Slashdot Mirror


Youngest Planet Discovered

qazsedcft writes "BBC is reporting that Astronomers have discovered what appears to be the youngest planet, being less than 2000 years old. If this proves to be true it could challenge our models of solar system formation."

123 of 182 comments (clear)

  1. I'm not that impressed by evolvearth · · Score: 3, Funny

    It's about a thousand year's shy of being middle aged. After all, the earth is approximately 6000 years old.

    1. Re:I'm not that impressed by Otter · · Score: 3, Funny
      I'd been thinking "For once, an astronomy story where we won't be subjected to a stream of 'But the earth is 6000 years old!' comments!"

      I underestimated you guys -- it'd be like anything Google-related not having ten "Steve Balmer through another chair!" posts.

    2. Re:I'm not that impressed by Tesen · · Score: 5, Funny

      In a related story, Microsoft CEO Steve Balmer threw multiple chairs after he heard of the newly discovered "young" planet. Steve was quoted as saying, "I bet freaking google has already tried to map the fucker! ".

    3. Re:I'm not that impressed by sorak · · Score: 2

      It's about a thousand year's shy of being middle aged. After all, the earth is approximately 6000 years old.

      Yeah, but it's a "young earth". In another 6000 years, it's going to buy a trans-am and start flirting with 6000 year-old planets.

    4. Re:I'm not that impressed by capnchicken · · Score: 2, Funny

      That's what Earth loves about these gaseous planetary clouds. Earth gets older, they stay the same age.

      --
      A libertarian shat on my carpet once. Claimed the free market would sort it out. -Ford Prefect(8777)
    5. Re:I'm not that impressed by Grishnakh · · Score: 2, Insightful

      Slashdotters will quit with the 6000-year-old earth comments just as soon as the hordes of Bible thumpers stop trying to convince everyone that that is really true.

      Since the Bible thumpers are actually growing in number, don't expect that to happen any time soon.

    6. Re:I'm not that impressed by element-o.p. · · Score: 1

      I'd pay good money to see Steve Balmer through another chair :P

      --
      MCSE? No, sir...I don't do Windows. Yes, I am an idealist. What's your point?
    7. Re:I'm not that impressed by QRDeNameland · · Score: 4, Funny

      All to test our faith.

      "Dinosaur fossils? God put those there to test our faith."

      "I think God put you here to test my faith, dude. You believe that?"

      "Uh huh."

      Does that trouble anyone here? The idea that God might be fuckin' with our heads? Anyone have trouble sleeping restfully with that thought in their heads? God's running around, burying fossils: "Huh huh ho. We will see who believes in me now, ha HA. I'm a prankster god. I am killing me. Ho ho ho ho."

      You know, you die, you go to St. Peter, "Did you you believe in dinosaurs?"

      "Well, you know, there was fossils everywhere."

      "What are you, an idiot? God was FUCKING with you! Giant flying lizards? You moron! That's one of God's easiest jokes!"

      "It seemed so plausible! Aieeeeeeeee!" Bound for the lake of fire. . . .

      ---quoth the prophet Bill Hicks

      --
      Momentarily, the need for the construction of new light will no longer exist.
    8. Re:I'm not that impressed by binpajama · · Score: 5, Funny

      Won't it be getting close to the Flood for those poor folks? Maybe we could bundle our tele-evangelists into a spaceship and send them there to spread salvation. The horrors of Earth must not be repeated elsewhere.

    9. Re:I'm not that impressed by Rycross · · Score: 2, Interesting

      I kinda figure that if God has enough of a sense of humor to prank us by burying dinosaur fossils, he's probably not going to be that uptight about the requirements for getting into heaven.

      Well, that is if I believed in biblical literalism. Or God.

    10. Re:I'm not that impressed by somersault · · Score: 1

      Sounds like a lot of backwards boloks to me.

      --
      which is totally what she said
    11. Re:I'm not that impressed by arminw · · Score: 2, Interesting

      ....But the earth is 6000 years old!' comments!".....

      If a planet can form out there somewhere in only 2000 or less years, might it then not be possible to get one done in three times as long?

      --
      All theory is gray
    12. Re:I'm not that impressed by JeanPaulBob · · Score: 3, Interesting

      FYI... I grew up in creationist circles, seeing creationist videos, reading websites, etc. I've never actually encountered anyone who thought that fossils are fakes.

      You might find such people in the back hills somewhere...But that kind of thing has nothing to do with the kind of creationism you're likely to encounter.

    13. Re:I'm not that impressed by vistic · · Score: 1

      Uhhh... yeah. That pretty much goes without saying. Or are you under the impression they found highly evolved life and geographical features on this 2000 year old planet?

      A 2000 year old planet *probably* isn't very hospitable to life yet. Just my guess.

    14. Re:I'm not that impressed by vistic · · Score: 1

      Aw crap, I should have replied to this longer dumb comment, instead of your other dumb comment.

      But yeah. They found a planet that's only 2000 years old. Believe it or not, everyone agrees that our own planet was 2000 years old at one time. What Earth was like at age 2000 is another matter, though. I'm guessing no solid crust at all, just a ball of molten rock trying to get itself together. No mountains, no oceans, no life, none of the things you see around you on Earth today.

      I can't believe I'm even bothering to respond.

    15. Re:I'm not that impressed by PhetusPolice · · Score: 1

      Alan Watts suggested that God is highly capable of joking, as it is the most constructive thing you can do. What else is God going to do with time?

    16. Re:I'm not that impressed by Rycross · · Score: 1

      I grew up in the same circles and never heard it either. Just sayin.

      Most creationists take the position that dating techniques are basically just plain wrong, and that dinosaurs died off in the flood.

    17. Re:I'm not that impressed by BrianGKUAC · · Score: 1

      It's orbiting the star Sirius. It's one of the five that do so... I don't remember which one, though.

      Of course, now that I've said that, I'm likely to be tak-;laisnnvianeiaavnabe- NO CARRIER

      --
      Menus: Linux=function, Windows=vendor, OS X=as little as possible. Makes a statement, don't you think?
    18. Re:I'm not that impressed by marnues · · Score: 1

      Your comprehension of basic logic is so seriously flawed I don't think anyone knows where to begin with you.

    19. Re:I'm not that impressed by Delkster · · Score: 1

      I thought that happened all the time at clubs.

      (Not necessarily to me, but to members of the prettier gender.)

    20. Re:I'm not that impressed by evilviper · · Score: 1

      I've never actually encountered anyone who thought that fossils are fakes.

      It doesn't matter whether it's true or not. The "rational" people need something to pin on the "non-rational" (ie. those that disagree with them about anything) people that follow some particular religion and factual accuracy doesn't count. It certainly didn't start, today, on /. and it's certainly not going to end because you've pointed out how incorrect and irrational it happens to be.

      For reference, see: http://en.wikipedia.org/wiki/Flat_Earth_mythology
      --
      Slashdot gets worse every day... Pipedot: News for nerds, without the corporate slant
    21. Re:I'm not that impressed by arminw · · Score: 1

      ....A 2000 year old planet *probably* isn't very hospitable to life yet. Just my guess....

      I would guess that also. Still such a short formation time of any kind of planet, habitable or not, is evidence against some present theories of planet formation.

      --
      All theory is gray
    22. Re:I'm not that impressed by JeanPaulBob · · Score: 1

      He told me that the fossil record (i.e. dinosaurs and pre-humans like Neanderthal and Cro-Magnon) was faked, built up from tiny pieces of bone into what scientists imagined the creature looked like.
      That's something else.

      We were talking about the idea that the fossils in the ground were put there by God, but were never living animals. There's probably someone out there who would say that, but for any position you can find at least one person who holds it. It's not standard creationism, was my point.

      Your friend was talking about the theoretical reconstruction of fossils from fragments. Which does happen a lot--you rarely find complete skeletons. So when you see a representation of a prehistoric animal, you can ask, "How much theoretical construction is involved? How certain is it?" I have no idea what specific cases your friend was talking about--he might be entirely right, he might have been blowing it way out of proportion.
    23. Re:I'm not that impressed by arminw · · Score: 1

      ....Why do you believe what one group of humans says are God's rules?....

      That's the question that religion has been and still is trying to figure out. If God really exists, don't you think He should be capable of communicating to each individual that TRULY wants to hear from Him, regardless of preconceived notions from others?

      Forget what you've heard about Christianity and any other religion. Read the gospel of John, as it is written and make up your own mind, without other "religious" input. Jesus life and what he told us, can stand entirely on its own. If need be, read it several times, from different translations. It is rather short. Think about the implications for your life IF what is written there is really true. If you need more information, read the other three gospels as well.

      Of course, you may come to the conclusion that what is written there is fiction. That is your choice.

      --
      All theory is gray
    24. Re:I'm not that impressed by deniable · · Score: 1

      It gets really weird when you consider that:
      If god is all powerful and created all of this 'evidence' that the earth is older than 6000 years, then he could have just as easily done it at 7:15 this morning and created a bit more evidence. All your memories, history, everything. Blows my mind.

    25. Re:I'm not that impressed by EnsilZah · · Score: 1

      Wow, does what you just wrote actually make sense to you?

      First, no one claimed it formed in 2000 years, they claimed it's 2000 years old, which means that 2000 years ago it crossed some kind of semantic barrier that switched it from being a ball of compact space debris to something we should call a planet.

      Second, the people who believe the earth was created ~6000 years ago also believe that it was created in what was it, three days?

    26. Re:I'm not that impressed by witekr · · Score: 1

      I think many people are quick to close their minds once they decide on their preferred world view (reality tunnel).

      Lets pretend we had knowledge of all the exact laws and constants that govern the way our universe ticks. We might then develop a piece of software that would simulate all of these laws in a virtual universe. Generate a whole bunch of atoms (perhaps on a smaller scale than our universe because of memory limitations (though we don't know our universe yet to be sure)) and hit Run (perhaps at a fraction of true speed because of computation limits, speed of light etc, though again: we don't know enough about our universe and physics yet to be certain of this need). Wouldn't we then not be considered gods of this simulated universe? Could we not step in and modify the simulation to move atoms around or speed certain developments up to our preference? If forms of 'life' developed in our simulated universe, I don't see why we couldn't run some code that would affect virtual atoms in a way that seemed (rightly) supernatural to these virtual denizens.

      Perhaps Christianity or other religions are actual records of such supernatural influence. Or perhaps our universe was born billions of years ago and life grew out of terribly convenient positions of atoms resulting in primitive analog machines that (by surprising luck) formed in a design that could replicate and become more complex. There are endless other possibilities.

      What if we invented a technology that could take a record of all matter and energy in a particular moment.. say, a snapshot of all matter and energy (and whatever other variables we don't know about) in our galaxy. If we could then convert this information into a form that could be fed into our simulated universe, we then have a copy of the Milky Way galaxy that you could argue was 'created' without any complex evolutionary processes.

      Just wanted to share these simple perspectives to say, maybe claiming certain atheist views while scoffing at religion is hypocritical in a sense?

    27. Re:I'm not that impressed by JosKarith · · Score: 1

      "If, 4000 years from now, this planet has indigenous intelligent life on it, then I, for one, will concede the Earth could be 6,000 years old if we ignore all the other evidence that it's not." And if we've managed to go all those 4000 years without destroying ourselves then there might just be something in the universe bigger than human greed and irrationality...

      --
      'Don't worry' said the trees when they saw the axe coming, 'The handle is one of us.'
    28. Re:I'm not that impressed by JosKarith · · Score: 1

      Well I was thinking we'll send our greatest thinkers, our greatest warriors and all our televangelists in 3 seperate ships. Of course the televangelists' ship will go first, to avoid being eaten by the great space goat...

      --
      'Don't worry' said the trees when they saw the axe coming, 'The handle is one of us.'
    29. Re:I'm not that impressed by Grishnakh · · Score: 1

      There's nothing atheist about scoffing at the 6000-year-old notion. Only a fundamentalist Christian would think such a thing, while the entire rest of the world, including members of other religions and even other non-fundie Christians, would happily scoff at the fundie's 6000-year idea.

      It's very simple: there's a preponderance of physical evidence suggesting the earth is billions of years old, and that life has been evolving on it for many hundreds of millions of years. Then there's a holy book, which if you interpret it in a very narrow, literal, and specific way, suggests the earth is 6000 years old. Which are you going to believe?

      Your "supernatural influence" idea is right up there with the idea that God set photons in motion from distant galaxies to get around the problem that our telescopes are seeing events that happened millions and billions of years ago, or that God put dinosaur fossils in place to test our faith. If you're going to come up with crazy things like that, there's no point in even debating. How do you know some other God didn't just create everything 2 minutes ago? It's pointless to even think about such a thing. It's like debating how many angels can fit on the head of a pin.

    30. Re:I'm not that impressed by mgblst · · Score: 1

      Well, lets all hope that the Earth isn't at the end of its lifespan just yet.

    31. Re:I'm not that impressed by master_p · · Score: 1

      It sounds more like Q from Star Trek than the Christian God...

    32. Re:I'm not that impressed by Two9A · · Score: 1

      This is indeed what the Catechism of the Church of Last Thursdayism states: that cats created the universe last Thursday, and humans as their carers.

      Personally, I subscribe to a different thread of the same belief: that the Universe was instantiated as a UniVMware guest system last Thursday.

      --
      xkcdsw: the unofficial archive of Making xkcd Slightly Worse
    33. Re:I'm not that impressed by JeanPaulBob · · Score: 1

      3 and 4 are standard creationism. 1 and 2 are not. (Well, 2 might show up when talking about a particular fossil, but not generally.)

    34. Re:I'm not that impressed by Hucko · · Score: 1

      Java Man was based on a pigs tooth, that was still running around Java. The Iguanodon was also reconstructed to look more like a rhino originally. Brontosaurus etc....

      --
      Semi-automatic amateur armchair Australian philosopher; conjecture ready at any moment...
    35. Re:I'm not that impressed by im_thatoneguy · · Score: 1

      Really? Back hills creationism is the type of creationism I've encountered more than any other.

      A Landover Baptist article once got passed around my highschool and generated a great deal of outrage for over a month much to my amusement. (Editor's Note: Landover Baptist is a parody much like the onion only for religious issues.)

      "
      Before the ark we were experimenting with genetics in our super high tech cities.
      The ancient egyptians were super advanced.
      The devil planted fossils to trick us.
      "
      etc etc.

      Anything that sounded good and authorative was often immediately snapped up and dispersed with a great sense of urgency without any fact checking. To expect them to apply a scientific level of scrutiny to creationism is unfortunately just asking too much.

      Back Hills Creationism has in my experience been the dominant form of creationism for the religious layman.

      Back Hills Evolution is also unfortunately the dominant form of biology understood by and propagated by the layman.

      Sadly it's the uninformed who are often the most self-assured and beligerant propaters of all theories.

  2. Magratheans by JeepFanatic · · Score: 4, Funny

    Maybe it's just the Magrathean's hard at work? Are there any white holes nearby for the collection of raw materials?

    1. Re:Magratheans by hkgroove · · Score: 1

      Shouldn't that be hard-on?

    2. Re:Magratheans by CDMA_Demo · · Score: 1

      Look closer, maybe has Slartibartfast written all over

    3. Re:Magratheans by JeepFanatic · · Score: 1

      We'll have to monitor the planet's development for fjords and crinkly bits.

    4. Re:Magratheans by JeepFanatic · · Score: 2, Insightful

      I'm still trying to figure out how this got modded insightful.

    5. Re:Magratheans by Archangel+Michael · · Score: 3, Funny

      Don't you know, Adams was a prophet! That makes the grandparent insightful! Where's your faith man??? 42 is all you need to know.

      --
      Agent K: A *person* is smart. People are dumb, stupid, panicky animals, and you know it.
    6. Re:Magratheans by JeepFanatic · · Score: 1

      Should we then wait for his reappearance at Milliways?

    7. Re:Magratheans by MozeeToby · · Score: 2, Informative

      You get no karma bonus for being modded funny. Knowing this, some moderators choose to mod insightful/interesting instead of funny so people are rewarded for their humour.

    8. Re:Magratheans by JeepFanatic · · Score: 1

      I did not know that. Thanks for the info.

  3. "Challenge our models"? by gardyloo · · Score: 4, Interesting
    From the submission on slashdot:

    If this proves to be true it could challenge our models of solar system formation. In the article it states that the [computer] models seem to be such a good fit to what they're seeing, that it "may actually be what happens in nature" [my paraphrase]. OK, fine. How is this any different that what's been thought for the last 30 years? Disk of swirling stuff: check. Some small inhomogeneities which get gravitationally amplified: check. Perturbing, passing massive things: check. What challenge?
    1. Re:"Challenge our models"? by truthsearch · · Score: 4, Informative

      The submitter was referring to time frame, I believe. Usually the disc is millions of years old before planets form (as far as we know). This one is thought to be less than 100,000 years old. However, another start flying by 1600 years ago might be an extenuating circumstance.

    2. Re:"Challenge our models"? by mcvos · · Score: 1

      What challenge?

      It might challenge our models of solar system formation. Or it might not. Depending on what scientists find out if they examine this thing a bit more.

    3. Re:"Challenge our models"? by Anonymous Coward · · Score: 5, Informative

      There really is an open controversy in the field regarding whether the gravitational instability model or the core accretion model is appropriate for large planets. Instability occurs very quickly and tends to produce big planets (the disc just clumps); accretion takes a long time and tends to build smaller planets (things have to hit and stick).

      Most astronomers believe that core accretion is correct, but there's a significant numerical astrophysics community who believes the instability model. Arguments tend to be about how cold the disc needs to be for the mechanism to work.

      The discovery of large early planets strengthens the evidence for the instability model.

      However, if I'm reading right, the 1600 yr timescale is mostly could-it-be speculation. Haven't read the underlying paper yet though.

      IANA.. oh, wait. I actually am a planetary astrophysicist.

    4. Re:"Challenge our models"? by maxch · · Score: 1

      it also might kill us all, or maybe a race of evil zombies might be evolutionizing on it. It also might be the replica of earth built by aliens to practice the invasion.

    5. Re:"Challenge our models"? by DaveV1.0 · · Score: 1

      Apparently, the challenge is in writing a decent summary of the article. Of course, it is possible the submitter didn't even bother to RTFA.

      Of course, it could be just sensationalism running wild. That could *never* happen on /., right?

      --
      There is no "-1 offended" or "-1 you don't agree with me" mod options for a reason.
    6. Re:"Challenge our models"? by simcop2387 · · Score: 1

      if they can build a replica, what the hell do they need the original for? if they are that advanced they've got far more resources than earth could provide (unless they need slaves)

    7. Re:"Challenge our models"? by s4ck · · Score: 1

      Don't argue with the aliens. they want what they need and need what they want.

    8. Re:"Challenge our models"? by soupman · · Score: 1

      How does a disc of matter collect into a sphere and how does that sphere manage to maintain its orbit for thousands and millions of years?

      --
      int 20h
    9. Re:"Challenge our models"? by spaceman375 · · Score: 1

      I've felt for awhile that both theories are true, depending on distance from the new sun. Solar wind pressure would blow the lighter elements out to jovian radii, leaving heavier objects close enough to the hard radiation to become somewhat molten, hence sticky enough for core aggregation. Our own planetary distribution is what suggested this to me. My credentials as any kind of astrophysicist are a matter of science fiction, so I'll bow to your more educated opinion on the subject. Wadda ya think?

      --
      On the one hand you take life too seriously, and on the other, you do not take playful existence seriously enough. Seth
    10. Re:"Challenge our models"? by qazsedcft · · Score: 1

      Actually, the submitter did bother to read the article, and also did bother reading the replies. Perhaps my headline was a bit sensational, but I didn't have much time to write a decent summary being at work.

      Of course, what did I expect? /. readers actually RTFA and commenting on that, or making sarcastic comments about the headline. That could never happen on /., right?

  4. But who's the father? by the_humeister · · Score: 1

    Inquiring minds really want to know. And so does Planet Weekly magazine.

    1. Re:But who's the father? by garett_spencley · · Score: 1

      It's not me. I swear!

    2. Re:But who's the father? by jd · · Score: 2, Funny

      I asked Asterix. He heard something about it being By Jupiter.

      --
      It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
  5. Won't somebody think of the children... by zappepcs · · Score: 5, Funny

    This astronomy child porn has to stop! Before you know it, these 'astronomers' will be cruising the galaxy trying to probe every new planet they find!

    1. Re:Won't somebody think of the children... by pshumate · · Score: 5, Funny

      Great, now Chris Hansen's going to host "To Catch An Astronomer."

    2. Re:Won't somebody think of the children... by AioKits · · Score: 2, Interesting

      Great, now Chris Hansen's going to host "To Catch An Astronomer." Shouldn't be too hard. Just look for telescopes. If you want the 'big' offenders, look for the bigger telescopes!
      --
      "Quote me as saying I was mis-quoted." -Groucho Marx
  6. Change our thinking? by Mr.Fork · · Score: 2, Insightful

    I think the article submitter/BBC has it wrong about changes to theories. Science is about discovery. How about this discovery introduces new wonders of our universe? Imagine - being able to even detect a plant and then determine that is even 2000 years old - that is the real story!

    --
    Management is doing things right; leadership is doing the right things. - Peter F. Drucker
    1. Re:Change our thinking? by InvisblePinkUnicorn · · Score: 2, Funny

      "Imagine - being able to even detect a plant"

      I'm always trying to do this, but I just end up stepping on them first.

  7. Headline Correction by joeflies · · Score: 4, Insightful

    Youngest KNOWN Planet Discovered

    1. Re:Headline Correction by geekoid · · Score: 1

      NO Shit.

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    2. Re:Headline Correction by bigtimepie · · Score: 1

      'Known' and 'Discovered' are redundant.

      Of course there are unknown planets that are undiscovered; of course the only known planets are the ones we have discovered.

      Thus, "Youngest Planet Discovered" implies the youngest of all that have been discovered (known). The headline is sufficient.

    3. Re:Headline Correction by MobileTatsu-NJG · · Score: 3, Informative

      Youngest KNOWN Planet Discovered That's implied by the word... DISCOVERED.
      --

      "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

    4. Re:Headline Correction by mmortal03 · · Score: 1

      You are right if "discovered" is taken to be an adjective, but wrong if it is taken to be a verb. This is ambiguous when interpreting the title.

    5. Re:Headline Correction by MobileTatsu-NJG · · Score: 1

      If it hasn't been discovered, we don't know it exists. Once discovered, we know about it. Simple.

      --

      "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

    6. Re:Headline Correction by geminidomino · · Score: 1

      Not really all that ambiguous. If "Discovered" is taken to be an adjective, then the headline lacks a predicate.

    7. Re:Headline Correction by mmortal03 · · Score: 1

      I agree with you. Generally, in headlines of this nature, "discovered" is always treated as a verb. Something like "Youngest Planet Found" is what they were getting at, which would definitely require "Youngest [Known] Planet Found" inserted to be accurate.

      The article was definitely not trying to be titled "[The] Youngest Discovered Planet", full stop, as others were trying to say (not you). When I read (reed) it in the latter way of meaning, I feel the need to say "dot dot dot" out loud after it, in other words, "The Youngest Discovered Planet... was what?"

    8. Re:Headline Correction by treeves · · Score: 1

      ...and this all makes perfect sense if you just remember to follow the simple rule: "ALWAYS interpret a headline in the way that makes the writer out to be the biggest knucklehead possible"!

      --
      ...the future crusty old bastards are already drinking the Kool-Aid.
    9. Re:Headline Correction by M.qrius · · Score: 1

      Actually, "Youngest planet discovered" is fine. The article talks about the youngest planet that has been discovered.

    10. Re:Headline Correction by joeflies · · Score: 1

      "est" says that it is the absolute and there are no planets younger than it, known or unknown. The modifier of known clarifies this statement, because we do not know if this particular planet is the absolute youngest planet in existence. Only the youngest one known to us. The only way this is true is if there is a definition for what defines when a planet is formed and at this very second it can be proven there are no others. Obviously this cannot be done. Thus, both Known and Discovered are necessary and one does not imply the other.

    11. Re:Headline Correction by MobileTatsu-NJG · · Score: 1

      "est" says that it is the absolute and there are no planets younger than it, known or unknown. Right, that's why the word 'discovered' is important. If we're discovering things, then 'known' is redundant.
      --

      "I like to lick butts!" by MobileTatsu-NJG (#32700246) (Score:5, Informative)

    12. Re:Headline Correction by sixtyeight · · Score: 1

      "Youngest grain of sand discovered... yet." Well, there's an excuse to throw a party that we can re-use [literally] ad nauseum.

      --
      The Wolfpack Project: BitCoin + Crowdfunding = Political Accountability
  8. Perhaps it won't wind up being a planet... by TripMaster+Monkey · · Score: 4, Interesting
    From TFA (emphasis mine):

    But there is an intriguing suggestion that the gas giant, which is some 14 times the size of our Jupiter, could be even younger.

    And this celestial body is still in the process of formation. It's possible that it will pick up enough extra mass to push it over the approximately 75 Jupiter-masses threshold and initiate fusion, becoming a star in its own right. We may be witnessing the birth of a binary star system.
    --
    ____

    ~ |rip/\/\aster /\/\onkey

    1. Re:Perhaps it won't wind up being a planet... by Tenebrousedge · · Score: 1

      And I think, "wow! how cool would that be, for humanity to be able to watch a binary star form!" Except for the follow-up thought which is that none of us will actually be around to watch it happen...this 'stellar timescale' thing sucks. I wanna go back to the beta days, seems like things were happening a lot faster back when this 'universe' project was just getting started...

      --
      Those who advocate genocide deserve every protection afforded by law, and none afforded by common human decency.
    2. Re:Perhaps it won't wind up being a planet... by jd · · Score: 2, Funny
      Gas giant planets contain heavy elements which - if you try to fuse them - will take more heat than they release. I can't see how you'd ever reach either ignition or self-sustaining conditions. Now, there ARE gas supergiant planets that are larger than small stars. Some were accused of being mis-identified brown dwarfs*. I think this find makes it very likely supergiant planets do indeed exist.

      (Brown dwarfs are easy to mis-identify, unlike white dwarfs, which carry warhammer adverts.)

      --
      It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
    3. Re:Perhaps it won't wind up being a planet... by swimsaturn · · Score: 2, Informative

      But there is an intriguing suggestion that the gas giant, which is some 14 times the size of our Jupiter, could be even younger. That is a very good point. 14 Jupiter masses is very close to the lower mass limit for temporary deuterium fusion. It will end up being a brown dwarf, not a planet. The 75 Jupiter mass threshold is for sustained hydrogen fusion (a star).
    4. Re:Perhaps it won't wind up being a planet... by Gazzonyx · · Score: 1

      Yeah, but things just seemed to happen faster in beta; it was really an informal continuation of alpha, but labeled in a way so as to make the marketing guys think we were actually making headway and fixing bugs. We actually skipped beta and just went RTM.

      --

      If I mod you up, it doesn't necessarily mean I agree with what you've said, sorry.

    5. Re:Perhaps it won't wind up being a planet... by Kelz · · Score: 1

      And now we're just arguing who gets in the end credits!

  9. Re:Duh, Jebus created it when he was born by quarrelinastraw · · Score: 1, Troll

    Errr, I meant younger. Jesus also occasionally switches the meanings of words to their opposites.

  10. From TFA... by SimonGhent · · Score: 5, Funny

    According to one model, planets form from the bottom up

    So that would be turtle first, then elephants, then the flat bit.

    Makes sense.

    (apologies for reading TFA, I'm new here)
    --
    simon
    1. Re:From TFA... by Speare · · Score: 3, Funny

      So that would be turtle first, then elephants, then the flat bit.

      No, it's turtles all the way down.

      --
      [ .sig file not found ]
    2. Re:From TFA... by notnAP · · Score: 1

      "I'm new here" != UID 57578

    3. Re:From TFA... by SimonGhent · · Score: 1

      Yeah, but TFA's about a 2000 year "young" planet.

      All things are relative.

      --
      simon
    4. Re:From TFA... by sm62704 · · Score: 1

      No, young man, it's turtles all the way down!

      --
      mcgrew's razor: Never attribute to stupidity that which can be explained by greedy self-interest
    5. Re:From TFA... by geekoid · · Score: 1

      Reading the TFA and the flagrant lie abut being new will be excused only because of the Diskworld reference.

      But we're watching you...

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    6. Re:From TFA... by cmh5 · · Score: 1
      From your own "correcting" link:

      In the popular Discworld comic fantasy books by Terry Pratchett, the Discworld is a flat disc that rests on the backs of four huge elephants which are in turn standing on the back of an enormous turtle as it slowly swims through space. In the book Small Gods, the question "what does the turtle stand on?" is asked, and gets the reply "It's a turtle, for heaven's sake. It swims. That's what turtles are for." In his introduction to The Discworld Companion, Pratchett uses the phrase in a different sense, describing the recurrence of the Earth on a turtle in myth as "turtles all the way".
    7. Re:From TFA... by Speare · · Score: 1

      First, it's just a silly non-scientific reply to a silly non-scientific reply on a science thread. You know, jokes. Lighten up. Second, I would have to say after a thorough re-reading of that page, that ancient Indian mythologies and even the western Thoreau kinda predate your favorite twentieth century pop-sci-fi author, an author who (by the way) highly values silly non-scientific philosophy. You know, jokes. Lighten up.

      --
      [ .sig file not found ]
  11. Planet is 100,000 years old, not 2,000 by AbsoluteXyro · · Score: 4, Informative

    According to the article, the proto-planet is 100,000 years old. It MIGHT be around 2,000 years old but there is no way to confirm that. It is more likely that the age of the proto-planet is more in line with the age of the star at 100,000 years. Space.com also reports that this planet is 100,000 years old. -- "The group, led by Jane Greaves of the University of St. Andrews in Scotland, found the 100,000-year-old fetal planet about 520 light-years away in the constellation Taurus "The new object, designated HL Tau b, is the youngest planetary object ever seen," said Anita Richards, an astronomer at the U.K. Jodrell Bank Centre for Astrophysics. Richards, who worked with Greaves' team to describe the infant planet, said it's just 1 percent as old as the young planet found in orbit around the star TW Hydrae last year."

    1. Re:Planet is 100,000 years old, not 2,000 by harry666t · · Score: 1

      > It MIGHT be around 2,000 years old but there is no way to confirm that.

      Meh. I saw God creating it.

      Oh, these mushrooms lying all around? These are Agaricus bisporus, aka button mushrooms, of course!

  12. only 18 years old by whtmarker · · Score: 5, Funny

    I think Captain Planet is the youngest planet alive. source

  13. Re:Pass out the cigars... by sm62704 · · Score: 2, Funny

    Flowers, my ass! When you have a baby you're supposed to hand out cigars. Where's my cigar, dammit?

    In related news, they've discovered the smallest black hole yet with a mass of only 3.8 times the sun's mass, and a diameter of only 24 km (that's about fifteen miles).

    So is this black ho the baby planet's momma?

    --
    mcgrew's razor: Never attribute to stupidity that which can be explained by greedy self-interest
  14. Re:Maybe not by maroberts · · Score: 4, Informative

    Not much chance of becoming a non-planet like Pluto - it's 14 times the mass of Jupiter, so it would have to break up into lots of smaller planets for that to happen.

    --

    Donte Alistair Anderson Roberts - hi son!
    Karma: Chameleon

  15. Re:Pass out the cigars... by Chapter80 · · Score: 4, Funny

    When you have a baby you're supposed to hand out cigars.
    Not in my town. Cigars for a boy, donuts for a girl.

    Yeah, that's right, the ones with a hole in them...

  16. Re:Pass out the cigars... by Deadstick · · Score: 2, Funny

    Sometimes a planet is just a planet.

    rj

  17. From the article by EriktheGreen · · Score: 1

    "The ball of dust and gas, which is in the process of turning into a Jupiter-like giant, was detected around the star HL Tau, by a UK team." Well, then... it's obvious the planet is being formed for The Greater Good through advanced technology. We can disregard the data, it's not a natural planetary formation.

    1. Re:From the article by MagusZeal · · Score: 1

      Hmph, well see what the Ordo Xenos and the Adeptus Astartes has to say about this 'Greater good'.

  18. Beware! by Mathness · · Score: 1

    Bah, I bet it is just a (galaxy) fed pretending to be young. :p

    --
    Carbon based humanoid in training.
  19. is this really the youngest plannet. by oliverthered · · Score: 1

    You have to take into account how many light years away it is, for all I know it could be older than the earth it just looks younger. Maybe I can sell a new beauty product for women, all they have to do is move so many light years away that they actually look younger than they really are, I'm sure someone will buy it.

    --
    thank God the internet isn't a human right.
    1. Re:is this really the youngest plannet. by MBGMorden · · Score: 2, Insightful

      You have to take into account how many light years away it is, for all I know it could be older than the earth it just looks younger. I'm going to assume (maybe erroneously) that only the second half of your post was a joke.

      As to the quote portion above, if Earth is 4.5 billion years old, and they see this as 2000 years old, then it's going to have to be 4.5+ billion light years away to actually BE older than Earth. That's significantly outside of the galaxy so no way we'd pick it up.
      --
      "People who think they know everything are very annoying to those of us who do."-Mark Twain
    2. Re:is this really the youngest plannet. by im_thatoneguy · · Score: 1

      Planet is ~520 light years away. Pretty easy to do the math from there.

      So the answer to your question is: No it's not older.

  20. Whippersnapper! by spike2131 · · Score: 2, Funny

    That planet better get off my lawn!

    <shakes-fist/>

    --
    SpyDock: Scientific Python in a Docker container
  21. Re:Youngest Planet by spidercoz · · Score: 1

    you know, these young Earth jokes stopped being funny about a hundred years ago. you're not clever, you're not witty, and if you're not actually attempting to be, you're just sad and pathetic

    --
    "I disapprove of what you say, but I will defend to the death your right to say it." - Evelyn Beatrice Hall, re Voltaire
  22. Re:Youngest Planet by Stanistani · · Score: 2, Funny

    Darn right. Everyone knows the Earth isn't young, it's flat.

  23. Re:Youngest Planet by Nullav · · Score: 1

    Young Earth jokes couldn't possibly be that old; Creationists have only been around for 20 years or so.
    (Wet blankets on the other hand...)

    --
    I just read Slashdot for the articles.
  24. did BBC get slashdoted ? by emilper · · Score: 1

    Did BBC get slashdoted ? It loads awfully slow.

    If the discovery can "challenge our models of solar system formation", how did they compute the age of the planet ? Wasn't that computation dependent on the current "models of solar system formation" ?

  25. Best part about young planets by mcmonkey · · Score: 3, Funny

    Every year you get older, they stay the same age.

  26. It says right there in TFA: by denzacar · · Score: 3, Funny
    From the TFA:

    Intriguingly, another young star in the same region called XZ Tau may have made a close pass of HL Tau about 1,600 years ago. Apparently, the pass XZ Tau made was more than just "close".
    He was last seen fleeing through the constellation of Taurus at the speed of light in order to avoid paying alimony.
    Apparently... HZ Tau is also already married.
    --
    Mit der Dummheit kämpfen Götter selbst vergebens
  27. Oblig by claytonjr · · Score: 1

    This just means that business is booming for Magrathea!

  28. Re:Pass out the cigars... by 2names · · Score: 1

    Why, President Clinton, I didn't realize that you swing that way...

    --
    "I'm just here to regulate funkiness."
  29. Re:Maybe not by jc42 · · Score: 1

    Not much chance of becoming a non-planet like Pluto - it's 14 times the mass of Jupiter, ...

    But there is the possibility that it'll go the other way, by accreting enough mass to graduate and become a small star.

    Stick around for a few hundred thousand years, and find out ...

    --
    Those who do study history are doomed to stand helplessly by while everyone else repeats it.
  30. Re:Pass out the cigars... by severoon · · Score: 2, Funny

    Huh. If that black hole is the planet's mama, then we should definitely get that planet that one t-shirt that says I tore mommy a new one!

    --
    but have you considered the following argument: shut up.
  31. Younger than Venus?! by Mr+Pippin · · Score: 1

    Wonder how Velikovsky would have taken this news?

    http://en.wikipedia.org/wiki/Immanuel_Velikovsky

  32. Re:Youngest Planet by Punko · · Score: 1

    Nope. Young Earth jokes are still funny, based on my Eigentaste vector.

    Now, the In Soviet Russia jokes are soooo 2003.

    --
    If only we could fall into a woman's arms without falling into her hands
  33. Re:It's 2008 years old by orkysoft · · Score: 1

    It was discovered in the year 2000, and estimated to be 2000 years old, so now it is estimated to be 2008 years old?

    --

    I suffer from attention surplus disorder.
  34. 75 Jupiter masses? by Corf · · Score: 2, Funny

    That seems like such an arbitrary unit of measurement.

    Let's go with SI units here, people. We are looking at no fewer than 1.6953x10^27 Volkswagen Beetles.

    --
    The pain was excruciating and the scarring is likely permanent, but that just means it's working.
  35. Genesis Planet? by primenerd · · Score: 1

    I hope they didn't use proto-matter!

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  36. Overachiever by thewiz · · Score: 1

    This little guy has his stuff together, knows how to consolidate disparate parts, and is on the ball!

    --
    If "disco" means "I learn" in Latin, does "discothèque" mean "I learn technology"?
  37. HL Tau by Chicken_Kickers · · Score: 1

    HL Tau eh? Quick, direct the SETI people to listen to the system. I wager they will hear something along the lines of join us for the greater good or something simialr.