Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
liqbase
In Soviet Russia, genome sequences you!
Can we start the patent countdown clock?
The simple truth is that interstellar distances will not fit into the human imagination
- Douglas Adams
n/t
Now where's my +1 Talent in every base?
if God wouldn't have used LISP to encode the darn sequence in the first place
While a marvelous scientific breakthrough, with the current state of things, I'm just waiting for tomorrow's headline: "Human Genome Patented".
But don't worry; you can freely reproduce the genome for the low cost of $15,000 per pregnancy.
I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!
Alpha Centauri reference = complete win!
One step closer to Gattaca http://en.wikipedia.org/wiki/Gattaca Some of the genome should be left untouched - people equate genes with ability. In fact, it only is part of the whole picture, but that could easily be forgotten.
Why do one chromosone have more genes than others?
that makes blacks better at sports?
Any links to a site like "sacred-texts.com" gets a near automatic (-1, Religious) moderation. This can be overcome, but only if someone with mod points actually bothers to *read* the item in question.
Naturally, this is quite rare. I mean, I didn't even look at anything but the name of the website you linked to, and I certainly don't have any mod points.
"To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
-- Academician Prokhor Zakharov,
"Address to the Faculty"
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
Scientists: All your base pair are belong to us!
Your single nucleotide polymorphisms are unique! Just like everyone else's.
ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
The grass is always greener on the other side of the light cone.
20/40 is worse than 20/20.
20/10 is supposedly the best visual acuity observed in humans.
20/20 is 'normal'.
From the fine article:
"The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
There are other variations which make us unique.
Alternate alleles*
Indels (insertions/deletions)
Variable numbers of repeats.*
The genetic code uses 4 letters, but I'll use English for explaination.
A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
"The cat and the dog" vs "the cat and the big dog".
In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".
Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
So we can start compiling from source code now! We better get this covered under the GPL quickly.
Why do one chromosone have more genes than others
Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!
The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
figuring out what it all means.
BTW, one of the big next steps is to sequence the chromosomes in cancer to see how they differ from normal cells.
How can you say that GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCT GTAGGAGTGA is the first line of a chromosome? I've always been taught that the sequence of bases defines the codon (in pairs of three) and that so much codons make up a gene. If GATCAA... is part of the 'human genome' does that mean that we all have a chromosome 1 that goes GATCAA...? This seems very strange to me, since there'd be no variation and we'd all have the same genotype?
I guess I'm asking, what is meant exactly by "Chromosome 1 starts like GAT..."?
pi * 1000 genes. Got to love those fun coincidences.
Wake me when they make Cobra Commander.
Joey stole mine when I was 12. He rocked.
http://www.hapmap.org/
The goal of the International HapMap Project is to compare the genetic sequences of different individuals to identify chromosomal regions where genetic variants are shared.
This is good news but not too useful until we can model protein shaping.
The AGCT's code for proteins and so far we can only model very short combinations. All you coders keen for a life project have a crack at it. Theres 20 amino acids formed from combinations of three base pairs. The amino acids have attraction and repulsion properties with each other and their environment and form to make a unique shape. Its the analysis of that 3D shape that will solve:
- all cancer - modelling protein shapes means instant cancer cures
- bird flu - again modelling proteins means instant antibodies to diseases
- the most toxic substance ever invented - it will also open up designer drugs
Hmm 3,141 genes huh? Did anyone recognize those numbers? 3141 ... really close to 1000 times Pi. (Well minus some change). Very interesting. Perhaps we're all just circles and we're made up of our circumference divided by our diameter.
FLR
that this was done already. Meh, I suppose I was wrong.
gtcatgcgatacgtaggcaaatcg2tgacggcagt
hmmm i guess its not as funny unless its binary
All your base pair are belong to us.
Never shake hands with a man you meet in a fertility clinic.
Basicly, "blacks" have a very diverse set of genes, more so than those peoples who migrated out of Africa (Europeans, Asian, American Indians). Blacks may excel in sports because sports have become so specialized.
Regardless, being atheletic may provide an advantage in which case it would not be bred out. If it's neutral, then it will remin in the gene pool Only if it is deliterious would it be bred out.
How do they differentiate junk dna from genes?
I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?
What makes a gene a gene?
It's probably just me, but for some reason it seems like I've read about this happening already like three times. Maybe those were just updates on the progress but I swear I thought this was already completed. Maybe I'm just dupe weathered ;)
I will forever be a student.
Weaselmancer
rediculous.
A dozen actual people please. It doesn't count if your just mixing chromosones from different people to claim you have a complete DNA decoded; there is no gaurantee that mix of dna would be viable. There ought to be a panel of scientists to select 12 people to have their DNA read that are willing to be studied for the rest of their lives. Six men and six women. At least some of which would be siblings. Only then can you actually decode DNA. You'll get 90% of the answers there.
You always go with a base line. Then you read other people and compare and contrast them. Then add in other species. And voila, the genetic black box of subroutines that evolution found most useful that are 99.99999% of the answer. After that your left with mutations and figuring out what, and how, the code sequences do what they do and finally programming new sequences to test theory.
In other words 30 years from now it will finally get interesting.
Comment removed based on user account deletion
There are many other diseases waiting for genetic therapy. For example Cardiomyopathy, which has no cure but heart transplantation. I myself was a cardiomyopathy patient and a heart transplantation acceptor. I sincerely hope decoding of human gene could provide a cure for cardiomyopathy and many other diseases.
The L'Enfants Terrible Project can get underway.
Just... 30 years too late.
Non impediti ratione cogitationus.
It may seem logical to respond that evolution yields varied results, or throw up hypotheses about the physics involved or whatever the hell you want. But these do not explain cause, and cannot answer why chromosomal size is varied.
So, if you really want to know, the answer is...
because.
To simplify: genes make proteins. Some of what was called "junk" apparently does things like regulate gene "expression". Vast stretches of unexpressing nucleotides may also provide a landing pad for new genes.
He did, however he injected the data for this planet into chaos, so it all got corrupted. Adam didn't fall by eating the fruit of the knowledge of good and evil, it was just a data integrity check. When God creates, that which is created falls from him.
This is obviously great and all, but didn't they announce the Human Genome Project was complete 3 years ago?
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
// Chromsome1.m
C TGTAGGAGTGAG CATCTTTCAGGGTTGTGCTTCTAT CAATAAAAGTCCTCAAGAGGTTGGTTAATACGCATA GTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG";
// Copyright (C) 6000 BC God
// This genome is free software; you can redistribute it and/or
// modify it under the terms of the GNU General Public License
// as published by the Free Software Foundation; either version 2
// of the License, or (at your option) any later version.
// This genome is distributed in the hope that it will be useful,
// but WITHOUT ANY WARRANTY; without even the implied warranty of
// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
// GNU General Public License for more details.
// You should have received a copy of the GNU General Public License
// along with this genome; if not, write to the Free Software
// Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
Chromosome *chromo1 = "GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGG
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAAT
TCTAGAAGGTAGAGCTGTGGTCGT
GTTTAATAGTAC
// FIXME: To do...
"...the computer language Lisp [is] to Artificial Intelligence roughly what the DNA code is to genetics."
from "Consciousness Explained", p. 384
Don't confuse randomness with not knowing how it works. Perhaps it just LOOKS random because we don't see or understand the pattern/function yet?
It seems to me that there are definitely some "rules" for evolution, although our understanding of them and how they work is very very limited -- for now. I mean, we don't see trees evolving into dogs and vice versa. So clearly there are some constraints on what can and can not be done within evolution.
But it's a hard thing to study because we've only been here (and been smart enough) for a very short period of time, evolution-wise.
And the world isn't round, either!
No, really - it's shaped like a burrito!
At that rate, it must be a group made entirely of male scientists.
All I have to do is open my mouth once & any female can sequence my genes instantly.
Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".
Wanna fight ? Bend over, stick your head up your ass, and fight for air.
OMFG...... pi = 3.14159265 so i recon there are .59265... Genomes that havent been discovered (i know fk all about this topic) however posibly genomes that change state inorder to fulfull diferent tasks.
but you cant help but see the resembalance
But I am still wondering about the intelligence/blonde connection, :-). I guess by my own reasoning, if there were such a coupling, there'd be no blondes. By contradiction of natural selection, intelligence and blonde are not connected. Q.E.D!
Phew.
Oh, damn. I have fallen victim to the dyed hair fallacy.
inversions would form "the cat the and dog" or, more accurately ('scuse the pun) "the cat dna the dog".
Did anyone else find the number 3,141 interesting? Is that a coincidence, or is there a good reason?
...gggagggagggagctcggacctcagatgcatintelinsidetgtgc cctcttctcctcctg...
The human genome project is one of the most monumental projects undertaken and accomplished by mankind in terms of technology, knowledge gained, collaboration, and potential for improving the human condition. It actually allows us to see the genetic blueprint for what makes us, us. Going to the moon is in the same category but precious few other things are in the same league. It was done under budget and ahead of schedule- it cost $2.7 billion (1991 dollars) which adjusted to 2006 would be $4B and was finished 2 years ahead of schedule. The people involved in the effort should be proud of their accomplishment.
m _wrapper&Itemid=182. It could have gone toward 68 other projects like the human genome project.
As a depressing comparison, consider the $281 billion and counting spent in Iraq so far http://nationalpriorities.org/index.php?option=co
How come there's as many genes as the first four digits of PI?
falxx
I'd give smarts for insight any day.
Sometimes, I'd give intelligence for booze. Life'd be a lot easier and less painful.
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
I checked the Nature website for the paper, here's the free link:u ll/nature04727.html
http://www.nature.com/nature/journal/v441/n7091/f
I'm convinced that the sequence is actually a big piece of ASCII art. Find the correct line width, print the whole thing off and stand back. I'm guessing it will spell out something like "Sorry for the inconvenience".
-= This is a self-referential sig =-
There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug
Who is this "human" whose genome has been sequenced? Is this some kind of "Messiah on CD" spam offer?
--
make install -not war
This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.
Automated DNA sequencing software
I thought cowardly foxes had a yellow streak?
Support Right To Repair Legislation.
Due to some 'random' thing happening two the chromosomes simply merged, yet when recombining to form the zygote the seperate chromosomes of the wild horse find their way to match up and combine with the domestic horses chromosomes. The resulting offspring will have 65 chromosomes.
And when you gaze long enough into the code, the code will also gaze into you.
Isn't military technology classified for 30+ years?
Unfortunately I'm dislexic, all I got was goo that tastes like chicken.
Yeah, there's not a lot of people with glasses who hang around in dark enclosed spaces, avoiding the sunlight because it hurts our eyes.
looks at inside of dark computer room, and closed blinds on window
never mind...
Never give in--never, never, never, never, in nothing great or small, large or petty, never give in except to conviction
I'll take that genome therapy shake for a larger penis now, thank you.
The human genome sequencing project is the most retarded project undertaken by biologists to date.
I'm quite sure my DNA is significantly different from lets say Elvis'.
What's the friggin point? These people really have no clue. They get what they deserve.
All your base pairs are belong to us!
Computers obey me.
This is great news now they need to sequence a cat and make me a cat girl! :-3 (the no hammerspace option please)
I'd like to make several points.
First, the nature vs. nurture argument is being 'spun' by biologists to placate the fears of people. Nature is a far more important element than the existing arguments would have you believe. Genetics is, without doubt, an incredibly powerful tool.
Second, we don't need any secret weapons in the race to cure disease. People are already outliving their ability to live with any quality of life. Earth is already overpopulated, and we humans are consuming far more energy than is our rightful share.
Third, we humans are not capable of making decisions with regards to what should or shouldn't be done with genetic information. Nor are we capable of enforcing our decisions with any sort of legal entity. We, unfortunately, have people who will break the law for personal gain.
Finally, bio-diversity is where genome research should be focussed, as natural balance is all about diversity. I'd much rather you studied the genome of rare animals.
However, I understand the economics of genetics (and science research in general) and realize that animal research isn't nearly as lucrative as being able to cure some wealthy (or well-insured) person of a disease at incredible mark-up. Don't be naive or suppose that we are naive when you propose your altruistic intention. It all comes back to saving the 'weak' human and indirectly making money.
My stance on this matter may change if humanity were facing extinction. However the risk/reward ratio is far too high.
It's not just about the proteins. As of the past decade we have begun to realize that the paradigm of DNA -(transcription)-> mRNA -(translation)-> Protein is not the end all, be all. We have regulartory elements on the DNA that affects the rates of transcription, mRNA modification which creates a wide variety of alternative splices, non-coding RNA that, despite not going to protein, still has important biological roles, and even non-coding DNA, previously disregarded as "Junk DNA" that life sciences researchers are beginning to hypothesize actually plays critical roles in gene regulation through methylation patterns, chromatin, etc.
Life sciences research has orthogonality. So what if one question's a stumper? You can still make headway on others.
It's such a fine line between stupid and clever.
back in the sixties.
Cobra Commander was a little bitch.
He was MY first exposure to an overbearing micromanager who couldn't get shit done. If he'd left Destro alone a little bit more often, maybe GI Joe wouldn't have been so fucking smug.
And maybe Destro would have signed the Cobra troops up for some shooting range time.
You better watch out, there may be dogs about . .
...but will it run on Linux?
Why does this number sound familiar to me?
Really weird.
PENAROL: Seras eterno como el tiempo y floreceras en cada primavera.
Which is more of a typical example of Science challenging our preconceptions than actual "oddity".
What I find odd is relationship between the mathematical constant equal to a circle's circumference divided by its diameter and the total number of genes in the human genoma.
There are 3,141 genes and pi begins with 3.141........
Thats odd.
PENAROL: Seras eterno como el tiempo y floreceras en cada primavera.
and some segment overlays where there are gaps, due to the methods used in sequencing.
One of the interesting fallouts of the the HGS is that we now realize that some people have inverted SNP and other anomolies, some of which were inherited from ancestors way back before we broke off from other simians.
And one should always point out that the difference in any segment from one human to another is greater than the difference between say the standard human sequence to a standard chimpanzee sequence, just as the difference between one human to another human is greater than the difference between a standard male sequence and a standard female sequence.
I think I said that right.
Now, if we could just figure out where the misfolds happen, we'd be right as rain.
Oh, and in case you wondered, race is just noise and meaningless at the genetic level - it's just adaptations to specific climates. Plop down an Inuvuk Native in Hawaii, along with other Inuvuks, let them live there for a few tens of thousands of years, and they'll look similar to other Hawaiian Natives.
Plop a Northern European down in Ethiopia, take the same time, and they'll look like people in Ethiopia do, with minor variations.
-- Tigger warning: This post may contain tiggers! --
All your base are belong to us!
I remember when I was a child (1990 I'd have been 8) and what a big deal this was. This will open the doors to amazing things and it'll be an improved qualify of life that humans have never known before. I'm the most excited nerd I know. lol
fisher price, the illest emcee.. step to me and i will doodoo on your face. jk
Can we get on with the transporter technology please? I'm getting tired of driving around the country, lets make it faster, DAMMIT!!
The best kind of news is the kind that you can announce over and over again, and it makes the front page every time. Any guesses how long it will take until they announce they just finished sequencing the human genome *again*?
I guess now all your base really do belong to us.
Cool! Amazing Toys.
ACGT isn't binary, it's quaternary (base 4). Whereas binary uses only 0 and 1, it uses 0, 1, 2, and 3 (easy to see how that translates into A, C, G, and T, I hope.)
In fact:
The nucleotide sequence GATTACA can be represented by the quaternary number 2033010, which is 9156 in decimal.
I have this from some apparently-now-vanished web page:
The question of the merits of different programming languages has often been called a "religious argument", except maybe by those who assume that theres obviously One Right True and Only Way and it begins with C. This track is on the Roundworm CD, available for $15 from Prometheus Music, http://www.prometheus-music.com/
CD: Roundworm Label: Prometheus Music
Credits: Julia Ecklar: lead vocals & guitar. Kristoph Klover: 6-string guitar
Story Behind the Song
The question of the merits of different programming languages has often been called a ``religious argument,'' except maybe by those who assume that of course there's One Right True and Only Way and it begins with a C.
Lyrics
The Eternal Flame
This parody was sung by Julia Ecklar on Roundworm
Parody of ``God Lives on Terra'',
words and music by Julia Ecklar
For more information and other parodies, see www.songworm.com
Parody lyrics copyright 7/29/96 by Bob Kanefsky.
It seems that my POV on this issue is controversial amongst my friends, too. I'll try to be brief.
We can't regulate it. I know that. So do you, I'd wager. We can't stop the application of this technology either. The genie is out of the bottle. I lament the fact that corporations (where profit is the sole motivator) are so powerful, and so devoid of ethics.
I'm not scared of learning. I embrace it. However, applying this technology has ramifications. Mainly, keeping people alive (though that's not the only one). We do that too well, now. My stance is that we should let a few people die.
There are valid ethical, logical and economic reasons that human genetics shouldn't be researched (in today's circumstances-- there are circumstances in which the research would be imperative).
Do not flame me and call me a luddite. I am not scared of the future. I think it's a mistake and would not pay for it, personally, if I had a choice. There are better uses of the talents and resources devoting themselves to that research, imho.
as with all data recording tasks, there's got to be an error rate.
to what percentage do they know they've "got it" all?
and to what percentage do they know it represents us all? (did they sequence one human or many?)
music - http://www.subatomicglue.com