune system was strong against them in the beginning but now we are all screwed. Bioterrorism? Granted, this could happen with nature's own course, and our own mutations. However, we have survived this long trusting nature's own fuck ups, let's not purposely fuck it up for profit :)

  76. AYBPABTU by AJ+Mexico · · Score: 1

    All your base pairs are belong to us!

    --
    Computers obey me.
  77. Neko! by Chayak · · Score: 1

    This is great news now they need to sequence a cat and make me a cat girl! :-3 (the no hammerspace option please)

  78. Re:Human disease by shummer_mc · · Score: 1

    I'd like to make several points.

    First, the nature vs. nurture argument is being 'spun' by biologists to placate the fears of people. Nature is a far more important element than the existing arguments would have you believe. Genetics is, without doubt, an incredibly powerful tool.

    Second, we don't need any secret weapons in the race to cure disease. People are already outliving their ability to live with any quality of life. Earth is already overpopulated, and we humans are consuming far more energy than is our rightful share.

    Third, we humans are not capable of making decisions with regards to what should or shouldn't be done with genetic information. Nor are we capable of enforcing our decisions with any sort of legal entity. We, unfortunately, have people who will break the law for personal gain.

    Finally, bio-diversity is where genome research should be focussed, as natural balance is all about diversity. I'd much rather you studied the genome of rare animals.

    However, I understand the economics of genetics (and science research in general) and realize that animal research isn't nearly as lucrative as being able to cure some wealthy (or well-insured) person of a disease at incredible mark-up. Don't be naive or suppose that we are naive when you propose your altruistic intention. It all comes back to saving the 'weak' human and indirectly making money.

    My stance on this matter may change if humanity were facing extinction. However the risk/reward ratio is far too high.

  79. Re:Ah yes... by Goaway · · Score: 1

    Welcome to Slashdot: News for luddites, stuff that scares us.

  80. Non-protein coding DNA important too! by gotgenes · · Score: 1

    It's not just about the proteins. As of the past decade we have begun to realize that the paradigm of DNA -(transcription)-> mRNA -(translation)-> Protein is not the end all, be all. We have regulartory elements on the DNA that affects the rates of transcription, mRNA modification which creates a wide variety of alternative splices, non-coding RNA that, despite not going to protein, still has important biological roles, and even non-coding DNA, previously disregarded as "Junk DNA" that life sciences researchers are beginning to hypothesize actually plays critical roles in gene regulation through methylation patterns, chromatin, etc.

    Life sciences research has orthogonality. So what if one question's a stumper? You can still make headway on others.

    --
    It's such a fine line between stupid and clever.
  81. Re:Stupid Question by ResidntGeek · · Score: 1

    I believe they combined 24 different people's genomes to eliminate point mutations and suchlike things. Nobody has the exact sequence of base pairs published.

    --
    ResidntGeek
  82. yep by BitterAndDrunk · · Score: 1

    Cobra Commander was a little bitch.
    He was MY first exposure to an overbearing micromanager who couldn't get shit done. If he'd left Destro alone a little bit more often, maybe GI Joe wouldn't have been so fucking smug.
    And maybe Destro would have signed the Cobra troops up for some shooting range time.

    --
    You better watch out, there may be dogs about . . .
  83. mandatory slashdot ritual... by glassgnost · · Score: 1

    ...but will it run on Linux?

  84. 3,141 genes..... by obdulio · · Score: 1

    Why does this number sound familiar to me?

    Really weird.

    --
    PENAROL: Seras eterno como el tiempo y floreceras en cada primavera.
  85. Odd? by obdulio · · Score: 1

    Which is more of a typical example of Science challenging our preconceptions than actual "oddity".

    What I find odd is relationship between the mathematical constant equal to a circle's circumference divided by its diameter and the total number of genes in the human genoma.

    There are 3,141 genes and pi begins with 3.141........

    Thats odd.

    --
    PENAROL: Seras eterno como el tiempo y floreceras en cada primavera.
  86. Re:Have they found the gene by smellsofbikes · · Score: 1

    As a side-note, the Bible might have the first description of genetic engineering, when Jacob selectively crossbred sheep to achieve a desired phenotype. Good thing to know, when people are on about how genetic engineering is against God's Will.

    --
    Nostalgia's not what it used to be.
  87. Not only is it not finished, we have some inverts by WillAffleckUW · · Score: 1

    and some segment overlays where there are gaps, due to the methods used in sequencing.

    One of the interesting fallouts of the the HGS is that we now realize that some people have inverted SNP and other anomolies, some of which were inherited from ancestors way back before we broke off from other simians.

    And one should always point out that the difference in any segment from one human to another is greater than the difference between say the standard human sequence to a standard chimpanzee sequence, just as the difference between one human to another human is greater than the difference between a standard male sequence and a standard female sequence.

    I think I said that right.

    Now, if we could just figure out where the misfolds happen, we'd be right as rain.

    Oh, and in case you wondered, race is just noise and meaningless at the genetic level - it's just adaptations to specific climates. Plop down an Inuvuk Native in Hawaii, along with other Inuvuks, let them live there for a few tens of thousands of years, and they'll look similar to other Hawaiian Natives.

    Plop a Northern European down in Ethiopia, take the same time, and they'll look like people in Ethiopia do, with minor variations.

    --
    -- Tigger warning: This post may contain tiggers! --
  88. This is fantastic news! by emceefisherprice · · Score: 1

    I remember when I was a child (1990 I'd have been 8) and what a big deal this was. This will open the doors to amazing things and it'll be an improved qualify of life that humans have never known before. I'm the most excited nerd I know. lol

    --
    fisher price, the illest emcee.. step to me and i will doodoo on your face. jk
  89. Now that the human genome has been mapped.... by BarneyRabble · · Score: 1

    Can we get on with the transporter technology please? I'm getting tired of driving around the country, lets make it faster, DAMMIT!!

  90. Re:Ah yes... by fyngyrz · · Score: 1

    It may be rambling to you, but it is eye opening to others, or, at least to me. I suspect there are more people quietly reading and appreciating the information. This is really a very exotic technical area for most, there just isn't any obvious analog of the process in common experience. Thanks for expounding for the benefit of others.

    --
    I've fallen off your lawn, and I can't get up.
  91. They finished sequencing the genome... again... by thisisauniqueid · · Score: 1

    The best kind of news is the kind that you can announce over and over again, and it makes the front page every time. Any guesses how long it will take until they announce they just finished sequencing the human genome *again*?

    1. Re:They finished sequencing the genome... again... by chawly · · Score: 1

      This coming Monday would be my guess. Any betting going on ?

      --
      How many beans make five, anyhow ? ... Charles Walmsley
  92. I didn't want to but.. by inKubus · · Score: 1

    I guess now all your base really do belong to us.

    --
    Cool! Amazing Toys.
  93. Re:20/10 is better than perfect!!! by VE3MTM · · Score: 1

    It doesn't.

    Case closed.

    --
    09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0 Whoops, silly middle mouse button...
  94. Words and music: Credits by hicksw · · Score: 1

    I have this from some apparently-now-vanished web page:

    The question of the merits of different programming languages has often been called a "religious argument", except maybe by those who assume that theres obviously One Right True and Only Way and it begins with C. This track is on the Roundworm CD, available for $15 from Prometheus Music, http://www.prometheus-music.com/
    CD: Roundworm Label: Prometheus Music
    Credits: Julia Ecklar: lead vocals & guitar. Kristoph Klover: 6-string guitar

    Story Behind the Song
    The question of the merits of different programming languages has often been called a ``religious argument,'' except maybe by those who assume that of course there's One Right True and Only Way and it begins with a C.

    Lyrics
    The Eternal Flame
    This parody was sung by Julia Ecklar on Roundworm
    Parody of ``God Lives on Terra'',
    words and music by Julia Ecklar
    For more information and other parodies, see www.songworm.com
    Parody lyrics copyright 7/29/96 by Bob Kanefsky.

  95. nice flame! you jumped to the wrong conclusion by shummer_mc · · Score: 1

    It seems that my POV on this issue is controversial amongst my friends, too. I'll try to be brief.

    We can't regulate it. I know that. So do you, I'd wager. We can't stop the application of this technology either. The genie is out of the bottle. I lament the fact that corporations (where profit is the sole motivator) are so powerful, and so devoid of ethics.

    I'm not scared of learning. I embrace it. However, applying this technology has ramifications. Mainly, keeping people alive (though that's not the only one). We do that too well, now. My stance is that we should let a few people die.

    There are valid ethical, logical and economic reasons that human genetics shouldn't be researched (in today's circumstances-- there are circumstances in which the research would be imperative).

    Do not flame me and call me a luddite. I am not scared of the future. I think it's a mistake and would not pay for it, personally, if I had a choice. There are better uses of the talents and resources devoting themselves to that research, imho.

  96. so what's the error rate? by HelloKitty · · Score: 1

    as with all data recording tasks, there's got to be an error rate.
    to what percentage do they know they've "got it" all?
    and to what percentage do they know it represents us all? (did they sequence one human or many?)