Slashdot Mirror
Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
liqbase
Can we start the patent countdown clock?
The simple truth is that interstellar distances will not fit into the human imagination
- Douglas Adams
Now where's my +1 Talent in every base?
if God wouldn't have used LISP to encode the darn sequence in the first place
I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!
Alpha Centauri reference = complete win!
Why do one chromosone have more genes than others?
Any links to a site like "sacred-texts.com" gets a near automatic (-1, Religious) moderation. This can be overcome, but only if someone with mod points actually bothers to *read* the item in question.
Naturally, this is quite rare. I mean, I didn't even look at anything but the name of the website you linked to, and I certainly don't have any mod points.
That movie has a lot to answer for. Unfortunately the level of public education in these matters hasn't gone up much since then. Which is a shame, because soon the technology will exist that allows us to cheaply sequence anyone or anything's DNA. The potential health benefits of such technology are extraordinary. Imagine going to the doctor with a cough. The doctor takes a sample of your phlegm and ten seconds later has a full genetic sequence of the virus that has infected you. Matching it against a medical database removes the guess work from treatment. And that's just the tip of the iceberg.
How we know is more important than what we know.
"To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
-- Academician Prokhor Zakharov,
"Address to the Faculty"
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
Scientists: All your base pair are belong to us!
Your single nucleotide polymorphisms are unique! Just like everyone else's.
ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
The grass is always greener on the other side of the light cone.
I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practical medical impact in daily life. Screen cancer samples for chromosomal abnormalities and mutations has led to the development of rational therapy for specific cancer types. Where everything is leading is rational therapy overall. Individualized medicine and preventative medicine are the goals. I do agree with you that there are dangers associated with such knowledge. The question is whether we can use it to benefit the everyday man or woman to improve the quality of life for everyone.
From the fine article:
"The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
There are other variations which make us unique.
Alternate alleles*
Indels (insertions/deletions)
Variable numbers of repeats.*
The genetic code uses 4 letters, but I'll use English for explaination.
A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
"The cat and the dog" vs "the cat and the big dog".
In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".
Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
So we can start compiling from source code now! We better get this covered under the GPL quickly.
Blacks were bred to have more physical ability by slave owners, much like dog breeds were bred to encourage certain traits. There is no gene for it and these qualities will in fact recede over time.
Why do one chromosone have more genes than others
Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!
The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
pi * 1000 genes. Got to love those fun coincidences.
Wake me when they make Cobra Commander.
Joey stole mine when I was 12. He rocked.
This is good news but not too useful until we can model protein shaping.
The AGCT's code for proteins and so far we can only model very short combinations. All you coders keen for a life project have a crack at it. Theres 20 amino acids formed from combinations of three base pairs. The amino acids have attraction and repulsion properties with each other and their environment and form to make a unique shape. Its the analysis of that 3D shape that will solve:
- all cancer - modelling protein shapes means instant cancer cures
- bird flu - again modelling proteins means instant antibodies to diseases
- the most toxic substance ever invented - it will also open up designer drugs
gtcatgcgatacgtaggcaaatcg2tgacggcagt
hmmm i guess its not as funny unless its binary
Just to add on to this
20/20 vision means that when you stand away from something at 20ft, what you see is what the normal person would see at 20ft.
20/40 is, well, if you stand 20ft away, you see what a normal person would see at 40ft
Same goes for 20/10.
Both right and wrong. In 2003 both the public effort and the effort at Celera released a "Finished" sequence that was basically 99% complete. It was as much of the genome as could be easily cloned and sequenced. But there have been gaps in the sequence. Since the release of the finished sequence the remaining gaps have slowly been resolved. I suppose by "finishing" chr 1 they are saying that all of the DNA that can be cloned and sequenced with current technology has been done.
Just who I was looking for!
I've been hearing about genome sequencing for years now, and looked it up on Wikipedia and Google, but for the life of me I can't find out what it actually is, or what it tells you. I know it doesn't tell you what each gene does, although the first time I heard about it, before I thought about it I thought that might be it. Obviously, for any given species the majority of genes are going to be the same. Is sequencing finding out which ones have to be the same? I don't think it could be that, even with a large enough sample size you can never be sure that just because every one you've tested has the same value, every one has to have the same value. And if it can't tell what one value can go in a particular place, it can't tell you what possible values can go in a particular place.... So, doc, what's it all about? Is it good, or is it whack?
<xml><I><am><so><damn>Web 2.0</damn></so></am></I></xml>
or, perhaps the universe is one big transcendentally derived object.
How do they differentiate junk dna from genes?
I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?
What makes a gene a gene?
Are you telling me "Mission accomplished" in 2003 was a little ahead of itself?
It's probably just me, but for some reason it seems like I've read about this happening already like three times. Maybe those were just updates on the progress but I swear I thought this was already completed. Maybe I'm just dupe weathered ;)
I will forever be a student.
Half answer:
The beginning is very likely a non-coding region, since stuff near the ends can get damaged more readily. The chromosome itself probably does not exactly start with GAT, it probably has a few thousand bases worth of telomere, and this just happens the be the chunk that starts once they get past all that.
Everybody has different genes, but the difference between two indviduals over the total range is measured in decimal-points of a percent. Big chunks of it are exactly the same from person to person.
Weaselmancer
rediculous.
A dozen actual people please. It doesn't count if your just mixing chromosones from different people to claim you have a complete DNA decoded; there is no gaurantee that mix of dna would be viable. There ought to be a panel of scientists to select 12 people to have their DNA read that are willing to be studied for the rest of their lives. Six men and six women. At least some of which would be siblings. Only then can you actually decode DNA. You'll get 90% of the answers there.
You always go with a base line. Then you read other people and compare and contrast them. Then add in other species. And voila, the genetic black box of subroutines that evolution found most useful that are 99.99999% of the answer. After that your left with mutations and figuring out what, and how, the code sequences do what they do and finally programming new sequences to test theory.
In other words 30 years from now it will finally get interesting.
Comment removed based on user account deletion
You are right though, genes only create the starting point and set the absolute limits, environment and life experience paint the rest of the picture.
The L'Enfants Terrible Project can get underway.
Just... 30 years too late.
Non impediti ratione cogitationus.
It may seem logical to respond that evolution yields varied results, or throw up hypotheses about the physics involved or whatever the hell you want. But these do not explain cause, and cannot answer why chromosomal size is varied.
So, if you really want to know, the answer is...
because.
He did, however he injected the data for this planet into chaos, so it all got corrupted. Adam didn't fall by eating the fruit of the knowledge of good and evil, it was just a data integrity check. When God creates, that which is created falls from him.
This is obviously great and all, but didn't they announce the Human Genome Project was complete 3 years ago?
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
No, I wouldn't say that. We're talking about the vast VAST majority of the 3 billion some odd base pairs of sequence being completed. Sure, there were some gaps. But they are gaps on the order of "We only have 65% of the genome done". I would call it fair to say that the announcement was right. Since then it's all been refinement. Even now there are some regions that we just can't sequence. Repetitive regions for instance. There are some regions just made up of a ton of repetitive sequence that you can't put together into coherent sequences. But with those regions aside, it's pretty useful to have almost all of the bases out of the whole genome. The gaps typically aren't in areas where you would expect genes or control elements. In summary: No, I wouldn't say it's premature and we've got most of the important stuff.
It was a joke, and a valid question. In terms of boxing, I have heard some pacific peoples should make better boxers because of their skull design. Look at some sports and see the mix of ethnicity. Is it due to economics, culture? Are you going to refuse to look at possible genetic differences because you feel that is racist? It is mainly just a difference of melatonin after all. Or do we say that because we haven't bothered to look. I would rather know the truth that dismiss something because of a political climate.
/. bug #926803 - Why I can post.
The basic idea is this. Our cells need a program that tells them what to do. That's the genome. There are a total of 46 chromosomes consisting of two sets of 23 independent chromosomes (1 - 22 and X or Y). DNA makes up the chromsomes. It's just a chemical structure that stores information; the four chemicals that make up DNA are Adenine (A), Thymidine (T), Cytosine (C) and Guanine (G). Every DNA molecule is actually two pieces of DNA that pair together as A binding to T and C binding to G. Sequencing is a chemical reaction that will tell you what the sequences of these four nitrogenous bases are. For example you may end up getting a read of AGTATTACGTATGCATAGGTCCGATG from a sequencing reaction (usu you'll get about 500 - 700 bases in one reaction). This tells you the sequence of ONE of the TWO strands of the DNA molecule. BUT since they pair in a predictable way, you know the sequence of the opposite strand (A-T and C-G). Our genomes are composed of approximately 3.2 billion total As, Cs, Ts and Gs. The goal of the genome project was just to tell us what the sequence of those bases are. That's it. Finding genes and things of that nature are really things that come about from having the primary sequence to reference. If you want to find a mutation you have to know what the sequence is SUPPOSED to be and WHERE IT IS before you can say it is different. That's your quick answer: the genome project sought to determine (1) what the sequence of bases in human chromosomes where and (2) the physical position of these sequences within the chromosomes. They did some other interesting things to prepare for it along the way, but that is a separate matter.
"...the computer language Lisp [is] to Artificial Intelligence roughly what the DNA code is to genetics."
from "Consciousness Explained", p. 384
Don't confuse randomness with not knowing how it works. Perhaps it just LOOKS random because we don't see or understand the pattern/function yet?
It seems to me that there are definitely some "rules" for evolution, although our understanding of them and how they work is very very limited -- for now. I mean, we don't see trees evolving into dogs and vice versa. So clearly there are some constraints on what can and can not be done within evolution.
But it's a hard thing to study because we've only been here (and been smart enough) for a very short period of time, evolution-wise.
Many genes make proteins, but not all. Genes are expressed into RNA. Ribosomal RNA genes don't make protein; instead they make RNA contribution to the ribosome.
So... what can a normal person see at 20ft?
SIGSEGV caught, terminating
wait... not that kind of sig.
At that rate, it must be a group made entirely of male scientists.
All I have to do is open my mouth once & any female can sequence my genes instantly.
Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".
Wanna fight ? Bend over, stick your head up your ass, and fight for air.
s/average/normal/
It's a definition. They just picked a reference point; in this case, the average visual acuity at 20ft.
09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0 Whoops, silly middle mouse button...
OMFG...... pi = 3.14159265 so i recon there are .59265... Genomes that havent been discovered (i know fk all about this topic) however posibly genomes that change state inorder to fulfull diferent tasks.
but you cant help but see the resembalance
But I am still wondering about the intelligence/blonde connection, :-). I guess by my own reasoning, if there were such a coupling, there'd be no blondes. By contradiction of natural selection, intelligence and blonde are not connected. Q.E.D!
Phew.
Oh, damn. I have fallen victim to the dyed hair fallacy.
When we say that "the gene for xxxx is located at yyyy
This means that we *do* know where the particular controlling sequence is located?
Viral gene therapy is a process that can locate the target gene somehow and replace the sequence there with a new sequence?
Does the sequence have to be broken, segmented, and re-built for viral gene therapy? Or is there a "merge" type of operation that "overlays" the new information?
I have read a great deal that in a hand-waving manner, describes viral gene therapy as the next great thing either directly, or by implication. Is that so? Anything else like that, in terms of technology, that is currently looking promising?
I've fallen off your lawn, and I can't get up.
inversions would form "the cat the and dog" or, more accurately ('scuse the pun) "the cat dna the dog".
All other factors being equal, having a more resilient skull will make you a better boxer.
It's pretty freaking obvious that there are genetic differences between races. That means there is quite a distinct possiblity that the expression of these differences is going to create affinities for certain activities within various races. Saying "some races are better than others at certain things" isn't racism - it's saying what anyone whose watched the Olympics can tell you. Of course, that doesn't necessarily imply that these affinities are genetic; they could just as easily be cultural (for example, Australia tends to do well in swim events, despite being from similar genetic stock to Britain and the US).
Then again, the Olympics is comparing highly trained athletes against each other - this tends to eliminate other factors, and make unmodifiable factors (like genetics) more pronounced. However, when you take it back to the general population, factors like education, health, environment and culture are likely to make a larger impact on individual ability than racial genetic tendancies.
Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
Blacks were bred to have more physical ability by slave owners, much like dog breeds were bred to encourage certain traits. There is no gene for it and these qualities will in fact recede over time.
You do realize that breeding like to like is genetic manipulation? That what you are essentially doing is reinforcing genes that express the desirous trait and eliminating genes that don't? Physical ability may have been bred in to certain people, as you suggest, and it may recede over time, but it's still a genetic trait.
Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
Skull design was obviously just one example, but I can't help but ask, isn't the boxer that lasts longer generally the winner? If one wins at boxing more than everyone else, that most certainly qualifies him as a better boxer. I think you may have confused excelling at a sport with excelling at one aspect of it (punching).
Did anyone else find the number 3,141 interesting? Is that a coincidence, or is there a good reason?
The human genome project is one of the most monumental projects undertaken and accomplished by mankind in terms of technology, knowledge gained, collaboration, and potential for improving the human condition. It actually allows us to see the genetic blueprint for what makes us, us. Going to the moon is in the same category but precious few other things are in the same league. It was done under budget and ahead of schedule- it cost $2.7 billion (1991 dollars) which adjusted to 2006 would be $4B and was finished 2 years ahead of schedule. The people involved in the effort should be proud of their accomplishment.
m _wrapper&Itemid=182. It could have gone toward 68 other projects like the human genome project.
As a depressing comparison, consider the $281 billion and counting spent in Iraq so far http://nationalpriorities.org/index.php?option=co
OOOOHHhh that makes perfect sense. I have 20/100 vision. Thats explains why I've never been able to get close to a woman. And all this time they were in arms reach!
I'd give smarts for insight any day.
Sometimes, I'd give intelligence for booze. Life'd be a lot easier and less painful.
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
I checked the Nature website for the paper, here's the free link:u ll/nature04727.html
http://www.nature.com/nature/journal/v441/n7091/f
Linus Torvalds says KDE is much better than Genome.
I'm convinced that the sequence is actually a big piece of ASCII art. Find the correct line width, print the whole thing off and stand back. I'm guessing it will spell out something like "Sorry for the inconvenience".
-= This is a self-referential sig =-
There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug
Who is this "human" whose genome has been sequenced? Is this some kind of "Messiah on CD" spam offer?
--
make install -not war
This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.
Automated DNA sequencing software
At the level of competition you are describing, the atheletes have more to overcome mentally than physically.
Really, the issue is a lot more complex than just looking at a sport and taking anything at face value. What sort of cultural barriers are there to a certain sport? What sort of expectations are placed on atheletes of a certain color? These, and many other factors, are frequently left out when the discussion of race and athleticism. Tracing everything back to slavery is the lazy thing to do.
Viral Gene Therapy
I don't know as much about this topic, so be forgiving. The idea with viral mediated gene therapy is that someone is missing a gene entirely or the copy they have is basically defunct. One way to fix it is to target the broken sequence and paste what you want into it. Like a word search and replace. Viruses that integrate into our genes are good at that. The problem is targeting. Most viruses that we can get to integrate do so RANDOMLY. Not a problem, you'll still be pasting a functional sequence into the DNA so they can at least make some of the protein. But what if you land it at a place far away from the uncharacterized control elements that say when to turn on and when turn off? Maybe the small amount of basal transcription will produce enough protein to correct the defect, maybe not. What if it lands in an area that is always very highly expressed? Overexpression of the gene product can be bad too. Then a third problem to look out for is what if this thing randomly integrates and hits the middle of a good gene, killing it. Then you've got a whole other problem entirely. For the sequence to go into the vector what you have to do is really going to be dependent on the sequence. If the gene is very small, maybe you want to put in exons, introns and everything else. Otherwise, if it is too big, maybe you take the introns out and put just the exons in (remember that the exons are cut out of RNA anyway and the exons are spliced together). Some are so big that even just the exons can't all go in. Dystrophin for example is mutated in Duchenne and Becker's Muscular Dystrophy. It would be great for gene therapy but it is *huge* and I mean huge compared to most genes. Maybe there you can only put part of the sequence in, so you try to guess what parts of the protein are the most functionally important. Gene therapy is something that has the potential to be very valuable. It just really hasn't had any success over a pretty big period of time that people have worked on it. One good example is Severe Combined Immune Deficiency (SCID). These are the people that have to live in a bubble because their immune system doesn't work. But if you reconstitute the mutated genes, they would be fine. There were some trials in France of Gene Therapy to fix the problem and in several people they did. Those individuals went from living in sterile conditions to basically a normal life. Then the side effects came in. Where the gene landed in a few of them basically gave some of the patients leukemia!!! So they
One point is that there's very little variation between individuals in terms of coding sequence - in this chromosome from the article there's only just over 1 base where there are known single base changes per gene. The most common type of variation is in the number of times repeated streaches of DNA are repeated, this generally (though not always) has no effect on an individual. The numbers of such repeats in the draft sequence are not meaningful in the published sequence.
Databases of variation in the human genome are maintained. The paper accompanying the release of the finished sequence does discuss variation - and notes that in some areas of chromosome people have different numbers of copies of a large region which includes genes.
Nature has made the Full text of the article announcing the completion of the chromosome one finished sequence available online. While this is good, it's still not the open publishing which ought be demanded by those spending public money on scientific endevours such as this.
UK Laptops
I thought cowardly foxes had a yellow streak?
Support Right To Repair Legislation.
Due to some 'random' thing happening two the chromosomes simply merged, yet when recombining to form the zygote the seperate chromosomes of the wild horse find their way to match up and combine with the domestic horses chromosomes. The resulting offspring will have 65 chromosomes.
And when you gaze long enough into the code, the code will also gaze into you.
Because if it had been 3140, that would have been the same number as the length of the US-Mexico border, in kilometers.
That's why it's called a "coincidence"
There's a Starman, waiting in the sky / He'd like to come and meet us, but he hasn't got the time.
Unfortunately I'm dislexic, all I got was goo that tastes like chicken.
Yeah, there's not a lot of people with glasses who hang around in dark enclosed spaces, avoiding the sunlight because it hurts our eyes.
looks at inside of dark computer room, and closed blinds on window
never mind...
Never give in--never, never, never, never, in nothing great or small, large or petty, never give in except to conviction
I'll take that genome therapy shake for a larger penis now, thank you.
While I agree that everyone should have a high resistance to disease, it scares me to say that it is something we should all do. What is to happen when we all essentially patch our immune systems in the beginning, and then have some equivalent of a 0day root execution exploit come out. We could have huge issues when no one can survive little things that could happen. I guess a decent example would be when a disease mutates in order to continue to survive (since they do mutate also ) and our immune system was strong against them in the beginning but now we are all screwed. Bioterrorism? Granted, this could happen with nature's own course, and our own mutations. However, we have survived this long trusting nature's own fuck ups, let's not purposely fuck it up for profit :)
All your base pairs are belong to us!
Computers obey me.
This is great news now they need to sequence a cat and make me a cat girl! :-3 (the no hammerspace option please)
I'd like to make several points.
First, the nature vs. nurture argument is being 'spun' by biologists to placate the fears of people. Nature is a far more important element than the existing arguments would have you believe. Genetics is, without doubt, an incredibly powerful tool.
Second, we don't need any secret weapons in the race to cure disease. People are already outliving their ability to live with any quality of life. Earth is already overpopulated, and we humans are consuming far more energy than is our rightful share.
Third, we humans are not capable of making decisions with regards to what should or shouldn't be done with genetic information. Nor are we capable of enforcing our decisions with any sort of legal entity. We, unfortunately, have people who will break the law for personal gain.
Finally, bio-diversity is where genome research should be focussed, as natural balance is all about diversity. I'd much rather you studied the genome of rare animals.
However, I understand the economics of genetics (and science research in general) and realize that animal research isn't nearly as lucrative as being able to cure some wealthy (or well-insured) person of a disease at incredible mark-up. Don't be naive or suppose that we are naive when you propose your altruistic intention. It all comes back to saving the 'weak' human and indirectly making money.
My stance on this matter may change if humanity were facing extinction. However the risk/reward ratio is far too high.
Welcome to Slashdot: News for luddites, stuff that scares us.
It's not just about the proteins. As of the past decade we have begun to realize that the paradigm of DNA -(transcription)-> mRNA -(translation)-> Protein is not the end all, be all. We have regulartory elements on the DNA that affects the rates of transcription, mRNA modification which creates a wide variety of alternative splices, non-coding RNA that, despite not going to protein, still has important biological roles, and even non-coding DNA, previously disregarded as "Junk DNA" that life sciences researchers are beginning to hypothesize actually plays critical roles in gene regulation through methylation patterns, chromatin, etc.
Life sciences research has orthogonality. So what if one question's a stumper? You can still make headway on others.
It's such a fine line between stupid and clever.
I believe they combined 24 different people's genomes to eliminate point mutations and suchlike things. Nobody has the exact sequence of base pairs published.
ResidntGeek
Cobra Commander was a little bitch.
He was MY first exposure to an overbearing micromanager who couldn't get shit done. If he'd left Destro alone a little bit more often, maybe GI Joe wouldn't have been so fucking smug.
And maybe Destro would have signed the Cobra troops up for some shooting range time.
You better watch out, there may be dogs about . .
...but will it run on Linux?
Why does this number sound familiar to me?
Really weird.
PENAROL: Seras eterno como el tiempo y floreceras en cada primavera.
Which is more of a typical example of Science challenging our preconceptions than actual "oddity".
What I find odd is relationship between the mathematical constant equal to a circle's circumference divided by its diameter and the total number of genes in the human genoma.
There are 3,141 genes and pi begins with 3.141........
Thats odd.
PENAROL: Seras eterno como el tiempo y floreceras en cada primavera.
As a side-note, the Bible might have the first description of genetic engineering, when Jacob selectively crossbred sheep to achieve a desired phenotype. Good thing to know, when people are on about how genetic engineering is against God's Will.
Nostalgia's not what it used to be.
and some segment overlays where there are gaps, due to the methods used in sequencing.
One of the interesting fallouts of the the HGS is that we now realize that some people have inverted SNP and other anomolies, some of which were inherited from ancestors way back before we broke off from other simians.
And one should always point out that the difference in any segment from one human to another is greater than the difference between say the standard human sequence to a standard chimpanzee sequence, just as the difference between one human to another human is greater than the difference between a standard male sequence and a standard female sequence.
I think I said that right.
Now, if we could just figure out where the misfolds happen, we'd be right as rain.
Oh, and in case you wondered, race is just noise and meaningless at the genetic level - it's just adaptations to specific climates. Plop down an Inuvuk Native in Hawaii, along with other Inuvuks, let them live there for a few tens of thousands of years, and they'll look similar to other Hawaiian Natives.
Plop a Northern European down in Ethiopia, take the same time, and they'll look like people in Ethiopia do, with minor variations.
-- Tigger warning: This post may contain tiggers! --
I remember when I was a child (1990 I'd have been 8) and what a big deal this was. This will open the doors to amazing things and it'll be an improved qualify of life that humans have never known before. I'm the most excited nerd I know. lol
fisher price, the illest emcee.. step to me and i will doodoo on your face. jk
Can we get on with the transporter technology please? I'm getting tired of driving around the country, lets make it faster, DAMMIT!!
It may be rambling to you, but it is eye opening to others, or, at least to me. I suspect there are more people quietly reading and appreciating the information. This is really a very exotic technical area for most, there just isn't any obvious analog of the process in common experience. Thanks for expounding for the benefit of others.
I've fallen off your lawn, and I can't get up.
The best kind of news is the kind that you can announce over and over again, and it makes the front page every time. Any guesses how long it will take until they announce they just finished sequencing the human genome *again*?
I guess now all your base really do belong to us.
Cool! Amazing Toys.
It doesn't.
Case closed.
09 F9 11 02 9D 74 E3 5B D8 41 56 C5 63 56 88 C0 Whoops, silly middle mouse button...
I have this from some apparently-now-vanished web page:
The question of the merits of different programming languages has often been called a "religious argument", except maybe by those who assume that theres obviously One Right True and Only Way and it begins with C. This track is on the Roundworm CD, available for $15 from Prometheus Music, http://www.prometheus-music.com/
CD: Roundworm Label: Prometheus Music
Credits: Julia Ecklar: lead vocals & guitar. Kristoph Klover: 6-string guitar
Story Behind the Song
The question of the merits of different programming languages has often been called a ``religious argument,'' except maybe by those who assume that of course there's One Right True and Only Way and it begins with a C.
Lyrics
The Eternal Flame
This parody was sung by Julia Ecklar on Roundworm
Parody of ``God Lives on Terra'',
words and music by Julia Ecklar
For more information and other parodies, see www.songworm.com
Parody lyrics copyright 7/29/96 by Bob Kanefsky.
It seems that my POV on this issue is controversial amongst my friends, too. I'll try to be brief.
We can't regulate it. I know that. So do you, I'd wager. We can't stop the application of this technology either. The genie is out of the bottle. I lament the fact that corporations (where profit is the sole motivator) are so powerful, and so devoid of ethics.
I'm not scared of learning. I embrace it. However, applying this technology has ramifications. Mainly, keeping people alive (though that's not the only one). We do that too well, now. My stance is that we should let a few people die.
There are valid ethical, logical and economic reasons that human genetics shouldn't be researched (in today's circumstances-- there are circumstances in which the research would be imperative).
Do not flame me and call me a luddite. I am not scared of the future. I think it's a mistake and would not pay for it, personally, if I had a choice. There are better uses of the talents and resources devoting themselves to that research, imho.
as with all data recording tasks, there's got to be an error rate.
to what percentage do they know they've "got it" all?
and to what percentage do they know it represents us all? (did they sequence one human or many?)
music - http://www.subatomicglue.com