Youngest Planet Discovered
qazsedcft writes "BBC is reporting that Astronomers have discovered what appears to be the youngest planet, being less than 2000 years old. If this proves to be true it could challenge our models of solar system formation."
It's about a thousand year's shy of being middle aged. After all, the earth is approximately 6000 years old.
Maybe it's just the Magrathean's hard at work? Are there any white holes nearby for the collection of raw materials?
Inquiring minds really want to know. And so does Planet Weekly magazine.
This astronomy child porn has to stop! Before you know it, these 'astronomers' will be cruising the galaxy trying to probe every new planet they find!
Support NYCountryLawyer RIAA vs People
I think the article submitter/BBC has it wrong about changes to theories. Science is about discovery. How about this discovery introduces new wonders of our universe? Imagine - being able to even detect a plant and then determine that is even 2000 years old - that is the real story!
Management is doing things right; leadership is doing the right things. - Peter F. Drucker
Youngest KNOWN Planet Discovered
____
~ |rip/\/\aster /\/\onkey
Errr, I meant younger. Jesus also occasionally switches the meanings of words to their opposites.
So that would be turtle first, then elephants, then the flat bit.
Makes sense.
(apologies for reading TFA, I'm new here)
simon
According to the article, the proto-planet is 100,000 years old. It MIGHT be around 2,000 years old but there is no way to confirm that. It is more likely that the age of the proto-planet is more in line with the age of the star at 100,000 years. Space.com also reports that this planet is 100,000 years old. -- "The group, led by Jane Greaves of the University of St. Andrews in Scotland, found the 100,000-year-old fetal planet about 520 light-years away in the constellation Taurus "The new object, designated HL Tau b, is the youngest planetary object ever seen," said Anita Richards, an astronomer at the U.K. Jodrell Bank Centre for Astrophysics. Richards, who worked with Greaves' team to describe the infant planet, said it's just 1 percent as old as the young planet found in orbit around the star TW Hydrae last year."
I think Captain Planet is the youngest planet alive. source
Flowers, my ass! When you have a baby you're supposed to hand out cigars. Where's my cigar, dammit?
In related news, they've discovered the smallest black hole yet with a mass of only 3.8 times the sun's mass, and a diameter of only 24 km (that's about fifteen miles).
So is this black ho the baby planet's momma?
mcgrew's razor: Never attribute to stupidity that which can be explained by greedy self-interest
Not much chance of becoming a non-planet like Pluto - it's 14 times the mass of Jupiter, so it would have to break up into lots of smaller planets for that to happen.
Donte Alistair Anderson Roberts - hi son!
Karma: Chameleon
Yeah, that's right, the ones with a hole in them...
Sometimes a planet is just a planet.
rj
"The ball of dust and gas, which is in the process of turning into a Jupiter-like giant, was detected around the star HL Tau, by a UK team." Well, then... it's obvious the planet is being formed for The Greater Good through advanced technology. We can disregard the data, it's not a natural planetary formation.
Bah, I bet it is just a (galaxy) fed pretending to be young. :p
Carbon based humanoid in training.
You have to take into account how many light years away it is, for all I know it could be older than the earth it just looks younger. Maybe I can sell a new beauty product for women, all they have to do is move so many light years away that they actually look younger than they really are, I'm sure someone will buy it.
thank God the internet isn't a human right.
That planet better get off my lawn!
<shakes-fist/>
SpyDock: Scientific Python in a Docker container
you know, these young Earth jokes stopped being funny about a hundred years ago. you're not clever, you're not witty, and if you're not actually attempting to be, you're just sad and pathetic
"I disapprove of what you say, but I will defend to the death your right to say it." - Evelyn Beatrice Hall, re Voltaire
Darn right. Everyone knows the Earth isn't young, it's flat.
You can't talk about Wikipedia's flaws on Wikipedia
Young Earth jokes couldn't possibly be that old; Creationists have only been around for 20 years or so.
(Wet blankets on the other hand...)
I just read Slashdot for the articles.
Did BBC get slashdoted ? It loads awfully slow.
If the discovery can "challenge our models of solar system formation", how did they compute the age of the planet ? Wasn't that computation dependent on the current "models of solar system formation" ?
Every year you get older, they stay the same age.
He was last seen fleeing through the constellation of Taurus at the speed of light in order to avoid paying alimony.
Apparently... HZ Tau is also already married.
Mit der Dummheit kämpfen Götter selbst vergebens
This just means that business is booming for Magrathea!
Why, President Clinton, I didn't realize that you swing that way...
"I'm just here to regulate funkiness."
Not much chance of becoming a non-planet like Pluto - it's 14 times the mass of Jupiter, ...
...
But there is the possibility that it'll go the other way, by accreting enough mass to graduate and become a small star.
Stick around for a few hundred thousand years, and find out
Those who do study history are doomed to stand helplessly by while everyone else repeats it.
Huh. If that black hole is the planet's mama, then we should definitely get that planet that one t-shirt that says I tore mommy a new one!
but have you considered the following argument: shut up.
Wonder how Velikovsky would have taken this news?
http://en.wikipedia.org/wiki/Immanuel_Velikovsky
Nope. Young Earth jokes are still funny, based on my Eigentaste vector.
Now, the In Soviet Russia jokes are soooo 2003.
If only we could fall into a woman's arms without falling into her hands
It was discovered in the year 2000, and estimated to be 2000 years old, so now it is estimated to be 2008 years old?
I suffer from attention surplus disorder.
That seems like such an arbitrary unit of measurement.
Let's go with SI units here, people. We are looking at no fewer than 1.6953x10^27 Volkswagen Beetles.
The pain was excruciating and the scarring is likely permanent, but that just means it's working.
I hope they didn't use proto-matter!
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
This little guy has his stuff together, knows how to consolidate disparate parts, and is on the ball!
If "disco" means "I learn" in Latin, does "discothèque" mean "I learn technology"?
HL Tau eh? Quick, direct the SETI people to listen to the system. I wager they will hear something along the lines of join us for the greater good or something simialr.